Application of CpWRKY51 in regulating resistance of zucchini to powdery mildew
By overexpressing the CpWRKY51 gene in zucchini, triggering an allergic response and upregulating antioxidant enzymes, the problem of chemical resistance to powdery mildew in zucchini was solved, achieving a long-lasting disease resistance effect and an environmentally friendly control solution.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-10
- Publication Date
- 2026-04-10
AI Technical Summary
Existing chemical control methods are prone to developing resistance and cannot effectively address the threat of powdery mildew in zucchini, leading to reduced yield, decreased fruit quality, and increased control costs.
By overexpressing the CpWRKY51 gene, a strong allergic reaction and upregulation of antioxidant enzymes are triggered, enhancing the resistance of zucchini to powdery mildew. This gene regulation strategy replaces chemical pesticides.
It improves the resistance of zucchini to powdery mildew, reduces lesions, enhances the activity of antioxidant enzymes, reduces oxidative stress, and achieves a lasting, environmentally friendly disease-resistant effect.
Smart Images

Figure CN121271952B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biotechnology, and particularly relates to CpWRKY51 application in regulating resistance of zucchini to powdery mildew. BACKGROUND
[0002] Powdery mildew is a devastating disease in zucchini cultivation, which can cause serious economic losses in yield, quality, and planting cost. Zucchini powdery mildew is caused by Sphaerotheca fuliginea, which can spread rapidly throughout the plant after infection. The specific damage is concentrated in three dimensions: (1) severe inhibition of photosynthesis, leading to sharp yield reduction: the hyphae and conidia of powdery mildew can densely cover the surface of zucchini leaves, petioles and stems, directly hindering the absorption of light and gas exchange by leaves. In the later stage of infection, leaves will turn yellow and dry, photosynthetic efficiency will decrease, and ultimately lead to reduced fruit setting rate and hindered fruit development of zucchini, (2) damage to fruit quality and loss of commercial value: the disease will indirectly affect fruit development, leading to small and deformed fruits, and spotted or dull fruit skin. At the same time, the decline of leaf function will lead to insufficient sugar accumulation in fruits, poor taste and weak flavor, and the storage period of diseased fruits will be greatly shortened, easily rotten and deteriorated, which cannot meet the market purchase standards, (3) increase of prevention and control cost, and cause environmental and safety risks: currently, farmers mainly rely on chemical fungicides (such as triazoles and kresoxim-methyl) for prevention and control, but powdery mildew is prone to drug resistance, which requires increasing the frequency and dosage of pesticide application, leading to increased planting cost. In addition, pesticide residues will pollute the soil and fruits, which not only harms the health of consumers, but also does not meet the development requirements of green agriculture.
[0003] In summary, the existing chemical control methods are prone to drug resistance and cannot fundamentally solve the threat of powdery mildew. SUMMARY
[0004] To solve the above technical problems, the present application provides CpWRKY51 application in regulating resistance of zucchini to powdery mildew.
[0005] CpWRKY51 application in regulating resistance of zucchini to powdery mildew, wherein the CpWRKY51The nucleotide sequence of the nucleic acid is: ATGAATATAAAAGCAGAGAGGCTGCCCTTGTCATTTCCAACCGAGAGATCGGATAATATGGATTGTTCTTGGGTTGAATCCACGCCGTTTGATCGGAAAAAAGTCGCCGATCAATTGCTTCGTGGCCATGAATTCGCCCGACAACTTCAAGCCCATCTACGGAGTGGTTCCAGCTGCGGCGGAACAGTCTCCGATGATCTGGTCGCCAAAATCTTATCCTCTTTCTCCAAAACTATCTCCGTCTTGAACCGCTACTCCGACGCCGACGACATTAATGGGTCTATTGTGGATAATTCACCGCCTGAGGAATCTGAAGACAGCTGCCGGAGCTCCACCCCCAATGATCGGAGGGGCTGCTATAAGAGAAGGAGGAATTCCCATAGTTGGGCGAGAGACAGCAGCAGCCTGGTGGACGACGGGCATGCGTGGCGGAAGTACGGGCAGAAGTCGATTCAAAACGCGAAATTCCCGAGGAATTACTACCGATGTACCCATAAATTCGACCAGGGCTGCCAAGCCTCGAAGCAAGTCCAGCGAGTGGAAGACCATCCACCCAAGTTCCGTACAACTTATTACGGCCATCACACCTGCACCAATTTCCTCAACACTTCCGACATCGTACTGGGTTCCTCAAATTTCGACGATTCCGGCGGCGTCCTCCTCAGTTTCGACACTCCCACCGCCGCTCCCGCCGCCGTACACGACCACGAAAGGAACCAGTTCTTCTTGCCTACAGACACCGATGTCGATGCCATGGCTCGCGTAGTCAAAACGGAAGTTGTAATGGGAGGAACGGCGGCGGCGGAGGAGGTATGCTCGCCGTCCGATTACATGAGTGCCGGCCCTTCACCCGACGACTTTTCCGAGGTTATGATGTCCGGTTCCATCGGCGACTTTGAGGACGATGTCTTACAATTTCACTTTTGA, referred to as SEQ ID NO. 1.
