Molecular marker related to early heading of rice and application of molecular marker
By detecting molecular markers with base differences on rice chromosome 6 and using PCR amplification technology to identify plants with early heading potential, the problem of long breeding cycle and low efficiency in existing technologies has been solved, and the accurate identification of early heading phenotype and the improvement of breeding efficiency have been achieved.
Patent Information
- Application Number
- CN202511564090.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-29
- Publication Date
- 2026-01-02
AI Technical Summary
Existing technologies make it difficult to accurately and efficiently utilize the Hd1 gene for rice breeding, resulting in long breeding cycles, low efficiency, and potential impact on yield.
This invention provides a molecular marker associated with early heading in rice. Based on the Nipponbare IRGSP-1.0 genome sequence, the marker detects the base differences between bases 9281094 and 9336488 on chromosome 6 and performs PCR amplification using primer sets F1, F2, and R1 to identify homozygous mutants, heterozygotes, and wild types, thus achieving accurate identification of the early heading phenotype.
Accurate identification of early-heading potential plants in the early stages of rice growth shortens the breeding cycle, improves breeding efficiency, avoids the waste of long-term phenotypic observation, and significantly improves breeding efficiency.
Smart Images

Figure CN121249945A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of plant molecular biology technology, and particularly relates to a rice early heading related molecular marker and application thereof. BACKGROUND
[0002] Rice is an important food crop, however, the expansion of rice planting area is limited, therefore, it is crucial to improve the yield per unit and breeding efficiency. Different rice regions face different production limitations. In rice regions with limited growth season, it is difficult to plant crops in succession; in rice-wheat and rice-oil double cropping regions, the short intercropping period makes it difficult to sow the next crop in time. Therefore, breeding early or super-early maturing varieties with strong adaptability is an effective way to improve the multiple cropping index and total yield. The key to achieving this goal lies in precisely regulating the heading date of rice. The heading date is a complex quantitative trait affected by the environment, which directly determines the regional and seasonal adaptability of varieties and affects the final yield and quality. Traditional breeding methods based on phenotypic selection are low in efficiency and easily disturbed by the environment, which is difficult to meet the needs of efficient breeding.
[0003] Under this background, molecular marker-assisted breeding shows significant advantages. This technology uses molecular markers that are closely linked or co-segregated with target genes to quickly and accurately identify the genotype of the target gene at an early stage of the plant, thereby achieving directional selection of the target trait and greatly shortening the breeding cycle.
[0004] Among the many genes that control the heading date of rice, Hd1 is one of the core regulatory factors. Existing studies have shown that Hd1 , Ghd7 , DTH8 and PRR37 are key genes that regulate the heading date. However, the function of Hd1 is complex, and its complete inactivation can significantly advance the heading date, but often leads to a significant decrease in yield. This indicates that Hd1 the simple loss of function of is not a viable strategy to obtain ideal early maturing traits, and it plays an important role in maintaining yield.
[0005] Based on the important influence of Hd1 on the heading date and yield of rice, how to accurately and efficiently use the characteristics related to Hd1 for rice breeding has become a key problem that needs to be solved in the field of rice breeding at present.
[0006] Based on the important influence of Hd1 on the heading date and yield of rice, how to accurately and efficiently use the characteristics related to Hd1 for rice breeding has become a key problem that needs to be solved in the field of rice breeding at present. SUMMARY
[0007] In view of the demand for rice breeding screening by molecular markers in the prior art, the application provides a rice early heading related molecular marker and application thereof.
[0008] The specific technical scheme is as follows: In a first aspect, the application provides a rice early heading related molecular marker, which is 55.394 kb of bases located between the 9281094th base and the 9336488th base of the 6th chromosome of rice, and the difference between the molecular marker bases is X or Y, based on the genomic sequence of Nipponbare IRGSP-1.0 version. X represents that the molecular marker bases are completely identical to the base sequence of the Nipponbare IRGSP-1.0 version genome; Y represents that the molecular marker bases are the inverted sequence of the Nipponbare IRGSP-1.0 version genome base sequence.
[0009] The inversion refers to a chromosome structure variation that the segment is inverted by 180° and then reconnected after the breakage of the 9281094th base to the 9336488th base of the 6th chromosome of rice.
