Wickersenula anomala as well as fungicide and application thereof

Abstract

The invention belongs to the technical field of microbial fermentation, and particularly relates to Wickers hansenula anomala, a microbial agent of the Wickers hansenula anomala and application of the Wickers hansenula anomala and the microbial agent of the Wickers hansenula anomala. In order to screen and separate more abnormal Wickersenula polymorpha new strains and enrich the flavor of Baijiu, especially Maotai-flavor Baijiu, the abnormal Wickersenula polymorpha new strain w.a is separated, screened and identified from Maotai-flavor Baijiu fermented grains, and the preservation number of the abnormal Wickersenula polymorpha new strain w.a is CGMCC (China General Microbiological Culture Collection Center) No.39014. The strain not only can grow under high acidity, but also can generate various volatile aroma compounds, such as phenethyl acetate, isoamyl acetate, ethyl phenylacetate, isoamyl alcohol, isobutanol, linalool, phenethyl alcohol, 3, 4-dimethylbenzyl alcohol and guaiacol. Therefore, the strain is of great significance in improving the flavor of white spirit and providing the fragrance of flowers and fruits in the wine production process, especially in the fermentation process of Maotai-flavor white spirit.

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation technology, specifically relating to *Wickhamsonia anisopliae* (…). Wickerhamomyces anomalus ) and its inoculants and applications. Background Technology

[0002] The rich aroma and flavor compounds in baijiu, including esters, alcohols, aldehydes, acids, and pyrazines, determine its quality and style, and are also important components of its flavor profile. Floral and fruity aromas are typical of sauce-aroma baijiu, primarily contributed by esters such as isoamyl acetate, ethyl acetate, and ethyl hexanoate. Acids are essential precursors for ester synthesis, and some alcohols also contribute to floral and fruity aromas, such as phenylethyl alcohol and 2-butanol. However, the unique "four highs" (high-temperature koji making, high-temperature stacking, high-temperature fermentation, and high-temperature distillation) and multiple fermentation processes of sauce-aroma baijiu create an extreme microecological environment characterized by high acidity, high ethanol, high temperature, and low water activity. This results in not all microorganisms being able to stably and optimally perform their aroma-producing functions within this environment. Therefore, targeted discovery and screening of native functional microorganisms from sauce-aroma baijiu mash that can adapt to these extreme conditions and efficiently synthesize key flavor compounds can help improve product quality and ensure flavor stability.

[0003] Abnormal Wickhamson yeast ( 异常威克汉姆酵母 *Wickhamsonia* is a dominant fungal microorganism in the fermentation process of Maotai-flavor baijiu. It can grow in an environment with a pH of 3.0 and produces abundant key aroma components such as ethyl acetate, phenylethyl alcohol, and isoamyl acetate, imparting a rich floral, fruity, and sweet aroma to the liquor. It makes an indispensable contribution to the complexity and layering of the Maotai-flavor flavor. Correlation analysis shows that *Wickhamsonia* species are positively correlated with key flavor compounds ethyl acetate, ethyl lactate, and ethyl hexanoate in the four rounds of fermentation of Maotai-flavor baijiu. Therefore, isolating and purifying anomalous *Wickhamsonia* from the mash pile, analyzing its physiological and metabolic characteristics, and its contribution to flavor during the Maotai-flavor baijiu pile process has important theoretical and applied value for exploring and analyzing high-quality mash resources, developing new baijiu brewing and control technologies, and also has significant practical implications for improving the flavor of baijiu in production. Summary of the Invention

[0004] To screen and isolate more novel strains of *Wilker's Hansenula* to enrich the flavor of baijiu, especially sauce-aroma baijiu, this invention isolated, screened, and identified a novel strain of *Wilker's Hansenula*, *wa*, from the mash of sauce-aroma baijiu. Its accession number is CGMCC No. 39014. The accession date is October 23, 2025. The depositary institution is the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China. The classification name is: 异常威克汉姆酵母 This strain can not only grow under high acidity, but also produce a variety of volatile aroma compounds, such as phenethyl acetate, isoamyl acetate, ethyl phenylacetate, isoamyl alcohol, isobutanol, linalool, phenethyl alcohol, 3,4-dimethylbenzyl alcohol, guaiacol, pentyl-γ-butyrolactone, ethyl 3-phenylpropionate, octanol, and ethyl octanoate.