[0006] The nucleic acid CpWRKY51The amino acid sequence of the CDS is: MNIKAERLPLSFPTERSDNMDCSWVESTPFDRKKVADQLLRGHEFARQLQAHLRSGSSCGGTVSDDLVAKILSSFSKTISVLNRYSDADDINGSIVDNSPPEESEDSCRSSTPNDRRGCYKRRRNSHSWARDSSSLVDDGHAWRKYGQKSIQNAKFPRNYYRCTHKFDQGCQASKQVQRVEDHPPKFRTTYYGHHTCTNFLNTSDIVLGSSNFDDSGGVLLSFDTPTAAPAAVHDHERNQFFLPTDTDVDAMARVVKTEVVMGGTAAAEEVCSPSDYMSAGPSPDDFSEVMMSGSIGDFEDDVLQFHF, recorded as SEQ ID NO. 2.
[0007] The present application finds that CpWRKY51 enhances resistance to powdery mildew by triggering strong hypersensitive response and cell death, while up-regulating antioxidant enzymes to alleviate oxidative stress, and therefore proposes CpWRKY51 application in regulating resistance of zucchini to powdery mildew. This disease resistance strategy based on gene regulation has the advantages of long-lasting resistance, environmental friendliness, and independence from chemical pesticides, and can provide a fundamental solution to zucchini powdery mildew prevention and control from the molecular level.
[0008] Preferably, the regulation is by overexpression of the CpWRKY51 gene. CpWRKY51 to improve the resistance of zucchini to powdery mildew.
[0009] Preferably, the overexpression of the CpWRKY51 gene is by overexpression of the CpWRKY51 gene. CpWRKY51 The method is: PCR amplification is performed with zucchini cDNA as a template to obtain an amplification product;
[0010] The amplification product is ligated to a vector ZYMV-eGFP to obtain an overexpression vector.
[0011] The overexpression vector is transformed into Agrobacterium, which infects zucchini to up-regulate the expression amount of the CpWRKY51 gene. CpWRKY51
[0012] Preferably, the primer sequences used in the PCR amplification are as shown in SEQ ID NO. 3~SEQ ID NO. 4.
[0013] Preferably, when the amplification product is ligated to the vector ZYMV-eGFP, the enzyme cutting sites are BamH I and Sac I.
[0014] Preferably, the ligation reaction system is as follows: ZYMV-eGFP, CpWRKY51 Target fragment, 10×T4 Buffer, T4 DNA Ligase, ddH2O.
[0015] Preferably, the phenotype that improves the resistance of zucchini to powdery mildew is the reduction of powdery mildew spots.
[0016] A method for improving the resistance of zucchini to powdery mildew, wherein the aforementioned CpWRKY51 Imported into zucchini, through the expression described CpWRKY51 This improves the resistance of zucchini to powdery mildew.
