Sclerotinia sclerotiorum-resistant gene, molecular marker closely linked with sclerotinia sclerotiorum-resistant gene and application
By developing the sclerotinia resistant gene qSCL2.3 and its tightly linked molecular markers, and using CAPs marker sites to design primers for PCR amplification and enzyme digestion, the problem of scarce sclerotinia resistant germplasm resources in sunflower breeding was solved, and efficient breeding of disease-resistant varieties was achieved.
Patent Information
- Application Number
- CN202510825906.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-19
- Publication Date
- 2026-01-02
AI Technical Summary
The lack of existing sunflower germplasm resources that are immune or highly resistant to sclerotinia stem rot limits the development of sunflower sclerotinia resistant breeding programs.
A molecular marker for the anti-sclerotinia sclerotinia gene qSCL2.3 and its close linkage was developed. Primer combinations were designed using CAPs marker sites for PCR amplification and MaeII digestion. The length of the digested fragments was detected to distinguish between resistant and susceptible genotypes.
It improved the efficiency and accuracy of selecting genes resistant to sclerotinia stem rot in sunflower breeding, shortened the breeding cycle, and significantly accelerated the breeding process of new sclerotinia stem rot resistant varieties.
Smart Images

Figure CN121249935A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of crop molecular genetics and breeding, and particularly relates to a sclerotinia resistance qSCL2.3, a molecular marker closely linked thereto and application thereof. BACKGROUND
[0002] Sclerotinia sclerotiorum is a worldwide disease that seriously harms and is difficult to control, can infect more than 400 plants, and is one of the most important diseases affecting the yield and quality of sunflower, with the yield loss caused by the sclerotinia disease being about 10-20% per year, and the yield loss being more than 80% or even zero yield in serious cases. Breeding a sclerotinia-resistant variety is the most direct, economic, effective and environmentally friendly measure to reduce the harm of the sclerotinia disease. However, so far, no immune or highly sclerotinia-resistant germplasm resource has been found, which limits the development of sunflower breeding work against the sclerotinia disease. Therefore, it is urgent to carry out sunflower sclerotinia-resistant germplasm identification, to excavate key genes against the sclerotinia disease, and to create new sclerotinia-resistant germplasm and breed new sunflower varieties resistant to the sclerotinia disease by means of modern breeding techniques. SUMMARY
[0003] The application aims to provide a sclerotinia resistance qSCL2.3, a molecular marker closely linked thereto and application thereof.
[0004] To achieve the above-mentioned purpose, the technical scheme adopted by the application is as follows:
[0005] A sclerotinia resistance gene, the sclerotinia resistance qSCL2.3 is located in the region of 0.82 Mb of the 2nd chromosome of sunflower (Chr02:122250375-Chr02:1223469901)
[0006] A molecular marker closely linked to the sclerotinia resistance, the molecular marker is a CAPs marker site in the region of the 2nd chromosome of sunflower (Chr02:122250375-Chr02:1223469901), and the nucleotide sequence thereof is shown as SEQ ID NO. 1.
[0007] Application of the molecular marker, the application of the molecular marker in breeding sunflower varieties carrying the sclerotinia resistance qSCL2.3.
[0008] A primer for detecting the molecular marker closely linked to the sclerotinia resistance qSCL2.3, the primer combination is shown by the base sequence in SEQ ID NO. 2 and SEQ ID NO. 3; wherein the forward primer F sequence of SEQ ID NO. 2 is 5'-ATTACAACTATCCAAAAGG-3', and the reverse primer R sequence of SEQ ID NO. 3 is 5'-GTTCTTACTGTTTGTTAGTAGT-3'.
[0009] The application of the primer in breeding sunflower varieties carrying the antibacterial and nuclear disease gene.
[0010] Genomic DNA of single plants in a sample population is extracted, PCR amplification is carried out on the genomic DNA using the primer combination, and the amplification product is subjected to MaeII enzyme digestion; if the length of the fragments after enzyme digestion is 414 bp and 143 bp, it indicates that the sunflower sample detected carries the antibacterial and nuclear disease qSCL2.3, and if the length of the fragments after enzyme digestion is 557 bp, it indicates that the sunflower sample detected does not carry the antibacterial and nuclear disease qSCL2.3.