[0010] Further, the phenotype of the early heading of rice is that the heading stage is more than 5 days earlier than the normal wild type control.
[0011] Further, the primer set for amplifying the molecular marker comprises primer F1, primer F2 and primer R1. The nucleotide sequence of the primer F1 is shown in SEQ ID NO. 1, the nucleotide sequence of the primer F2 is shown in SEQ ID NO. 2, and the nucleotide sequence of the primer R1 is shown in SEQ ID NO. 3.
[0012] In a second aspect, the application provides a primer set for detecting the above-mentioned rice early heading related molecular marker, which comprises primer F1, primer F2 and primer R1. The nucleotide sequence of the primer F1 is shown in SEQ ID NO. 1, the nucleotide sequence of the primer F2 is shown in SEQ ID NO. 2, and the nucleotide sequence of the primer R1 is shown in SEQ ID NO. 3.
[0013] In a third aspect, the application provides the application of the above-mentioned molecular marker or the above-mentioned primer set in rice molecular marker assisted breeding.
[0014] In a fourth aspect, the application provides the application of the above-mentioned molecular marker or the above-mentioned primer set in screening whether the rice hybrid offspring has the early heading phenotype and / or is in a heterozygous state in rice breeding resources.
[0015] Further, the application approach is as follows: (1) extracting the genomic DNA of the rice to be detected; (2) using the genomic DNA of the rice sample to be detected as a template, performing PCR amplification using the primer set, and detecting the 9281094th base to the 9336488th base on the 6th chromosome of the genomic DNA of the rice sample to be detected by 1%-2% agarose gel electrophoresis.
[0016] Further, if a 570bp band is detected in the rice sample to be detected, it indicates that the rice to be detected is an early heading homozygous mutant and has an early heading phenotype. If a 688bp band is detected in the rice sample to be detected, it indicates that the rice to be detected is a wild-type homozygote and does not have an early heading phenotype. If 570bp and 688bp bands are detected in the rice sample to be detected, it indicates that the rice to be detected is a heterozygote and does not have an early heading phenotype.
[0017] Further, the rice is Jinjian 818.
[0018] Further, the present application provides the following four groups of genomic sequences: (1) a 688bp sequence before and after the 9281094th base on the 6th chromosome of the wild-type rice, and the nucleotide sequence is shown as SEQ ID NO. 5.
[0019] (2) a 704bp sequence before and after the 9336488th base on the 6th chromosome of the wild-type rice, and the nucleotide sequence is shown as SEQ ID NO. 6.
[0020] (3) a 570bp sequence before and after the 9281094th base on the 6th chromosome of the mutant rice, and the nucleotide sequence is shown as SEQ ID NO. 7.
[0021] (4) a 822bp sequence before and after the 9336488th base on the 6th chromosome of the mutant rice, and the nucleotide sequence is shown as SEQ ID NO. 8.
[0022] In a fifth aspect, the present application provides a kit for detecting early heading of rice, characterized in that the kit comprises a primer set for amplifying a rice early heading-related molecular marker: primer F1, primer F2 and primer R1. The nucleotide sequence of the primer F1 is shown as SEQ ID NO. 1, the nucleotide sequence of the primer F2 is shown as SEQ ID NO. 2, and the nucleotide sequence of the primer R1 is shown as SEQ ID NO. 3.
[0023] Compared with the prior art, the present application has the following beneficial effects: The present application canHd1 The early heading potential rice plants can be accurately identified at the early growth stage of the rice without waiting for the later phenotypes such as heading, so that the breeding cycle is greatly shortened, the time and labor consumed due to long-time observation of the phenotypes in the traditional breeding mode are avoided, and the breeding efficiency is significantly improved.
[0024] The detection method provided by the application can clearly distinguish whether the to-be-tested rice sample is a homozygous mutant, a wild-type homozygote or a heterozygote. The clear classification of genotypes provides a clear basis for the directional improvement of rice varieties. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 It is a schematic diagram of the structural variation of the 6th chromosome of the mutant in Example 1.