[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0018] This invention discovers CpWRKY51 By triggering strong heart rate (HR) and cell death, while simultaneously upregulating antioxidant enzymes to alleviate oxidative stress, resistance to powdery mildew is enhanced, thus a new theory is proposed. CpWRKY51 Application in regulating the resistance of zucchini to powdery mildew. Attached Figure Description
[0019] Figure 1 for CpWRKY51 Subcellular localization and transcriptional activation analysis, where A shows CpWRKY51 Subcellular localization of proteins in tobacco leaves, from left to right: eGFP fluorescence, nuclear localization tag, bright field, mixed field; scale bar = 20 μm; B-mode display. CpWRKY51 Transcriptional activation in yeast cells; C shows a schematic diagram of the structure of three tandem W-boxes and a mutant mW-box; D shows... CpWRKY51 Incorporate W-box elements into yeast.
[0020] Figure 2 For overexpression CpWRKY51 It improved the resistance of seed zucchini to powdery mildew. Among them, A is the leaf phenotype under powdery mildew stress; B is the leaf phenotype under a handheld fluorescent flashlight; C is the mycelial growth observed by trypan blue staining. DI represents the disease index, lowercase letters represent significance, and p<0.05.
[0021] Figure 3 for CpWRKY51 Overexpression of [a specific substance] enhanced the antioxidant activity of seed zucchini. Among these, A represents cell death, H2O2, and O2 after pathogen inoculation. - Accumulation status; B–F: Physiological index analysis under powdery mildew stress, where B represents H2O2 level and C represents O2 level. - Levels, D for CAT activity, E for SOD activity, F for POD activity; asterisk indicates statistical significance; **p<0.01.
[0022] Figure 4GO enrichment analysis; the defense-related genes expressed in the seed pumpkins after inoculation with powdery mildew for 24 h, wherein A is a heat map showing the expression of defense-related genes in the seed pumpkins after inoculation with powdery mildew for 24 h, and B is a heat map showing the expression of defense-related genes in the seed pumpkins after inoculation with powdery mildew for 24 h. CpWRKY51 Enrichment of differentially expressed genes regulated, wherein A is a GO enrichment diagram of up-regulated differential genes, and B is a GO enrichment diagram of down-regulated differential genes.
[0023] Figure 5 Enrichment of defense-related genes expressed, wherein A is a heat map showing the expression of defense-related genes in the seed pumpkins after inoculation with powdery mildew for 24 h, CpWRKY51 up-regulated in the seed pumpkins; different colors represent log2-fold changes; B is the expression level of CpPR1b / e / f in wild type WT, control and overexpression lines 24 h after inoculation with powdery mildew, as analyzed by real-time quantitative PCR. CpWRKY51
[0024] Figure 6 Yeast one-hybrid verification CpWRKY51 binding with CpPR1b / e / f the promoters. p53-AbAi+pGADT7-p53 was used as a positive control, and p53-AbAi+pGADT7 was used as a negative control.
[0025] Figure 7 EMSA confirmed CpWRKY51 in vitro binding with CpPR1b / e / f the TTGACT motif of the promoters, wherein A is a schematic diagram of EMSA promoter sequence selection; B is an EMSA showing CpWRKY51 direct binding with the CpPR1b / e / f promoter; A~B shows the probe sequence corresponding to the promoter of each target gene, and the red letters represent W-box and mutated W-box; the purified recombinant GST-CpWRKY51 protein was incubated with the probe, and then the protein-DNA complex was separated on a native polyacrylamide gel; the GST protein alone was used as a negative control; "-" indicates the absence, and "+" indicates the presence, and the arrow indicates the position of the migration band; C is a result of dual luciferase reporter gene detection showing, CpWRKY51 activation of the expression of the LUC reporter gene driven by PRb / e / f the promoters, and the LUC / REN ratio represents PRb / e / f the relative activity of the promoters, and the values are represented by "mean ± standard error"; D is a result of transient expression detection showing, CpWRKY51 activation of the expression of the LUC reporter gene driven by the PRb / e / f promoter at the transcriptional level. DETAILED DESCRIPTION
[0026] The specific embodiments of the present application are described in detail below, but the scope of protection of the present application is not limited by the specific embodiments. Based on the examples in the present application, all other examples obtained by those of ordinary skill in the art without creative labor are within the scope of protection of the present application. The experimental methods described in the embodiments of the present application are all conventional methods unless otherwise specified.
