Peanut oil content character related gene AhPEX10 as well as molecular marker and application thereof
By using genome-wide association analysis and virus-induced gene silencing technology, the AhPEX10 gene was precisely located and molecular markers were developed, solving the problem of regulating peanut oil content trait and enabling efficient molecular breeding and the cultivation of new peanut varieties with high oil content and stable traits.
Patent Information
- Application Number
- CN202511825147.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2045-12-05
AI Technical Summary
In existing technologies, the study of gene regulation of peanut oil content lacks key genes and their molecular markers, resulting in low breeding efficiency and unstable oil content that is easily affected by the environment, making it difficult to achieve a balance between high yield, disease resistance, and stress resistance.
The AhPEX10 gene was precisely located in peanut using genome-wide association analysis (GWAS), and corresponding molecular markers were developed. Their function was verified using virus-induced gene silencing (VIGS) technology. Combined with multiple statistical models, SNP sites associated with high oil content were screened and applied to marker-assisted selection breeding.
It enables early and precise genotyping, improves breeding efficiency, ensures high oil content and trait stability in new peanut varieties, provides direct gene targets and efficient molecular tools, and enhances breeding results.
Smart Images

Figure CN121249968A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to AhPEX10, a gene related to peanut oil content, its molecular markers, and applications. Background Technology
[0002] The information disclosed in this background section is intended only to enhance some understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art.
[0003] Peanuts (Arachis hypogaea L.) are one of my country's important oilseed and cash crops. my country ranks first in the world in annual peanut production and second in planting area. Peanuts hold a vital position among agricultural products, both in industrial restructuring and in international competition. They account for 25% of my country's total vegetable oil production, but currently, the self-sufficiency rate of vegetable oil is less than 32%, and oilseeds still heavily rely on imports.
[0004] High oil content is an important goal for peanut genetic improvement. Through techniques such as hybridization, mutagenesis combined with marker-assisted selection, a number of high-oil varieties with oil content exceeding 55% have been bred in China. However, the oil content of high-oil peanut varieties currently in production is easily affected by environmental factors and is unstable. Furthermore, there are common problems such as poor coordination between high yield, disease resistance, and stress tolerance. This is closely related to the fact that peanut oil content is a quantitative trait controlled by multiple genes.
[0005] In recent years, with the development of high-throughput sequencing technology, marker-assisted selection (MAG) based on genome-wide association studies (GWAS) and quantitative linkage analysis (QTL mapping) has gradually become an important means of crop trait improvement. GWAS is a highly efficient analytical method based on population genetic diversity. It rapidly locates chromosomal segments or candidate genes affecting trait variation by statistically associating genome-wide single nucleotide polymorphisms (SNPs) and target trait phenotypes. Currently, GWAS-based MAG technology has been widely applied in genotyping and marker-assisted selection breeding of crops such as cucumber (Cucumissativus L.), Arabidopsis thaliana L., and soybean (Glycine max L.). However, key genes and their molecular markers closely linked to and functionally defined traits related to peanut oil content are still very scarce.
[0006] Currently, there are relatively few key regulatory genes and molecular markers for oil content in peanuts, limiting the improvement of molecular breeding efficiency. The genetic basis of peanut oil content is a complex quantitative trait controlled by multiple genes, influenced by additive and dominant effects. In addition to genetic factors, light, temperature, water, nutrients, and cultivation practices also significantly affect the level and stability of peanut oil content, indicating an interaction between genotype and environment. Summary of the Invention
[0007] To address the shortcomings of existing technologies, this invention utilizes genome-wide association analysis, large-scale resequencing, phenotypic identification, and multiple statistical models to locate peanut oil content-related genes, providing a gene AhPEX10 associated with peanut oil content traits, its molecular markers, and their applications in molecular-assisted breeding.
[0008] The technical solution adopted in this invention is as follows: In a first aspect of the invention, an isolated polynucleotide is provided, said polynucleotide encoding peroxisome biogenic factor PEX10 (AhPEX10) associated with the oil content trait of peanut seeds, said polynucleotide being selected from any one of (a) to (c): (a) Polynucleotides as shown in SEQ ID NO: 1; (b) A polynucleotide having at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the sequence shown in SEQ ID NO: 1 and encoding a protein that regulates the oil content of peanut seeds; (c) Hybridized under high stringency conditions with the complementary sequence of the sequence shown in SEQ ID NO: 1 and encodes a polynucleotide that has the function of regulating the oil content of peanut seeds.
[0009] In a second aspect of the invention, a protein is provided, the protein being encoded by the aforementioned polynucleotide.
[0010] In a third aspect of the invention, a recombinant vector is provided, the recombinant vector comprising the aforementioned polynucleotide.