[0005] To achieve the above-mentioned objectives, the technical solution adopted in this application is as follows: In a first aspect, the present invention provides an abnormal Wirk Hansenula yeast strain ( 异常威克汉姆酵母 )wa, its accession number is: CGMCC No. 39014.

[0006] The ITS nucleotide sequences of the aforementioned abnormal Wirk Hansenula polymorpha are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0007] SEQ ID NO:1: ITS1 nucleotide sequence of *Wilker's Hansenula polymorpha* strain wa: GAGGCGGAGGGATTCACTTGCAGCGCTTATTGCGCGGCGATAAACCTTACACACATTGTCTAGTTTTTTTGAACTTTGCTTTGGGTGCATCAGCCTAGCTGCGTGCCCAAAGGTCTAAACACATTTTTTTAATGTTAAAACCTTTAACCAATAGTCATGAAAATTTTTAACAAAAATTAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCACCCTCTGGTATTCCAGAGGGTATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTGTCAAGGGTTAACTTGAAATATTGACTTAGCAAGAGTGTACTAATAAGCAGTCTTTCTGAAATAATGTATTAGGTTCTTCCAACTCGTTATATCAGCTAGGCAGGTTTAGAAGTATTTTAGGCTCGGCTTAACAACAATAAACTAAAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGGATATCAATAAAGGGGAGGAA SEQ ID NO:2: ITS4 nucleotide sequence of Wickerhamomyces anomalus w.a strain GAGGGGGTCTACTGATTTGAGGTCAACTTTTAGTTTATTGTTGTTAAGCCGAGCCTAAAATACTTCTAAACCTGCCTAGCTGATATAACGAGTTGGAAGAACCTAATACATTATTTCAGAAAGACTGCTTATTAGTACACTCTT GCTAAGTCAATATTTCAAGTTAACCCTTGACAGAGTATCACTCAATACCAAACCCGAAGGTTTGAGAGAGAAATGACGCTCAAACAGGCATACCCTCTGGAATACCAGAGGGTGCAATGTGCGTTCAAAGATTCGATGATTCAC GAAAATCTGCAATTCACAATACGTATCGCATTTCGCTGCGTTCTTCATCGTTGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAGATTTTAATTTTTGTTAAAAATTTTCATGACTATTGGTTAAAGGTTTTAACATTAA AAAAATGTGTTTAGACCTTTGGGCACGCAGCTAGGCTGATGCACCCAAAGCAAAGTTCAAAAAAACTAGACAATGTGTGTAAGGTTTATCGCCGCGCAATTAAGCGCTGGCAATAGAATACTATAATGATCCTTCCGCAGGGA The biological characteristics of the aforementioned abnormal Wickhamsonia wa are as follows: the colonies are milky white, round and raised, opaque, with a smooth surface, and easy to pick up.

[0008] Secondly, the present invention provides a microbial inoculant containing the aforementioned abnormal Wickhamsonia yeast wa.

[0009] Among them, the number of viable *Wilker's Hansenula polymorpha* wa per milliliter or per gram of microbial agent reached 1 × 10⁻⁶. 8 CFU and above.

[0010] Thirdly, the present invention provides the application of the above-mentioned abnormal Wickhamsonia yeast wa or the above-mentioned microbial agent in the preparation of wine.

[0011] Furthermore, the wine is at least one of distilled spirits, fermented wines, or blended wines.

[0012] Preferably, the alcoholic beverage is selected from at least one of the following: baijiu, brandy, whiskey, vodka, rum, gin, tequila, fruit spirits, huangjiu, beer, wine, fruit wine, sake, or milk wine.

[0013] More preferably, the liquor is at least one of the following: soy sauce aroma type, strong aroma type, light aroma type, or rice aroma type.

[0014] Fourthly, the present invention provides a method for increasing the content of volatile aroma compounds in the fermentation of baijiu, comprising the following steps: adding the above-mentioned abnormal Wickhamson yeast wa or the above-mentioned microbial agent to baijiu for fermentation.