[0027] The primer sequences used in the present application are as follows:
[0028] ZYMV-F: atgctccagtcgggcgggcccATGAATATAAAAGCAGAGAGGCTGC, recorded as SEQ ID NO. 3;
[0029] ZYMV-R: ctggagcatcacagtgtcgacAAAGTGAAATTGTAAGACATCGTCCT, recorded as SEQ ID NO. 4;
[0030] BD-F: atggccatggaggccgaattcATGAATATAAAAGCAGAGAGGCTGC, recorded as SEQ ID NO. 5;
[0031] BD-R: ccgctgcaggtcgacggatccTCAAAAGTGAAATTGTAAGACATCGTC, recorded as SEQ ID NO. 6;
[0032] ADF: gccatggaggccagtgaattcATGAATATAAAAGCAGAGAGGCTGC, recorded as SEQ ID NO. 7;
[0033] ADR: cagctcgagctcgatggatccTCAAAAGTGAAATTGTAAGACATCGTC, recorded as SEQ ID NO. 8;
[0034] CpWRKY51-eGFPF: acgggggacgagctcggtaccATGAATATAAAAGCAGAGAGGCTGC, recorded as SEQ ID NO. 9;
[0035] CpWRKY51-eGFPR: tggcgcgccgggccctctagaAAAGTGAAATTGTAAGACATCGTCCT, recorded as SEQ ID NO. 10;
[0036] CpWRKY51-qPCR F: TAAAAGCAGAGAGGCTGCCC, denoted as SEQ ID NO. 11;
[0037] CpWRKY51-qPCR R: ATGGGCTTGAAGTTGTCGGG, denoted as SEQ ID NO. 12;
[0038] pGEX-4T-1-CpWRKY51-F: ggttccgcgtggatccATGAATATAAAAGCAGAGAGGCTGC, denoted as SEQ ID NO. 13;
[0039] pGEX-4T-1-CpWRKY51-R: agtcacgatgcggccgcAAAGTGAAATTGTAAGACATCGTCCT, denoted as SEQ ID NO. 14;
[0040] ZYMV represents a transient overexpression vector, BD represents insertion into a pGBKT7 vector, AD represents insertion into a pGADT7 vector, CpWRKY51-eGFP is inserted into a pCAMBIA1300-35S-EGFP vector, CpWRKY51-qPCR represents a qPCR primer,
[0041] pGEX-4T-1-CpWRKY51-R represents insertion into a pGEX-4T-1 vector to obtain a GST-CpWRKY51 fusion protein, and all the above-mentioned vector constructions adopt a homologous recombination method. The homologous recombination kit is a product of Beijing Quanshijin Biological Company, and the article number is CU201.
[0042] Amplification CpWRKY51 The primers of the target fragment are ZYMV-F and ZYMV-R, the system is 1 uL of each of the forward and reverse primers, 1 uL of cDNA, 25 uL of 2xTransStart FastPfu Fly PCR SuperMix, and 22 uL of dd water. The PCR system is 98 DEG C for 1 min, 98 DEG C for 10 s, 60 DEG C for 5 s, 72 DEG C for 10 s, 72 DEG C for 1 min, wherein 98 DEG C for 10 s, 60 DEG C for 5 s, 72 DEG C for 10 s, and the cycle is 30 times.
[0043] In the application, the SD / -Trp culture medium is an SD / -tryptophan culture medium, which refers to an SD culture medium lacking tryptophan; the SD / -Ade / -His / -Trp culture medium is an SD / -adenine / -histidine / -tryptophan culture medium, which refers to an SD culture medium lacking adenine, histidine and tryptophan.
[0044] 1. Test materials and treatments
[0045] The zucchini germplasm used for the test seeds was MRJ, preserved in our laboratory. Seeds with plump kernels and free from disease and pests were selected, disinfected with 0.1% potassium permanganate solution for 10 minutes, rinsed 3-5 times with sterile water, and germinated in a 28℃ constant temperature incubator. Once the seeds showed signs of germination, they were sown in sterilized substrate and placed in an artificial climate chamber for cultivation. The cultivation conditions were: 28℃ / 22℃, 18h light / 6h dark photoperiod, light intensity 25000 Lux, and relative humidity 70%±5%. Healthy seedlings with fully expanded cotyledons and undeveloped true leaves were selected as experimental materials.