[0011] In a fourth aspect of the invention, a molecular marker is provided for assisting in the screening of peanut germplasm with high oil content, the molecular marker being located at position 286 of SEQ ID NO: 1, and having a base of G or C; wherein the C allele is associated with the high oil content trait.
[0012] When the base is G, the peanut plant carries the HAP1 gene with ordinary or low oil content; when the base is C, the peanut plant carries the HAP2 gene with high oil content.
[0013] In a fifth aspect of the invention, the application of the gene AhPEX10 and / or the molecular marker in peanut genetic improvement is provided, including any of the following applications: Used for identifying, screening, or breeding peanut germplasm with high oil content; Application in the preparation of reagent kits for detecting the oil content of peanuts; It was used as a core marker in marker-assisted selection breeding for high-oil peanuts.
[0014] In a sixth aspect of the invention, a kit is provided for detecting the oil content trait of peanuts or screening peanut germplasm with high oil content, the kit comprising reagents for detecting the molecular marker.
[0015] In one or more embodiments of the present invention, the reagent comprises primer pairs capable of specifically amplifying DNA fragments containing the SNP sites.
[0016] In a seventh aspect of the present invention, a method for identifying, screening or breeding peanut varieties with high oil content is provided, the method comprising: detecting the genotype of the molecular markers in peanut germplasm or plants, and screening out single plants with a genotype of C allele homozygous or heterozygous.
[0017] The method specifically includes the following steps: (1) Obtain genomic DNA from peanut samples to be tested; (2) Detect the genotype of the molecular marker in the genomic DNA; (3) Select individual plants with genotype C allele homozygous or heterozygous.
[0018] In an eighth aspect of the invention, a method for increasing the oil content of peanut seeds is provided, 10. The method includes the step of increasing the expression level of the AhPEX10 gene or the activity of its encoded protein in peanut plants.
[0019] Compared with the related technologies known to the inventors, one of the technical solutions of the present invention has the following beneficial effects: (1) This invention is the first to precisely locate the specific gene AhPEX10 in peanut through genome-wide association analysis (GWAS) and confirm that it is a key factor in regulating seed oil content, filling the gap in the study of the gene’s regulatory function in peanut oil metabolism.
[0020] (2) This invention has discovered a specific SNP molecular marker that is significantly associated with oil content and identified its dominant allele (C). Using this marker, early, rapid and accurate genotyping can be achieved, overcoming the problems of blindness and long cycle of traditional phenotypic selection, and greatly improving breeding efficiency.
[0021] (3) This invention uses virus-induced gene silencing (VIGS) technology to demonstrate that inhibiting the expression of the AhPEX10 gene will significantly reduce the oil content of peanut seeds. This invention confirms the function of the gene from the perspective of reverse genetics and provides a solid scientific basis for the application of molecular markers.
[0022] (4) This invention provides direct gene targets and efficient molecular tools for high-oil peanut breeding, which has important theoretical and practical significance for breeding new peanut varieties with high oil content and stable traits. Attached Figure Description
[0023] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0024] Figure 1 Manhattan plot of peanut multi-trait GWAS.
[0025] Figure 2 A represents the relative expression level of AhPEX10 in different peanut tissues; B represents the relative expression level of AhPEX10 in peanut seeds at different stages; C represents actual images of peanut seeds at different stages of the pegging stage.
[0026] Figure 3 Relative expression levels of AhPEX10 in VIGS silent plants, CK1, CK2 and Model plants.
[0027] Figure 4 AhPEX10 haplotype analysis. Detailed Implementation
[0028] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0029] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, and / or combinations thereof.
[0030] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0031] Example: 1. Mining of AhPEX10, the gene encoding peroxisome biogenetic factor related to peanut oil content. We used 390 resequencing peanut core germplasm resources, covering two major subspecies and five major varieties, from five continents, ensuring high representativeness. Using the BGISEQ-T7 sequencing platform, we performed whole-genome resequencing on all germplasm resources with an average sequencing depth of 20X, obtaining a total of 13.5T of data. Using the Tifrunner genome as a reference genome, we obtained 7.89 million SNPs, covering all 20 chromosomes. Using EMMAx software, we performed genome-wide association analysis with peanut oil content phenotypes, and then used a p-value < 1x10⁻⁶. -6 SNP-associated signaling sites were screened, resulting in 56 candidate sites significantly associated with peanut oil content. In-depth analysis of the candidate gene AhPEX10 (its genome sequence is shown in SEQ ID NO: 7) identified a key SNP site (position 286, G / C base) highly correlated with oil content in its coding sequence (SEQ ID NO: 1). This gene is the candidate gene AhPEX10. Figure 1 ).