[0015] The inoculum size for *Wickhamsonia wanensis* was 1–10% v / v.

[0016] The fermentation temperature is 28–37℃.

[0017] The fermentation time is 3 to 6 days.

[0018] The fermentation liquid is sorghum juice.

[0019] Preferably, the sorghum juice is obtained by mixing sorghum with water and then steaming it, adding heat-resistant α-amylase and saccharifying enzyme during the steaming process, and finally adding yeast extract and adjusting the sugar content of the sorghum juice to 3°Bx.

[0020] Fifthly, the present invention provides the application of the above-mentioned abnormal Wickhamsonia yeast wa or the above-mentioned microbial agent in the preparation of yeast or mash.

[0021] In a sixth aspect, the present invention provides the use of the above-mentioned abnormal Wirk Hansenula polymorpha or the above-mentioned microbial agent in increasing the content of phenethyl acetate, isoamyl acetate, ethyl phenylacetate, isoamyl alcohol, isobutanol, linalool, phenethyl alcohol, 3,4-dimethylbenzyl alcohol, guaiacol, pentyl-γ-butyrolactone, ethyl 3-phenylpropionate, octanol and / or ethyl octanoate.

[0022] Beneficial Effects: This invention isolated, screened, and identified an anomalous *Wickhamsonia wa* strain from fermented mash of a soy sauce-flavored type, with the preservation number CGMCC No. 39014. This strain exhibits good tolerance to organic acids, tolerating 60 g / L citric acid and succinic acid under aerobic conditions, and 10 g / L lactic acid under facultative anaerobic conditions. Furthermore, this strain produces a variety of volatile aroma compounds in both aerobic and static fermentation, such as phenethyl acetate, isoamyl acetate, ethyl phenylacetate, isoamyl alcohol, isobutanol, linalool, phenethyl alcohol, 3,4-dimethylbenzyl alcohol, guaiacol, pentyl-γ-butyrolactone, ethyl 3-phenylpropionate, octanol, and / or ethyl octanoate. During aerobic fermentation, the yields of phenethyl acetate reached 152.22 mg / L, isoamyl acetate reached 26.26 mg / L, and phenethyl alcohol reached 79.87 mg / L. During static fermentation, the yields of phenethyl alcohol reached as high as 142.86±24 mg / L, and isoamyl alcohol reached as high as 122.3±22.83 mg / L. Furthermore, phenethyl acetate, pentyl-γ-butyrolactone, isoamyl acetate, and guaiacol, which contribute to the floral and fruity aromas, were also produced simultaneously. Therefore, the *Wickhamsenula* wa strain provided by this invention is of great significance in improving the flavor of liquor, especially in the fermentation process of sauce-flavored baijiu, and in providing floral and fruity aromas. Attached Figure Description

[0023] Figure 1 The figures show the tolerance of *Wilker's yeast wa* to citric acid (A) and succinic acid (B) under aerobic conditions in Example 4 of this invention; and the tolerance of *Wilker's yeast wa* to acetic acid (C) and lactic acid (D) under anaerobic conditions.

[0024] Preservation instructions for the abnormal Wickhamson's yeast wa of this invention: The accession number is CGMCC No. 39014. The deposit date is October 23, 2025. The depositary institution is the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China (Institute of Microbiology, Chinese Academy of Sciences). The classification name is: 异常威克汉姆酵母 . Detailed Implementation

[0025] To make the technical problems, solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with the embodiments. Unless otherwise defined, all technical terms used herein have the same meaning as understood by one of ordinary skill in the art.

[0026] In one embodiment of the present invention, an abnormal strain of Wickhamsonia yeast wa was isolated and screened from the mash of Maotai-flavor liquor, and its preservation number is CGMCC No. 39014.

[0027] The abnormal *Wilk Hansenula polymorpha* wa was identified through a combination of morphological and molecular biological characteristics. Its morphological characteristics are: milky white, round, raised, opaque colonies with a smooth surface, easily picked up. Its ITS nucleotide sequence is shown in SEQ ID NO:1 and SEQ ID NO:2.

[0028] In one embodiment of the present invention, *Wilker's Hansenula polymorpha* wa is used as a live bacteria to prepare a microbial inoculum, wherein the number of live bacteria per milliliter or per gram of the microbial inoculum reaches 1 × 10⁻⁶. 8 CFU and above.