[0011] A method for breeding sunflower varieties resistant to the antibacterial and nuclear disease:
[0012] 1) Extracting genomic DNA of sunflower samples;
[0013] 2) Using the primer combination to perform PCR amplification on the genomic DNA of the sunflower samples;
[0014] 3) The amplification product is subjected to MaeII enzyme digestion, and the length of the fragments obtained is 414 bp and 143 bp, indicating that the sunflower sample detected carries the antibacterial and nuclear disease qSCL2.3.
[0015] The beneficial effects of the present application:
[0016] The antibacterial and nuclear disease gene is obtained by hybridizing the sunflower disease-resistant inbred line C6 and the disease-susceptible inbred line B728, and deriving 178 F 5:6 Recombinant inbred lines, genotypes of parents and offspring populations are detected using SLAF-seq, and an antibacterial and nuclear disease gene WRKY48 is located from C6, the obtained antibacterial and nuclear disease gene WRKY48 can be applied in sunflower breeding, and in order to improve the selection efficiency and accuracy of the gene in the breeding process, shorten the breeding period, and further obtain a molecular marker closely linked to qSCL2.3, the application method of the antibacterial and nuclear disease gene in the breeding process of new sunflower varieties is as follows:
[0017] 1. The molecular marker obtained in the present application is closely linked to the antibacterial and nuclear disease qSCL2.3, and the obtained antibacterial and nuclear disease gene is identified as a new gene located in sunflower varieties, which can be applied in sunflower disease-resistant breeding, and the application of the present application can significantly improve the utilization efficiency of qSCL2.3.
[0018] 2. The molecular marker provided in the present application is developed based on the results of second-generation resequencing and verified by first-generation sequencing, and the results are accurate and specific.
[0019] 3. The molecular marker provided by the present application is located in the mapping region of the disease-resistant qSCL2.3, specifically, the second chromosome of the region, and is closely linked to qSCL2.3 in genetics, and the marker has a high degree of co-segregation with the gene.
[0020] 4. The molecular marker provided by the present application is a CAPs marker, which has good detection polymorphism, can be accurately distinguished by agarose gel electrophoresis, has low application cost, simple operation and high accuracy. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 The genetic linkage map of 6059 polymorphic SNPs between 178 RILs of B728 and C6 and their 17 chromosome parents is provided for the embodiments of the present application.
[0022] Figure 2 The high-resolution genetic linkage map for controlling lesion length (LL) and lesion area (LA) in the RIL population provided for the embodiments of the present application; wherein the black annotation indicates a new site found in this survey; the chromosome position reflects the calculated recombination frequency.
[0023] Figure 3 The CAPs molecular marker development of sunflower antibacterial nucleus disease qSCL2.3 is provided for the embodiments of the present application; wherein A is the DNA sequence polymorphism and enzyme cutting site of the parents; B is the detection of 10 sunflower inbred line target gene polymorphism using CAPs marker; C is the 10 sunflower inbred line resistance identification of sclerotinia stem rot after 72 hours of infection. R represents disease resistance; S represents disease susceptibility. DETAILED DESCRIPTION
[0024] The specific embodiments of the present application are further described below in conjunction with examples, and it should be noted that the specific embodiments described herein are only for the purpose of illustrating and explaining the present application, and are not limited to the present application.