[0032] 2. Obtaining the AhPEX10 gene The cDNA and genomic sequences of AhPEX10, as well as the amino acid sequences of the proteins it encodes, were obtained from the Tifrunner reference genome. The cDNA sequence of AhPEX10 (1404 bp) is shown in SEQ ID NO: 1, and the genomic sequence (chr10:112405975-112411873) is shown in SEQ ID NO: 7.
[0033] Primers for cloning the full-length gene were designed based on the gene's cDNA, and then the target gene was amplified.
[0034] F1:ATTCAAAATCTTTTTTTAACATATGAATGG, SEQ ID NO: 2; R1:TCTAGTTTGTGTGTATCATTCAGACTTCTAG, SEQ ID NO: 3.
[0035] The PCR amplification products were then sequenced and compared with the reference cDNA sequence to confirm the accuracy of the cloned sequence. Successful sequence alignment yielded the gene AhPEX10 encoding the peroxisome biogenetic factor. Table 1 shows the PCR reaction components and procedure.
[0036] Table 1
[0037] 3. Analysis of the expression level of gene AhPEX10 in different tissues and developmental stages of peanut. To investigate the expression pattern of AhPEX10 in different peanut tissues, the relative expression levels of AhPEX10 in peanut roots, stems, shoot tips, leaves, flowers, and seeds were detected using qRT-PCR. The results showed that the gene was expressed in all of these tissues, with the highest expression level in the shoot tip, followed by seeds, while the expression levels in roots and flowers were relatively low. Figure 2 A.
[0038] The relative expression levels of AhPEX10 in peanut seeds at six developmental stages after pegging were detected using qRT-PCR. The results showed that the highest expression level was observed in the fourth developmental stage, when lipid accumulation activity was most active. This indicates that the gene is associated with seed lipid accumulation. Figure 2 B and Figure 2 C.
[0039] 4. Application of silencing the AhPEX10 gene in altering peanut oil content (1) As a tetraploid crop with a complex genome, peanut lacks a stable genetic transformation system, which poses many technical challenges to its gene function research. Virus-induced gene silencing (VIGS), as a rapid and efficient transient genetic transformation tool, has been widely used in the functional gene verification of various plants. The function of the gene AhPEX10 was verified using the TRV2-mediated peanut gene silencing system.
[0040] (2) A 202bp fragment of the coding sequence (CDS) of AhPEX10 (shown in SEQ ID NO: 4) was extracted to construct the pTRV2 vector; gene primers for amplification sequences were designed based on the nucleotide sequence of the silenced gene fragment. Simultaneously, specific restriction enzyme sites (BamH1 and XBa1) were added to the primers to construct the pTRV2 vector primers as follows: F:AAGGTTACCGAATTCTCTAGACTTTGTGTAATAGCTGCGGAACG, as shown in SEQ ID NO: 5; R:CGTGAGCTCGGTACCGGATCCAGTTCCATACTCAGAAGATGAAGAATCA, as shown in SEQ ID NO: 6.
[0041] (3) The pTRV2 silencing vector with BamH1 and XBa1 restriction enzyme sites was selected, and the plasmid was double-digested. Using the CDS fragment of the gene as a template, silencing primers with restriction enzyme site sequences were used for amplification. After purification, the amplified product was ligated via homologous recombination and transformed into DH5α competent cells, followed by kanamycin resistance screening. Positive clones were detected using universal primers, and the recombinant plasmid with the correct sequence, pTRV2-AhPEX10, was selected for subsequent experiments.
[0042] (4) The recombinant plasmid was transformed into GV3101 competent cells by freeze-thaw method, and kanamycin / rifampin double antibody screening was performed. The above universal primers were used for positive detection, and the correct monoclonal antibody solution was selected for subsequent experiments.
[0043] (5) Agrobacterium-mediated vacuum infiltration method for infecting peanut seedlings Prepare a solution of 0.5 M MES (pH=5.7), 1 M MgCl2, and 150 mm acetylsylgenin (AS) in advance, filter to sterilize, and store at 4°C. Take out Agrobacterium GV3101 containing TRV1, TRV2, and TRV2-Ahpex and thaw it on ice. Transfer 10 μL of the bacterial culture to a test tube containing 3 mL of LB liquid medium [Kan + Rif] and incubate overnight at 180 rpm / 28°C with a shaker. Transfer 1 mL of the activated bacterial culture to 500 mL of LB liquid medium [Kan + Rif] and incubate overnight at 200 rpm / 28°C with a shaker for propagation. Shake until the OD600 value is approximately 1.5. Pour the bacterial culture into a 50 mL centrifuge tube, centrifuge at 4000 rpm for 10 min, discard the supernatant, and collect the bacterial cells. Wash the bacterial cells twice with sterile water, centrifuge at 3500 / 4000 rpm for 5 min, and discard the supernatant. Resuspend the bacterial cells in the prepared infection solution and adjust the OD value to 1.0. Incubate at room temperature in the dark for 2-3 hours. Mix equal volumes of TRV1 and TRV2-AhPex; simultaneously mix equal volumes of TRV1 and empty TRV2 as a control group. Randomly divide peanut seedlings into two groups: one group is immersed in the mixed bacterial suspension of TRV1 and TRV2-AhPex, and the other group is immersed in the mixed bacterial suspension of empty TRV1 and TRV2. Place both groups of bacterial suspensions containing peanut seedlings into a vacuum chamber, start the vacuum pump and monitor the pressure gauge reading. Start timing when the pressure reaches 0.080 MPa, maintain the vacuum state for about 210 seconds, open the vent valve of the vacuum chamber, and remove the container after the internal and external pressures have balanced.