[0029] In one embodiment of the present invention, the application of the above-mentioned abnormal Wickhamsonia yeast wa or its microbial inoculum in the preparation of wine is also provided.

[0030] In some specific embodiments of the present invention, the wine is at least one of distilled wine, fermented wine, or blended wine.

[0031] Preferably, the alcoholic beverage is selected from at least one of the following: baijiu, brandy, whiskey, vodka, rum, gin, tequila, fruit spirits, huangjiu, beer, wine, fruit wine, sake, or milk wine.

[0032] More preferably, the liquor is at least one of the following: soy sauce aroma type, strong aroma type, light aroma type, or rice aroma type.

[0033] In some specific embodiments of the present invention, the prepared liquor is achieved by increasing the content of volatile aroma compounds during liquor fermentation, which is done by adding the above-mentioned abnormal Wickhamson yeast wa or the above-mentioned microbial agent to the liquor for fermentation.

[0034] The inoculum size for *Wilhelminthes aberrant* (wa) was 1–10% v / v. The fermentation temperature was 28–37°C, and the fermentation time was 3–6 days.

[0035] The fermentation liquid is sorghum juice, which is obtained by mixing sorghum with water and then steaming it. During the steaming process, heat-resistant α-amylase and saccharifying enzyme are added, and finally yeast extract is added and the sugar content of the sorghum juice is adjusted to 3°Bx.

[0036] In one embodiment of the present invention, the application of the above-mentioned abnormal Wickhamsonia yeast wa or the above-mentioned microbial agent in the preparation of yeast or mash is provided.

[0037] In one embodiment of the present invention, the above-mentioned abnormal Wickhamsonia wa or the above-mentioned microbial agent is provided for the application of increasing the content of phenethyl acetate, isoamyl acetate, ethyl phenylacetate, isoamyl alcohol, isobutanol, linalool, phenethyl alcohol, 3,4-dimethylbenzyl alcohol, guaiacol, pentyl-γ-butyrolactone, ethyl 3-phenylpropionate, octanol and / or ethyl octanoate.

[0038] The following specific embodiments will be provided to explain the solution of the present invention. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0039] Raw materials used in the examples: The mash samples were taken from a representative distillery of Maotai-flavor liquor, specifically from the mash on days 1, 4, and 9 of the third fermentation stage. Each sample was taken from 50 cm below the ground, at a depth of 20 cm, with three sampling points. 50 g of mash was collected from each point, mixed thoroughly, placed in a sterile resealable bag, and stored at 4 ℃ with ice packs.

[0040] Yeast extract peptone glucose (YPD) liquid culture medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L.

[0041] YPD solid medium: Add 20.0 g / L of agar to the liquid medium.

[0042] Sorghum juice culture medium (SEM): 1 kg of sorghum and water were mixed at a mass ratio of 1:4 and then cooked. During the cooking process, 5 mL of heat-resistant α-amylase (specific activity unit of 2600 IU / g) and 4 mL of saccharifying enzyme (specific activity unit of 100,000 IU / mL) were added. Finally, 2 wt% yeast extract was added and the sugar content of the sorghum juice was adjusted to 3°Bx.

[0043] Example 1: Isolation and screening of abnormal Wickhamsonia wa Weigh 10.0 g of the collected fermented mash sample and add it to a 250 mL Erlenmeyer flask containing 100 mL of sterile physiological saline and glass beads. Place the flask in a constant temperature shaker and shake at 30 ℃ and 180 r / min for 30 min. Let it stand for 10 min until the mash settles to the bottom of the flask to obtain a bacterial suspension. Take the supernatant and perform 10... -1 ~10 -7Serial dilutions were performed, and 100 µL of each gradient bacterial suspension was spread onto YPD solid medium and incubated at 30 ℃ for 2–3 days. After colonies grew, single colonies with different morphologies were selected at intervals, isolated and purified three times, and then inoculated into YPD liquid medium and incubated on a shaker at 30 ℃ and 180 r / min for 2 days. Based on colony morphology and color, a strain named wa with milky white, round, raised, opaque, smooth, and easily pickable colonies was selected.