[0025] Example 1: Development of molecular markers closely linked to antibacterial nucleus disease qSCL2.3
[0026] The present application uses the recombination inbred line population derived by crossing the antibacterial nucleus disease sunflower restorer line C6 (Zhao et al., 2024) and the disease susceptible sunflower maintainer line B728 (Zhao et al., 2024) as materials, and 178 F 5:6 The recombination inbred line (Zhao et al., 2020) is inoculated with S. sclerotiorum by artificial inoculation, and the stem lesion length, leaf lesion area and plant disease index of the population are determined. The genotypes of the parents and the offspring population are detected by SLAF-seq, and after filtering, 4764 SNPs with polymorphism between the parents are obtained for constructing a high-quality genetic map (see Figure 1). The genetic map is 2794 Mb in total length, and contains 17 linkage groups, each of which is 164 Mb in length. Two stem lesion length QTLs, two leaf lesion area QTLs and three plant disease index QTLs were detected on chromosome 2 by using composite interval mapping (see Figure 2 ). Among them, qSCL2.3 located in the range of 0.82 Mb on chromosome 2 controls stem lesion length, leaf lesion area and plant disease index simultaneously, with LOD values of 14.79-19.11, and phenotypic contribution rates of 25.26%-27.22%, and all the disease resistance enhancing genes are from the resistant inbred line C6.
[0027] Then, qSCL2.3 against Sclerotinia sclerotiorum was preliminarily located in the range of 0.82 Mb on chromosome 2 by using composite interval mapping, and all the disease resistance enhancing genes are from the resistant inbred line C6. C6 and B728 were resequenced by using the second-generation resequencing technology, and sequencing data with an average coverage depth of more than 30x were obtained. By comparing the sequences of the two varieties (C6 and B728), it was found that there was a CPAs site in the location region of C6 carrying qSCL2.3 against Sclerotinia sclerotiorum as shown in FIG. (see Figure 3 A). Figure 3
[0028] As can be seen from Figure 3 , qSCL2.3 against Sclerotinia sclerotiorum is located in the range of 0.82 Mb (Chr02: 122250375-Chr02: 1223469901) on chromosome 2 of sunflower variety C6, and the CAPs marker for detecting qSCL2.3 against Sclerotinia sclerotiorum is located in the location region; as can be seen from the figure, the sequence comparison of C6 carrying qSCL2.3 against Sclerotinia sclerotiorum and B728 not carrying qSCL2.3 shows that, compared with B728, C6 has a CAPa enzyme cutting site.
[0029] That is, the enzyme cutting site of CAPa as a molecular marker closely linked to Sclerotinia sclerotiorum is the enzyme cutting site CAAAAACA / GTCAT as shown in SEQ ID NO. 1.
[0030] Further, a pair of primer combinations is designed according to the sequences at both ends of the molecular marker CPAs site closely linked to qSCL2.3 against Sclerotinia sclerotiorum obtained above, and the primer combinations consist of the DNA sequence as shown in SEQ ID NO. 2 and the DNA sequence as shown in SEQ ID NO. 3.
[0031] The sequence of the forward primer Indel-F (SEQ ID NO. 2) is 5'-ATTACAACTATCCAAAAGG-3', and the sequence of the reverse primer Indel-R (SEQ ID NO. 3) is 5'-GTTCTTACTGTTTGTTAGTAGT-3'.
[0032] The genomic DNA of sunflower varieties C6 and B728 was subjected to PCR amplification using the above-obtained primer pair.
[0033] The reaction system was as follows: 10 μL of 2x Taq PCR Master Mix (Aidley PC0902), 0.5 μL of 10 μM of each primer, 1 μL of 100 μg / mL of template DNA, and 8 μL of ddH2O.
[0034] The PCR reaction program was as follows: 5 min of pre-denaturation at 94°C, 30 s of denaturation at 94°C, 30 s of annealing at 58°C, 1 min of extension at 72°C, 32 cycles, 10 min of extension at 72°C, and preservation at 12°C.
[0035] As can be seen from the PCR amplification product, the PCR amplification product of the primer pair contains the CPAs region, and the amplification product carrying the resistance to bacterial blight qSCL2.3 is 414 bp and 143 bp; and the amplification product not carrying the resistance to bacterial blight qSCL2.3 is 557 bp, and thus it can be seen that the primer can well distinguish the genotype of the disease resistance and the disease susceptibility.
[0036] Verification of the molecular marker closely linked to the resistance to bacterial blight qSCL2.3
[0037] Ten selfed lines, TUB, L405R, 7226, C1, C4, C20, C24, 7218, 7220, and B2, were selected as the test materials, and whether the selected varieties contained the disease resistance qSCL2.3 was identified.