[0044] Remove the infected peanut seedlings and place them in a germination tray (lined with moistened absorbent cotton). Maintain a room temperature of 25°C and incubate in the dark for 12 hours. Then, place the peanut seedlings in a 12-cell plastic hydroponic container for hydroponic cultivation. Change the nutrient solution (Hoagland's) every 4-5 days.
[0045] (6) Identification of oil content trait after gene silencing To evaluate the effectiveness of VIGS silencing, crude fat content was determined using Soxhlet extraction on fresh mature peanuts three months after silencing. Analysis showed that the crude fat content of AhPex-silenced plants was significantly lower, as shown in Table 2. The expression level of AhPEX10 was detected using qRT-PCR, and the results showed a significant decrease in AhPEX10 expression in silenced plants, as shown in Table 2. Figure 3 .
[0046] Table 2
[0047] Note: Gene silencing group: P1, P9, P32, P45, P49, P57; negative control group: CK1, CK2; untreated wild-type control group: Model.
[0048] 5. Haplotype analysis Genotyping was performed based on the SNP of the regulatory gene AhPEX10. A change from G to C occurred at the corresponding position on the transcribed cDNA (SEQ ID NO: 1, position 286), resulting in an amino acid alteration. Specifically, sequencing was performed on 390 peanut varieties. Of these, 252 varieties had the genotype HAP1, which had lower oil content, and 138 varieties had the genotype HAP2, which had higher oil content. The average oil content of the HAP2 haplotype population was significantly higher than that of the HAP1 population (P<0.01). Figure 4 .
[0049] Summarize: The results above demonstrate that the AhPEX10 gene has significant research value in developing new peanut varieties with higher oil content. Genome-wide association studies (GWAS) were used to locate and analyze candidate genes related to oil content, enabling gene mining and functional screening. This identified genes determining peanut oil content traits and investigated their biological functions, providing germplasm resources for breeding high-oil-content peanuts and contributing to modern molecular breeding techniques for peanuts.
[0050] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A molecular marker for assisting in the screening of peanut germplasm with high oil content, characterized in that, The molecular marker is an SNP located at position 286 of the polynucleotide shown in SEQ ID NO: 1, with the base C. The C allele is associated with the high oil content trait.
2. The use of the molecular marker according to claim 1 in any of the following aspects: Used for identifying, screening, or breeding peanut germplasm with high oil content; Application in the preparation of reagent kits for detecting the oil content of peanuts; It was used as a core marker in marker-assisted selection breeding for high-oil peanuts.
3. A kit for detecting peanut oil content or screening peanut germplasm with high oil content, characterized in that, The kit contains reagents for detecting the molecular marker of claim 1.
4. A method for identifying, screening, or breeding peanut varieties with high oil content, characterized in that, The method includes: detecting the genotype of the molecular marker as described in claim 1 in peanut germplasm or plants, and screening out single plants with a genotype of C allele homozygous or heterozygous.
5. The method for identifying, screening, or breeding high-oil-content peanut varieties as described in claim 4, characterized in that, The method specifically includes the following steps: (1) Obtain genomic DNA from peanut samples to be tested; (2) Detect the genotype of the molecular marker in the genomic DNA; (3) Select individual plants with genotype C allele homozygous or heterozygous.
6. A method for increasing the oil content of peanut seeds, characterized in that, The method includes the step of increasing the expression level of the AhPEX10 gene or the activity of its encoded protein in peanut plants; the AhPEX10 gene is encoded by the polynucleotide shown in SEQ ID NO: 1.
Citation Information
Patent Citations
Peanut oil content related major quantitative trait gene locus and application thereof
CN115862731A
Gene AhWRI1 for regulating and controlling oil content of peanut and application of gene AhWRI1
CN116286849A
Development of molecular markers to select high oleate peanut(arachis hypogaea l.)
KR1020120050840A
Increased oil content by increasing YAP1 transcription factor activity in oleaginous yeasts
US20120329160A1