[0044] Example 2: Molecular identification of *Wilker's Hansenula* wa Two mL of the bacterial culture of strain wa screened in Example 1 was taken, and DNA was extracted for species identification according to the instructions of the DNA rapid extraction kit (Nanjing Novizan Biotechnology Co., Ltd.). The extracted genomic DNA of the strain was amplified by PCR using the universal fungal primers ITS1 / ITS4. The PCR product was sent to Wuxi Tianlin Biotechnology Co., Ltd. for sequencing, and the nucleotide sequence of the ITS gene was obtained as shown in SEQ ID NO:1 and SEQ ID NO:2. The sequencing results were compared with the NCBI database using BLAST to determine the species.

[0045] Among them, the primers used for PCR are: ITS1: 5′-TCCGTAGGTGAACCTGCGG-3′ (SEQ ID NO: 3) ITS4: 5′-TCCTCCGCTTATTGATATGC-3′ (SEQ ID NO:4) PCR amplification reaction 25 μL system: ITS1 1 μL, ITS4 1 μL, 2xTaq Master Mix (Vazyame) 12.5 μL, sterile ultrapure water 9.5 μL, DNA template 1 µL.

[0046] The PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30 s, annealing at 56 ℃ for 1 min, extension at 72 ℃ for 1 min, 30 cycles; 72 ℃ for 10 min.

[0047] Purification: Based on the PCR results, the taxonomic position of the strain was determined, and the culture medium of the target strain was spread on YPD solid medium to obtain single colonies.

[0048] Based on morphological characteristics and molecular identification, strain wa was ultimately identified as *Wilck's Hansenula* and deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 39014. The deposit date is October 23, 2025. The address of the depository is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China. Classification name: 异常威克汉姆酵母 .

[0049] Example 3: Growth curve of *Wilker Hansenula polymorpha* wa and preparation of inoculum (1) Growth curve Wickhamsonia var. wa was streaked on solid YPD medium, and single colonies were selected and cultured in liquid YPD medium to obtain seed culture with good growth viability. The seed culture was then transferred at a 1% v / v inoculum to 250 mL Erlenmeyer flasks containing 100 mL of liquid YPD medium with glass beads. Fermentation broth was collected every 4 h for growth analysis. Uninoculated medium served as a control, and each group was divided into three replicates.

[0050] Growth curve analysis showed that the strain grew slowly from 0 to 16 h, indicating a lag phase; it grew rapidly after 18 h, entering the logarithmic growth phase; and it entered a plateau phase between 44 and 60 h, with OD... 600 The pH ranged from 5.0 to 6.0. During the entire growth process, the pH of strain wa initially decreased and then increased, changing from an initial pH of 6.0 to 5.0, and finally rising to 8.2.

[0051] (2) Preparation of microbial agents The following method is used to prepare an inoculum from abnormal Wirk Hansenula polymorpha: The obtained abnormal Wickhamsonia wa was inoculated into YPD medium at a 1% v / v inoculum and cultured at 30℃ for 24 h to obtain the first-level seed culture. Then, the culture was expanded stepwise to the third generation at a 10% inoculum ratio to obtain the third-level seed culture.

[0052] Take the above-mentioned third-stage seed culture and inoculate it into 100 mL of YPD liquid medium at a 10% v / v inoculation ratio. Ferment and culture at 30℃ for 48 h. Then, collect the bacterial cells by centrifugation at 8000 rpm for 10 min at 4℃. Add skim milk as a freeze-drying protectant in a clean bench at a volume ratio of 5:1 (500 mL fermentation broth to 100 mL skim milk). Mix well and dispense 100 mL into glass petri dishes. Seal the dishes with plastic wrap and pre-freeze at -80℃ for 2 h. After pre-freezing, freeze-dry at a vacuum of 66.66 Pa for 24 h to obtain a solid inoculum containing *Wilhelminthes wa*. The viable count of *Wilhelminthes wa* per milliliter or per gram of inoculum reaches 1 × 10⁻⁶. 8 CFU.