[0046] 2. Analysis of transcriptional activation activity in yeast.
[0047] Will CpWRKY51 The CDS sequence was cloned into the pGBKT7 vector to construct the recombinant plasmid pGBKT7-CpWRKY51. The recombinant plasmid was transformed into Y2HGold yeast strain, with an empty pGBKT7 vector used as a negative control. Transformed yeast cells were inoculated into SD / -Trp medium and cultured at 30°C for 3 days. Subsequently, successfully transformed clones were transferred to selective SD / -Trp / -His / -Ade medium containing X-α-Gal and cultured at 28°C for 3 days to assess their transcriptional activation activity. The Y2HGold yeast strain was purchased from Coolaber, Beijing, China.
[0048] 3. Construction and subcellular localization analysis of the CpWRKY51-eGFP expression vector.
[0049] Will CpWRKY51 The coding region was inserted into the pCAMBIA1300-35S-EGFP plasmid, fused with the green fluorescent protein (eGFP) gene, and the expression vector 35S::CpWRKY51-eGFP was constructed. The obtained expression vector 35S::CpWRKY51-eGFP and the control vector 35S::eGFP were transformed into Agrobacterium GV3101 strain using a freeze-thaw method. The target gene was amplified using cDNA as a template. CpWRKY51 The amplified fragment was seamlessly cloned and inserted into the KpnⅠ / XbaⅠ site of the pCAMBIA1300-35S-EGFP vector. Colony-positive PCR clones were then selected for sequencing verification.
[0050] The specific steps of the subcellular localization experiment in tobacco leaves are as follows: Recombinant plasmids were transformed into Agrobacterium GV3101 using the liquid nitrogen freeze-thaw method. After confirmation by colony PCR, the strain was preserved. Agrobacterium cultured overnight was centrifuged, resuspended in a suspension, and incubated at room temperature for 3 hours. Subsequently, it was injected into leaves of 4-5 leaf stage *Tobacco Bengal*. The localization results were observed using a laser confocal microscope 3 days later. The suspension consisted of MgCl2, MES, and AS, with concentrations of 10 mM for MgCl2, 10 mM for MES, and 100 μM for AS.
[0051] 4. Virus-induced seed zucchini CpWRKY51 The instantaneous overexpression.
[0052] Double enzyme digestion: The overexpression vector ZYMV-eGFP plasmid was digested with ApaⅠ and SalⅠ. Reaction system: 20 μL plasmid DNA, 5 μL 10×NEB Buffer, 2 μL BamHI, 2 μL SacⅠ, 21 μL ddH2O, incubated at 37℃ for 3 h. The digestion products were separated by 1% agarose gel electrophoresis and recovered. CpWRKY51 The target fragment and the ZYMV-eGFP vector backbone.
[0053] The ZYMV-eGFP plasmid is described in the following literature: Liu Liming, Kang Baoshan, Peng Bin, et al. Construction and infectivity of ZYMV infectious clones carrying eGFP [J]. Acta Phytopathologica Sinica, 2021, 51(05):734-740. DOI:10.13926 / j.cnki.apps.000539.
[0054] Recombinant expression vector ligation: CpWRKY51 The target fragment was mixed with the ZYMV-eGFP vector backbone at a molar ratio of 3:1 and ligated with T4 DNA Ligase. The reaction system consisted of 2 μL of vector backbone, 5 μL of target fragment, 1 μL of 10×T4 Buffer, 1 μL of T4 DNA Ligase, and 1 μL of ddH2O. The ligation was carried out overnight at 16°C.
[0055] Transformation and identification: The ligation product was transformed into DH5α competent cells and plated on LB solid medium containing 50 μg·mL⁻¹ Kan. Single colonies were picked for colony PCR identification. Positive clones were cultured and plasmids were extracted. The plasmids were verified by double digestion with BamHI and SacⅠ and confirmed by sequencing. The recombinant overexpression vector was named pCAMBIA1300-WRKY51.