[0026] Figure 2 It is the identification of the homozygous wild type, homozygous inversion mutant and heterozygous genotype in Example 1; wherein lane 1 is a homozygous inversion mutant, lanes 3 and 6 are heterozygous genotypes, and lanes 2, 4, 5, 7 and 8 are homozygous wild types.
[0027] Figure 3 It is the field phenotype of the homozygous wild type, homozygous inversion mutant and heterozygous genotype in Example 1.
[0028] Figure 4 It is the heading stage of the homozygous wild type, homozygous inversion mutant and heterozygous genotype in Example 1.
[0029] Figure 5 It is the field phenotype identification of the inversion mutant hybrid offspring after the backcross in Example 2, and the single plant indicated by the arrow is an early heading phenotype.
[0030] Figure 6 It is the molecular identification of the single plant PCR product in Example 2, Figure 5 The molecular identification of the single plant indicated by the arrow is seen in lanes 4 and 6, which is a homozygous mutant; lanes 1, 7 and 8 are homozygous wild types; and the other lanes are heterozygous genotypes.
[0031] Figure 7 It is the heading stage of each single plant in Example 2. DETAILED DESCRIPTION
[0032] The application will be further described below in combination with specific embodiments, and the following enumeration is only a specific embodiment of the application, but the protection scope of the application is not limited to this.
[0033] In the following examples, the nucleotide sequence of primer F1 is shown in SEQ ID NO. 1.
[0034] SEQ ID NO. 1: 5-TTAGGCGCACACAGTTCAAG-3.
[0035] The nucleotide sequence of primer F2 is shown as SEQ ID NO. 2.
[0036] SEQ ID NO. 2: 5-TCGACTTGACACCCCCTTAC-3.
[0037] The nucleotide sequence of primer R1 is shown as SEQ ID NO. 3.
[0038] SEQ ID NO. 3: 5-TTTTGCGACTCAGAGACACG-3.
[0039] The nucleotide sequence of primer R2 is shown as SEQ ID NO. 4.
[0040] SEQ ID NO. 4: 5-TTGGAGAGGAGAAGCCAAGA-3.
[0041] The nucleotide sequence of wild type rice chromosome 6 physical position 9281094 base pairs before and after a total of 688 bp sequence is shown as SEQ ID NO. 5.
[0042] SEQ ID NO. 5: TTAGGCGCACACAGTTCAAGAGAAGGAGATGGCCGAAACAACTCGAAACAAAATTCATCTTCAGCCCGATAATCAAACGCCCAGACACACACGGAGAGGGGAGTGGAGGGAGAGGTGGCGAACCGGGGAGCAGGGAGGCCTGGCGGAGCGACTCCTCGGCGAAGGCCCGGACGTCGCGGGCGGTGTCGAGCGTCGCCGTCAGGCACTCCACCAGCCACCTCTGGTCGCCGTCCCCCGCGCCCGCCGCCATATCGCCCACCGACCCACCTACCCACCACCGCCTAGGATTCGAGCTCCCTCCTCCCGCGCACGCGCGCGCGCTCCCCTGTTTCGCTGGCTTCCCGCGCAACCTTCACGGGGATGGATTTTGGTTTCGAATGGGGAGGGATCACGCGGCGAGGCGGCGGGATCCGCGCGGGTTTTGGCTAGGGTTTTTATAGGAGATGGGGAAACAAACGAGGTGGTGGCGGCCGAGAAGAAGAGGGGTAGCGACTAGCGAGTCAAGTGTCGGGAGGAAAGAAGGTTTTGTGTGGGCCCACCGCTCCGGTGTTCCGTGGCCGGTGGGGCCCATCACAGGCTGGCGGCAGGTCAGGTACAGCCTTAATGGGCCTAGGCACCATACGGGTAGGACTGCTAAGGGAAAAAGTCCAGATTTAGTCCCTCTAATTCGTGTCTCTGAGTCGCAAAA.
[0043] The wild type sequence of 704 bp at the 5' and 3' of the 9336488th base of the physical position of chromosome 6 of rice is shown in SEQ ID NO. 6.