[0053] Example 4: Analysis of the acid tolerance of *Wickhamsonia wanensis* During the brewing of baijiu and fruit wine, acid-producing microorganisms such as lactic acid bacteria metabolize and produce large amounts of organic acids such as lactic acid, acetic acid, succinic acid, and citric acid. This leads to the continuous accumulation of organic acids in the fermentation system, creating acid stress. If the yeast has poor tolerance to organic acids, fermentation may stop, yield may decrease, or flavor may become abnormal. Therefore, an analysis of the acid tolerance of abnormal Wickhamsonia wanensis was conducted.

[0054] In the fermentation system of Maotai-flavor liquor, the main organic acids in the mash include lactic acid, acetic acid, succinic acid, and citric acid. Among them, succinic acid and citric acid directly participate in energy production and carbon skeleton supply. Good tolerance indicates that yeast can maintain TCA cycle flux, ensure FADH2 / NADH supply, and thus support efficient ATP production and metabolic diversion. Therefore, we first investigated the tolerance of *Wilk Hansenula polymorpha* wa to succinic acid and citric acid under aerobic conditions. YPD liquid culture medium with citric acid contents of 0 (control group), 30, 60, 90, and 120 g / L and succinic acid contents of 0 (control group), 10, 30, 60, and 90 g / L were prepared. Yeast *Wilk Hansenula polymorpha* wa culture was inoculated at a 2% v / v inoculum and cultured at 30℃ and 180 r / min for 120 h. OD was measured using a microplate reader. 600 The growth status was monitored, and the results were as follows: Figure 1 As shown in (A and B). From Figure 1 -A indicates that different citric acid concentrations have different effects on *Wilkhamsenula anomala* (wa). The control group showed the fastest growth rate and the highest maximum cell concentration, with an OD value of [missing value] at 120 h of fermentation. 600The value was 2.27. When the citric acid concentration was less than 60 g / L, it had little effect on the final OD value of *Wilkhansenula aberrantis* wa (slightly lower than the control), but it prolonged the lag phase of the strain; the lag phases at 30 and 60 g / L citric acid concentrations were 12 and 36 h, respectively. When the citric acid concentration increased to above 90 g / L, *Wilkhansenula aberrantis* wa stopped growing. Figure 1 -B indicates that different succinic acid concentrations have varying effects on *Wilkhansenula anomala* (wa). The control group showed the fastest growth and the highest maximum cell count. The biomass (OD) of *Wilkhansenula anomala* strains was also observed in culture systems with succinic acid concentrations ranging from 10 to 60 g / L. 600 The concentration of OD24 was lower than that of the control group, but it had little impact on its growth. Under high concentrations of succinic acid, when WA increased to above 90 g / L, its lag phase was prolonged to (0–72 h), followed by rapid growth, with its OD24 at the fermentation endpoint reaching a high level. 600 Higher than the control group.

[0055] Lactic acid content in Maotai-flavor baijiu mash can reach as high as 60 g / kg, and acetic acid content can reach as high as 10 g / kg. The accumulation of organic acids leads to an increase in the acidity of the fermenting mash, causing microbial cells to stop growing or even die. Therefore, to simulate the production process of Maotai-flavor baijiu, sorghum juice culture medium with acetic acid contents of 0 (control group), 5, 10, and 15 g / L, and lactic acid contents of 0 (control group), 10, 30, and 50 g / L were prepared using a microbial culture medium (SEM). Yeast *Wa* culture was inoculated at a 4% v / v inoculum and cultured anaerobicly at 37℃ for 96 h. OD values ​​were measured using a microplate reader. 600 The growth status was monitored, and the results were as follows: Figure 1 As shown in (C and D). During static fermentation, the abnormal Wickhamsonia wa yeast could only grow normally in basal medium without added acetic acid, and its OD... 600 The value was 2.28. When acetic acid increased to above 5 g / L, *Wilkhamnosus wa* stopped growing. Figure 1 -C). The effects of different lactic acid concentrations on *Wilkhamnosus wa* yeast were also different. Among them, the control group showed the fastest growth and the highest concentration of maximum cell size, with the highest OD. 600 The value was 2.28. The abnormal Wickhamsonia yeast (wa) can tolerate 10 g / L lactic acid, and its OD... 600 The value was 1.29. When lactic acid increased to above 30 g / L, *Wilsonia vesicularis* wa stopped growing. Figure 1 -D).