[0056] The recombinant overexpression vector was transformed into Agrobacterium GV3101 using the freeze-thaw method: 1 μg of recombinant plasmid was added to 100 μg of GV3101 competent cells and incubated on ice for 30 min; then flash-frozen in liquid nitrogen for 5 min, incubated in water at 37°C for 5 min, and immediately incubated on ice for 2 min; 800 μg of LYEB liquid medium was added and incubated at 28°C and 200 rpm. -1 Shaking culture for 2 hours; take 200 μL of bacterial culture and spread it on a medium containing 50 μg / mL... -1 Kan and 20 μg·mL -1 The Rif bacteria were cultured on YEB solid medium at 28°C inverted for 48 hours. Single colonies were picked and identified by colony PCR using WRKY gene-specific primers. Positive Agrobacterium strains were stored in YEB medium containing 50% glycerol at –80°C for subsequent transient overexpression experiments of MRJ materials.
[0057] 5. Determination of ROS, antioxidants and MDA.
[0058] Inoculate powdery mildew with CpWRKY51 Overexpressing plants and control plants were observed to respond to the pathogen 7 days after inoculation. Leaf samples were collected 72 hours after inoculation for the determination of relevant physiological indicators and histological observation. Malondialdehyde (MDA) content and O2 were determined using kits purchased from Solarbio, Beijing, China. - The content of H2O2, and the activities of catalase, superoxide dismutase, and peroxidase were measured. H2O2 accumulation and O2 content were assessed by 3,3-diaminobenzidine staining, nitroblue tetrazolium staining, and trypan blue staining, respectively. - Accumulation and induction of allergic cell death. 1 cm discs were obtained using a perforator and immersed in DAB and NBT solutions, incubated at room temperature in the dark. DAB staining was used to detect the presence of H2O2 in the leaves; specifically, the leaves were immersed in a 1 mg / mL DAB solution at pH 3.8 for 12 h. NBT staining was used to detect the presence of superoxide anions in the leaves; the leaves were immersed in 0.1 mM NBT at pH 7.8 for 15 min under vacuum, then placed at room temperature until a blue precipitate was observed. For tyrosine blue staining, the leaves were placed in anhydrous ethanol and boiled for 30 min to decolorize. The leaves were then stained with 0.1% tyrosine blue solution for 4 h, and the stained leaves were placed in lactol water for microscopic observation of hyphal growth.
[0059] Among them, malondialdehyde is abbreviated as MDA, catalase as CAT, superoxide dismutase as SOD, peroxidase as POD, 3,3-diaminobenzidine as DAB, nitroblue tetrazolium as NBT, allergic reaction as HR, and superoxide anion as O2. - .
[0060] 6. Yeast one-hybrid experiment, abbreviated as Y1H.
[0061] Will CpWRKY51 The CDS region was cloned into the pGADT7 vector. A 30 bp DNA fragment containing the target cis-element was tandemly repeated three times and inserted into the pABAi vector, which was synthesized by Tsingke Biotechnology. These vectors were co-transformed into Y1HGold yeast cells in specific combinations and cultured on SD / -Ura / -Leu medium. Positive transformants were screened and verified by genomic PCR, then inoculated into SD / -Ura / -Leu medium containing amberrin A. Growth was observed and photographed after 3 days of incubation at 28°C. Yeast strains transfected with the empty pGADT7 vector served as negative controls. Amberrin A is abbreviated as AbA.
[0062] 7. Electrophoretic mobility variation analysis and dual-luciferase assay. Electrophoretic mobility variation analysis is abbreviated as EMSA.
[0063] The GST-CpWRKY51 fusion protein was expressed in *E. coli* BL21(DE3) cells and purified according to the purification kit instructions. EMSA experiments were performed using the LightShift chemiluminescent EMSA kit, following the kit instructions. Protein-DNA interactions were detected by chemiluminescence using the ChemiDoc™ MP imaging system. GST protein alone served as a negative control. The purification kit was purchased from Clontech, Mountain View, CA, USA; the LightShift chemiluminescent EMSA kit was purchased from Thermo Scientific, Waltham, MA; and the ChemiDoc™ MP imaging system was purchased from Bio-Rad, Hercules, CA, USA.