[0044] SEQ ID NO. 6: TCGACTTGACACCCCCTTACTATTAGTATACTCTACACTCAAACTCCCCAGGACAAAAACACCGTGACTTTCCCCTCCCTAGCTCCTTCCAAAAAACACTCACAAAATTCCACAAGAGCCATGCGAGGTAGAGGAACAGGAGAAGACGCATACACACACGACACATAGAGAGAGAGGACAAACACAATAGCTTGGATCGATAGACTTGTCCATGTGGTGCAAGCTAAAGCTACTACTACCACAAGCAAGGCTACTTCGTTCATGAATTATAATTTTGGTGGCAACGTGTTCGACCAGGAGGTTGGAGTTGGAGGCGAAGGAGGAGGAGGAGGAGAGGGGAGCGGCTGCCCATGGGCGCGGCCGTGCGACGGGTGCCGCGCGGCGCCGAGCGTGGTGTACTGCCGCGCGGACGCGGCGTACCTGTGCGCGTCGTGCGACGCGCGGGTGCACGCGGCCAACCGCGTGGCGTCCCGCCACGAGCGCGTGCGGGTGTGCGAGGCCTGCGAGCGCGCCCCGGCCGCGCTCGCGTGCCGCGCCGACGCCGCCGCGCTGTGCGTGGCGTGCGACGTGCAGGTGCACTCCGCGAACCCGCTCCCGGCCATCACCATCCCGGCCACCTCCGTCCTCGCTGAGGCGGTGGTGGCCACCGCCACCGTCCTCGGCGACAAGGACGAGGAGGTGGACTCTTGGCTTCTCCTCTCCAA.
[0045] The mutant rice chromosome 6 physical position 9281094 base pairs before and after a total of 570bp sequence, the nucleotide sequence is shown as SEQ ID NO. 7.
[0046] SEQ ID NO. 7: TTAGGCGCACACAGTTCAAGAGAAGGAGATGGCCGAAACAACTCGAAACAAAATTCATCTTCAGCCCGATAATCAAACGCCCAGACACACACGGAGAGGGGAGTGGAGGGAGAGGTGGCGAACCGGGGAGCAGGGAGGCCTGGCGGAGCGACTCCTCGGCGAAGGCCCGGACGTCGCGGGCGGTGTCGAGCGTCGCCGTCAGGCACTCCACCAGCCACCTCTGGTCGCCGTCCCCCGCGCCCGCCGCCATATCGCCCACCGACCCACCTACCCACCACCGCCTAGGATTCGAGCTCCCTCCTCCCGCGCACGCGCGCGCGCTCCCCTGTTTCGCTGGCTTCCCGCGCAACCTTCAACATGGACAAGTCTATCGATCCAAGCTATTGTGTTTGTCCTCTCTCTCTATGTGTCGTGTGTGTATGCGTCTTCTCCTGTTCCTCTACCTCGCATGGCTCTTGTGGAATTTTGTGAGTGTTTTTTGGAAGGAGCTAGGGAGGGGAAAGTCACGGTGTTTTTGTCCTGGGGAGTTTGAGTGTAGAGTATACTAATAGTAAGGGGGTGTCAAGTCGA.
[0047] The mutant rice chromosome 6 physical position before and after the 9336488 base is a total of 822 bp sequence, the nucleotide sequence is shown as SEQ ID NO. 8.