[0056] In summary, *Wickhamsonia var. anomala* exhibits varying tolerance to different acids, tolerating citric acid and succinic acid up to 60 g / L and lactic acid up to 10 g / L, while showing poor tolerance to acetic acid.

[0057] Example 5: High-yield volatile aroma compounds from aerobic fermentation of *Wilker's Hansenula* var. *wa*. Wickhamsonia var. wa was streaked on solid YPD medium, and single colonies were selected and cultured in liquid YPD medium to obtain seed culture with good growth viability. The inoculum was transferred at a 1% v / v rate to 250 mL Erlenmeyer flasks containing 100 mL of liquid YPD medium with glass beads, and cultured at 30 °C for 72–96 h under aerobic conditions at 180 rpm. Uninoculated medium served as a control. Each group was divided into three replicates. The content of volatile aroma compounds in the fermentation broth was determined by headspace solid-phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS).

[0058] The specific method for HS-SPME-GC-MS determination is as follows: (1) Pretreatment method Take 30 mL of fermentation broth that has reached the stationary phase and place it in a 50 mL centrifuge tube. Centrifuge at 8000 r / min for 10 min at 4 ℃. Take 5 mL of the supernatant and place it in a 20 mL headspace vial. Add 2.3 g of sodium chloride and 10 μL of chromatographic grade tert-amyl alcohol internal standard solution.

[0059] (2) Analysis conditions Instrument: Gas Chromatography-Mass Spectrometry System (GC-MS) from Agilent Technologies, USA.

[0060] Testing conditions: Chromatographic column: DB-Wax capillary column, 30 m long, 0.25 mm inner diameter, 0.25 μm film thickness; carrier gas: He; flow rate: 1.0 mL / min, injection port temperature: 250 ℃, desorption for 5 min, splitless injection; gas phase temperature program: initial temperature 40 ℃, hold for 3 min, increase to 60 ℃ at 5 ℃ / min, then increase to 230 ℃ at 10 ℃ / min, hold for 8 min; mass spectrometry conditions: ion source temperature 260 ℃, interface temperature 200 ℃, electron energy 70 eV, scan mass range 25–350 amu. Qualitative analysis was performed using the NIST17 spectral library, and the relative content of various substances was calculated using the internal standard method.

[0061] A total of 69 volatile compounds were detected in the fermentation broth using the HS-SPME-GC-MS method, including 21 alcohols, 13 esters, 5 pyrazines, 4 ketones, 8 aldehydes, 2 acids, and 16 other compounds. Typical compounds and their contents are shown in Table 1. Among the esters, phenethyl acetate had the highest content at 152.22 mg / L and a rose-like aroma; followed by isoamyl acetate at 26.26 mg / L, with a banana and pear-like aroma; and ethyl phenylacetate, with a honey-like aroma, at 0.76 mg / L. Among the alcohols, isoamyl alcohol had the highest yield, at 87.45 mg / L, and has floral and fruity aromas; followed by phenylethyl alcohol at 79.87 mg / L, which has a mild and lasting rose scent; ethanol had a yield of 20.37 mg / L, isobutanol had a yield of 6.49 mg / L, both with floral and fruity aromas, and linalool had a yield of 0.71 mg / L, with a fresh woody and citrus aroma.

[0062] Table 1. Content of volatile aroma compounds produced by aerobic fermentation of *Wickhamsonia wanensis*.

[0063] Note: "ND" indicates not detected.

[0064] Example 6: High-yield volatile aroma compounds from liquid sorghum fermentation using *Wickhamsonia wanensis* (WA). To simulate the production process of Maotai-flavor liquor, sorghum juice was used as the culture medium for liquid fermentation of *Wilker Hansenula anomala* wa. Purified *Wilker Hansenula anomala* wa was first inoculated into YPD liquid medium at a 1% v / v inoculation rate. After reaching the stationary phase, it was transferred to 24-well plates containing 5 mL of sorghum juice at a 5% v / v inoculation rate and statically cultured in an anaerobic incubator at 37℃. Uninoculated medium served as a control. Three replicates were set up for each group. The content of volatile aroma compounds in the fermentation broth was determined using HS-SPME-GC-MS, with three replicates for each treatment.