[0038] The specific test was as follows:
[0039] Ten selfed lines, TUB, L405R, 7226, C1, C4, C20, C24, 7218, 7220, and B2, were selected as the test materials, and the genomic DNA of each plant was extracted, and PCR amplification was performed using the primer combination SEQ ID NO: 2 / SEQ ID NO: 3. The PCR reaction program was as follows: 5 min of pre-denaturation at 94°C, 30 s of denaturation at 94°C, 30 s of annealing at 58°C, 1 min of extension at 72°C, 32 cycles, 10 min of extension at 72°C, and preservation at 12°C. The amplification product was electrophoresed in a 4% agarose gel, and the test results were recorded by using a gel imaging system, and the amplification results are shown in FIG. B. As can be seen from the amplification results, the genomic DNA of TUB, L405R, 7226, C1, C4, C20, C24, 7218, and 7220 contains the disease resistance qSCL2.3, and the genomic DNA of B2 does not contain the disease resistance qSCL2.3. Figure 3 B as shown. As can be seen from the amplification results, the genomic DNA of TUB, L405R, 7226, C1, C4, C20, C24, 7218, and 7220 contains the disease resistance qSCL2.3, and the genomic DNA of B2 does not contain the disease resistance qSCL2.3. Figure 3The results of gene amplification of B showed that the individuals with 2 fragments of 414 bp and 143 bp in length in the TUB, L405R, 7226 amplification products were resistant materials; the individuals with only one fragment of 557 bp in length were susceptible. The results of the examples showed that the plants carrying the qSCL2.3 resistant to Sclerotinia sclerotiorum could be accurately screened by using the primer combination SEQ ID NO: 2 / SEQ ID NO: 3, and the screening efficiency reached 100%. The results of the examples showed that the development of the marker would accelerate the process of breeding sunflower varieties resistant to Sclerotinia sclerotiorum.
[0040] Then the above 10 test materials were further planted in the laboratory, specifically: full and undamaged seeds were selected, and evenly sown in 7.0 cm x 7.0 cm x 7.5 cm small flowerpots containing equal amount of vermiculite, covered with about 1 cm thick vermiculite after light pressing, and 21 small flowerpots were placed in a 53.5 cm x 27.5 cm x 6.0 cm large box. The test was carried out in an artificial climate chamber, and the parameters of the artificial climate chamber simulation environment were set as follows: light for 14 h, darkness for 10 h, light temperature of 25℃, darkness temperature of 20℃, light intensity of 500 μmol / (m 2 ·s), and relative humidity of 60%. When the sunflower grew four true leaves, the treatment was started, and each treatment was repeated three times.
[0041] From Figure 3 C It can be seen that the seeds carrying Sclerotinia disease showed the following performance, R represents resistance; S represents susceptibility, and in the figure, TUB, L405R, 7226 plants are healthy and not diseased, and the rest are diseased.