[0048] SEQ ID NO. 8: TTTTGCGACTCAGAGACACGAATTAGAGGGACTAAATCTGGACTTTTTCCCTTAGCAGTCCTACCCGTATGGTGCCTAGGCCCATTAAGGCTGTACCTGACCTGCCGCCAGCCTGTGATGGGCCCCACCGGCCACGGAACACCGGAGCGGTGGGCCCACACAAAACCTTCTTTCCTCCCGACACTTGACTCGCTAGTCGCTACCCCTCTTCTTCTCGGCCGCCACCACCTCGTTTGTTTCCCCATCTCCTATAAAAACCCTAGCCAAAACCCGCGCGGATCCCGCCGCCTCGCCGCGTGATCCCTCCCCATTCGAAACCAAAATCCATCCCCGGGTGCAAGCTAAAGCTACTACTACCACAAGCAAGGCTACTTCGTTCATGAATTATAATTTTGGTGGCAACGTGTTCGACCAGGAGGTTGGAGTTGGAGGCGAAGGAGGAGGAGGAGGAGAGGGGAGCGGCTGCCCATGGGCGCGGCCGTGCGACGGGTGCCGCGCGGCGCCGAGCGTGGTGTACTGCCGCGCGGACGCGGCGTACCTGTGCGCGTCGTGCGACGCGCGGGTGCACGCGGCCAACCGCGTGGCGTCCCGCCACGAGCGCGTGCGGGTGTGCGAGGCCTGCGAGCGCGCCCCGGCCGCGCTCGCGTGCCGCGCCGACGCCGCCGCGCTGTGCGTGGCGTGCGACGTGCAGGTGCACTCCGCGAACCCGCTCCCGGCCATCACCATCCCGGCCACCTCCGTCCTCGCTGAGGCGGTGGTGGCCACCGCCACCGTCCTCGGCGACAAGGACGAGGAGGTGGACTCTTGGCTTCTCCTCTCCAA。
[0049] Example 1 Identification of Chromosomal Structural Variations Using gene editing technology, at LOC_Os06g16370 ( Hd1A target site (5-ACCAAAATCCATCCCCGTGA-3; 5-TAGCTTTAGCTTGCACCACA-3) was designed on the promoter of LOC_Os06g16280 and 1, respectively, and a vector was constructed, which was transformed into japonica rice variety Jinjian818 to obtain transgenic materials. At the same time, specific primers F1 (SEQ ID NO. 1), primer F2 (SEQ ID NO. 2), primer R1 (SEQ ID NO. 3) and primer R2 (SEQ ID NO. 4) were designed according to the sequence before and after the target site.
[0050] The genomic DNA of T2 generation gene editing materials was used as a template, and the specific primers F1 / R1, F2 / R2, F1 / F2 and R1 / R2 were used for PCR amplification. Figure 1 The PCR reaction system was as follows:
[0051] The results showed that some materials could be amplified with F1 / R1 and F2 / R2 to obtain corresponding bands, and the corresponding sequences were SEQ ID NO. 5 and SEQ ID NO. 6, indicating that these lines were homozygous wild type; some materials could be amplified with F1 / F2 and R1 / R2 to obtain corresponding bands, and the corresponding sequences were SEQ ID NO. 7 and SEQ ID NO. 8, indicating that these lines were homozygous inversion mutants; Figure 2 Some materials could be amplified with the four primers, indicating that these lines were heterozygous. The homozygous wild type, heterozygous and homozygous mutant materials were planted in the field, and the results showed that the heading stage of homozygous inversion lines was significantly earlier than that of homozygous wild type and heterozygous type. Figure 3 , Figure 4 ).
[0052] Example 2 Development of molecular markers Based on the structural variation of mutant chromosome 6, according to the characteristics of wild type sequence SEQ ID NO. 5 and mutant sequence SEQ ID NO. 7 on one side of the inversion site, the forward primers F1 and F2 and the reverse primer R1 were used to form a co-dominant molecular marker. In homozygous wild type rice, F1 / R1 type bands could be amplified, while in homozygous mutants, F1 / F2 type bands could be amplified, and in heterozygous single plants, F1 / R1 and F1 / F2 type bands could be amplified. Therefore, the combination of the three primers can be used as a co-dominant molecular marker to identify whether the offspring of rice hybridization carries inversion fragments and whether the inversion fragments are homozygous.
[0053] Example 3 Early heading of new rice materials The F2 material is obtained by crossing the inversion mutant with a high-generation japonica rice maintainer line Zhe 8 and selfing, and the F2 single plants are planted in a field to investigate the heading stage Figure 5 ), and the DNA is extracted from the single plants, and the specific primers F1, F2 and R1 in Example 1 are used for PCR identification of the corresponding genotypes.
[0054] The results show that, Figure 5 The PCR results of the single plants indicated by arrows are shown in Figure 6 Lanes 4 and 6 have F1 / F2 band types, and are homozygous single plants, and exhibit the early heading phenotype Figure 7 The PCR results of the other single plants are shown in Figure 6 Lanes 1, 7 and 8 have F1 / R1 band types, and are homozygous wild types; or Figure 6 Lanes 2, 3, 5, 9 and 10 have F1 / R1 and F1 / F2 band types, and are heterozygous types Figure 7 ).