[0065] Sample pretreatment for HS-SPME-GC-MS detection: Take 5.0 g of sample into a 50 mL centrifuge tube, add 20 mL of ultrapure water, vortex thoroughly to mix, sonicate at 4 °C for 30 min, and centrifuge at 8000 r / min for 10 min. Take 5 mL of the supernatant into a 20 mL headspace vial, add 2.3 g of sodium chloride and 10 µL of 8.05 g / L chromatographic grade tert-amyl alcohol internal standard solution. The HS-SPME-GC-MS running procedure and analytical method are the same as in Example 4.

[0066] Thirty-three volatile compounds were detected in the fermentation broth using HS-SPME-GC-MS, including 12 alcohols, 7 esters, 5 phenols, 1 ketone, 6 aldehydes, and 2 other compounds. Typical compounds and their contents are shown in Table 2. Among the alcohols, ethanol had the highest yield (215.91±25.25 mg / L), followed by phenethyl alcohol (142.86±24 mg / L, with a mild and lasting rose aroma); isoamyl alcohol (122.3±22.83 mg / L) and isobutanol (5.93±3.68 mg / L), both with floral and fruity aromas; 3,4-dimethylbenzyl alcohol (1.39±1.66 mg / L), with a faint almond and floral aroma. Guaiacin was present at a concentration of 0.19±0.0 mg / L. Among the ester compounds, isoamyl acetate had the highest content at 3.59±0.24 mg / L, followed by pentyl-γ-butyrolactone, ethyl 3-phenylpropionate, and phenylethyl acetate, with contents of 1.92±0.09, 0.65±0.46, and 0.54±0.19 mg / L, respectively. All of them have floral and fruity aromas.

[0067] Table 2. Content of volatile aroma compounds produced by *Wickhamsonia wanensis* during static fermentation in sorghum juice.

[0068] Note: "ND" indicates not detected.

Claims

1. Abnormal Wickhamsonia yeast ( Wickerhamomyces anomalus )wa, characterized in that, The preservation number is CGMCC No. 39014.

2. A microbial inoculant, characterized in that, The wine is at least one of distilled wine, fermented wine or prepared wine. The wine is at least one of baijiu, brandy, whiskey, vodka, rum, gin, mescal, fruit distillate, yellow rice wine, beer, grape wine, fruit wine, sake or milk wine; preferably, the baijiu is at least one of Jiangxiang-type, Nongxiang-type, Qingxiang-type or Mixiang-type.

4. Use according to claim 3, characterized in that, The method comprises the following steps: adding the Wickerhamomyces anomalus w.a. of claim 1 or the microbial inoculant of claim 2 into baijiu for fermentation.

5. Use according to claim 4, characterized in that, The inoculation amount of the Wickerhamomyces anomalus w.a. is 1-10% v / v; the fermentation temperature is 28-37℃, and the fermentation time is 3-6 days.

6. A method for increasing the content of volatile aroma compounds in the fermentation of white liquor, characterized in that, The fermentation liquid is highland barley juice, which is obtained by mixing highland barley with water, cooking, adding thereto thermostable alpha-amylase and saccharifying enzyme during the cooking process, and finally adding yeast extract and adjusting the sugar content of the highland barley juice to 3°Bx.

7. The method for increasing the content of volatile aroma compounds in Baijiu fermentation according to claim 6, characterized in that, 9. The Wickerhamomyces anomalus w.a. of claim 1 or the microbial inoculant of claim 2 is used for preparing wine starter or fermented grains. 8.The method of claim 6, wherein the white liquor is fermented at a temperature of 20-30 ℃.

10. The Wickerhamomyces anomalus w.a. of claim 1 or the microbial inoculant of claim 2 is used for increasing the content of phenethyl acetate, isoamyl acetate, ethyl phenylacetate, isoamyl alcohol, isobutyl alcohol, linalool, phenylethanol, 3,4-dimethylbenzyl alcohol, guaiacol, pentyl-gamma-butyrolactone, 3-phenylpropionic acid ethyl ester, octanol and / or ethyl octanoate. ​ ​

Images