[0042] C6 sequence information
[0043] ATGGAAAAGAAACCGGATCATTCAAAGAGTAACTCAGACAATTCAAA
[0044] CATAATGACAAGCACAACATTTT
[0045] CTGATCAGATTCCGGCAGTCTATAGTGGTGTTGGTGGTGGTTTTTTCGA
[0046] TATGCCTCAAGGGTGCTTAGA
[0047] CATGTTAAATTATCAGGACGACGGTGGCTCGTCTCTCTTCGATTTGTTT
[0048] CAACAACCGGACTTGGTACCC
[0049] GATGCAGCCAATATGTTGATCAGGAGAATAAAAG
[0050] GGCTGAGATGGTGAATACACCCA
[0051] CGCAAAACTCTTCTTCCATTTCATGGTCTTCAAACGATGCAGCCAATAT
[0052] TGTTGATCAGGAGAATAAAAG
[0053] CAGATCTGTTCAAGAAGAAGATGATCTTCATGATGGTGATGATGATCA
[0054] AGAAAAAAGTACTACTAACAAA
[0055] CACTTAAAACCCAAAAAGAAGAACCCAAAAAGGCAAAGGGAACCAA
[0056] GATTTGCATTCATGACAAAGACTA
[0057] B728 sequence information ATGGAAAAGAAACCGGATCATTCAAAGAGTAACTCAGACAATTCAAA
[0058] CATAATGACAAGCACAACATTTT
[0059] CTGATCAGATTCCGGCAGTCTATAGTGGTGTTGGTGGTGGTTTTTTCGA
[0060] TATGCCTCAAGGGTGCTTAGA
[0061] CATGTTAAATTATCAGGACGACGGTGGCTCGTCTCTCTTCGATTTGTTT
[0062] CAACAACCGGACTTGGTACCC
[0063] GAACAAAAACATCATCTTCTACCACCTGTTTCCACCGTGCCGGAGACG
[0064] GCTGAGATGGTGAATACACCCA
[0065] CGCAAAACTCTTCTTCCATTTCATGGTCTTCAAACGATGCAGCCAATAT
[0066] TGTTGATCAGGAGAATAAAAG
[0067] CAGATCTGTTCAAGAAGAAGATGATCTTCATGATGGTGATGATGATCA
[0068] AGAAAAAAGTACTACTAACAAA
[0069] CACTTAAAACCCAAAAAGAAGAACCCAAAAAGGCAAAGGGAACCAA
[0070] GATTTGCATTCATGACAAAGACTA.
Claims
1. An antibacterial cryphonectria gene, characterized by: The anti-phythophthora qSCL2.3 is located in the region of 0.82 Mb in the chromosome 2 (Chr02: 122250375-Chr02: 1223469901) of sunflower.
2. A molecular marker tightly linked to the resistance to ANTHACNOSA GRANDIS of claim 1, characterized in that: The molecular marker is a CAPs marker site in the region of the chromosome 2 (Chr02: 122250375-Chr02: 1223469901) of sunflower, and the nucleotide sequence is shown as SEQ ID NO.
1.
3. Use of a molecular marker according to claim 4, characterized in that: The application of the molecular marker in breeding sunflower varieties carrying the anti-phythophthora gene.
4. A primer for detecting the molecular marker tightly linked to the antimicrobial cryphonectria parasitica qSCL2.3 of claim 2, characterized by: The primer combination is shown as the base sequence in SEQ ID NO. 2 and SEQ ID NO. 3; wherein the forward primer F sequence of SEQ ID NO. 2 is 5'-ATTACAACTATCCAAAAGG-3', and the reverse primer R sequence of SEQ ID NO. 3 is 5'-GTTCTTACTGTTTGTTAGTAGT-3'.
5. Use of a primer according to claim 4, characterized in that: The application of the primer in breeding sunflower varieties carrying the anti-phythophthora gene.
6. Use of a primer combination according to claim 5, characterized in that: The genomic DNA of a single plant in a sample population is extracted, and the primer combination of claim 3 is used for PCR amplification, and the amplification product is subjected to MaeII enzyme digestion; if the length of the fragment after enzyme digestion is 414 bp and 143 bp, it indicates that the detected sunflower sample carries the anti-phythophthora qSCL2.3, and if the length of the fragment after enzyme digestion is 557 bp, it indicates that the detected sunflower sample does not carry the anti-phythophthora qSCL2.
3.
7. A method for breeding sunflower varieties with anti-phythophthora gene, characterized in that: 1) extracting the genomic DNA of sunflower samples; 2) using the primer combination of claim 3 to perform PCR amplification on the genomic DNA of sunflower samples; 3) the amplification product is subjected to MaeII enzyme digestion, and the length of the obtained fragment is 414 bp and 143 bp, indicating that the detected sunflower sample carries the anti-phythophthora qSCL2.3.
Citation Information
Patent Citations
QTLs associated with and methods for identifying whole plant field resistance to sclerotinia
CN103443292A
Rice blast resistance gene Pi67 (t), codominant molecular marker closely linked with the same and application
CN111073991A
Plant pathogen resistance genes
WO2024186806A2