[0055] The rice heading stage phenotype verification is shown in Table 1, all the single plants with detection results of X (single plants 1, 7 and 8) exhibit no early heading, all the single plants with detection results of Y (single plants 4 and 6) exhibit early heading, and the single plants with detection results of Y+X (i.e. heterozygous types) have the same phenotype as the single plants with X, i.e. no early heading. This shows that the inversion sequence (Y) is recessive relative to the normal sequence (X), and when the Y sequence and the X sequence coexist, the phenotype is determined by the X sequence, i.e. no early heading.
[0056] Table 1: Molecular characteristics of rice and heading stage phenotypes
[0057] Note: In order to distinguish the normal sequence from the inversion sequence, the present application defines that X represents that the base sequence of the molecular marker is completely identical to the reference genome based on the genomic sequence of Nipponbare IRGSP-1.0 version, and the sequence corresponds to the phenotype of no early heading; Y represents that the base sequence of the molecular marker is an inversion sequence of the corresponding interval of the reference genome based on the genomic sequence of Nipponbare IRGSP-1.0 version, and the sequence corresponds to the phenotype of early heading.
Claims
1. A molecular marker associated with early heading in rice, characterized in that, Based on the Nipponbare IRGSP-1.0 genome sequence, the molecular marker is a 55.394 kb base located between bases 9281094 and 9336488 on chromosome 6 of rice; the difference in the molecular marker base is X or Y. X indicates that the molecular marker base is identical to the base sequence of the Nipponbare IRGSP-1.0 version genome; Y indicates that the molecular marker base is the inverted sequence of the Nipponbare IRGSP-1.0 version genome.
2. The molecular markers related to early heading in rice as described in claim 1, characterized in that, The early heading phenotype is defined as heading more than 5 days earlier than the normal wild-type control.
3. The molecular markers related to early heading in rice as described in claim 1, characterized in that, The primer set used to amplify the molecular marker includes primer F1, primer F2, and primer R1; The nucleotide sequence of primer F1 is shown in SEQ ID NO.1; The nucleotide sequence of primer F2 is shown in SEQ ID NO.2; The nucleotide sequence of primer R1 is shown in SEQ ID NO.
3.
4. A primer set for detecting molecular markers related to early heading in rice as described in claim 1, characterized in that, The primer set includes primer F1, primer F2, and primer R1; The nucleotide sequence of primer F1 is shown in SEQ ID NO.1; The nucleotide sequence of primer F2 is shown in SEQ ID NO.2; The nucleotide sequence of primer R1 is shown in SEQ ID NO.
3.
5. The application of the molecular marker as described in any one of claims 1 to 3, or the primer set as described in claim 4, in molecular marker-assisted breeding of rice.
6. The application of the molecular marker as described in any one of claims 1 to 3, or the primer set as described in claim 4, in screening rice breeding resources for whether the hybrid offspring have an early heading phenotype and / or are heterozygous.
7. The application according to claim 6, characterized in that, The application method is as follows: (1) Extract genomic DNA from the rice to be tested; (2) Using the genomic DNA of the rice to be tested as a template, PCR amplification was performed using the primer set, and the amplification products from base 9281094 to base 9336488 on chromosome 6 of the genomic DNA of the rice to be tested were detected. If a 570bp band is detected in the amplification product, it indicates that the rice being tested is a homozygous mutant with an early heading phenotype. If a 688bp band is detected in the amplification product, it indicates that the rice being tested is a wild-type homozygote and does not have the early heading phenotype. If the amplification product detects bands of 570bp and 688bp, it indicates that the rice being tested is heterozygous and does not have the early heading phenotype.
8. The application according to claim 6, characterized in that, The rice variety in question is Jinjing 818.
9. A reagent kit for detecting early heading in rice, characterized in that, The kit includes a primer set for amplifying molecular markers related to early heading in rice: primer F1, primer F2, and primer R1; The nucleotide sequence of primer F1 is shown in SEQ ID NO.1, the nucleotide sequence of primer F2 is shown in SEQ ID NO.2, and the nucleotide sequence of primer R1 is shown in SEQ ID NO.3.