[0064] Transient expression dual-luciferase assay is used to detect CpWRKY51 right CpPR1d / e / f The regulatory role of promoters. CpPR1d / e / f The promoter was cloned into the pGreenII-0800-LUC vector to construct a reporter plasmid. CpWRKY51 CDS was cloned into the pGreenII62-SK vector to construct an effector plasmid. Both plasmids were co-transformed into Agrobacterium and injected into leaves of *Nicotiana benthamiana*. After culture, LUC and REN activities in the leaves were measured, and the LUC / REN ratio was calculated to reflect the effector plasmid activity. CpWRKY51 Transcriptional regulatory activity of each promoter.
[0065] result
[0066] 1.CpWRKY51 subcellular localization and transcriptional activation activity.
[0067] The subcellular localization of CpWRKY51-eGFP fusion construct driven by constitutive CaMV 35S promoter was studied. The results showed that the fluorescence signal of CpWRKY51-eGFP was only observed in the nucleus, while the signal of GFP control appeared in multiple subcellular structures, including the plasma membrane and the nucleus, as shown in A of Figure 1 is a nuclear localization protein. CpWRKY51
[0068] In the transcriptional activation experiment, three yeast strains could grow normally on SD / -Trp medium. The negative control Y2HGold / pGBKT7 expressed leucine due to the leakage of the plasmid, and could not grow on SD / -Ade / -His / -Trp medium, as shown in B of Figure 1 . The positive control VP16 had transcriptional activation activity, which could activate the HIS3 and ADE2 reporter genes, so that Y2HGold / pGBKT7-VP16 could grow on SD / -Ade / -His / -Trp medium. The growth of Y2HGold / pGBKT7-CpWRKY51 on SD / -Ade / -His / -Trp medium was comparable to that of the positive control, which confirmed that CpWRKY51 has intrinsic transcriptional activation ability.
[0069] In order to clarify whether CpWRKY51 can specifically bind to W-box elements, a yeast one-hybrid experiment was carried out, in which the sequence of the W-box element is shown in C of Figure 1 , and mW-box is a mutant sequence of W-box. The results showed that pGADT7-CtWRKY51 / pABAi-W-box, pGADT7 / pABAi-W-box, pGADT7-CtWRKY51 / pABAi-mW-box, and pGADT7 / pABAi-mW-box could all grow on SD medium lacking leucine and uracil, but only pGADT7-CtWRKY51 / pABAi-W-box could grow normally on the medium added with Aureobasidin A, as shown in D of Figure 1 , indicating that CpWRKY51 has the ability to specifically bind to W-box elements.
[0070] 2、 CpWRKY51 Overexpression enhances the defense response of seed pumpkin to powdery mildew.
[0071] In order to further clarify CpWRKY51 In the mechanism of resistance to powdery mildew in seed squash, the early defense response in the infection process was studied, including the accumulation of H2O2 and O2 - and the induction of HR. NBT and DAB staining were used for histological observation to assess the production of O2 - and H2O2, respectively, and trypan blue staining was used to assess HR.
[0072] As shown in Figure 2 , after powdery mildew infection, the surfaces of wild-type WT and empty vector ZYMV-eGFP-treated squash leaves were covered with typical powdery lesions, while the lesion of CpWRKY51 overexpression plant leaves was significantly reduced, directly reflecting stronger disease resistance; GFP fluorescence observation showed that only the ZYMV-eGFP group showed specific fluorescence, indicating that the empty vector successfully expressed the eGFP tag, while the CpWRKY51 group showed no fluorescence, ruling out the interference of the vector background on the phenotype, confirming that the difference in leaf disease resistance phenotype was directly caused by overexpression of the CpWRKY51 gene; the results of trypan blue staining showed that a large number of dense mycelial structures were visible in the leaves of the WT and ZYMV-eGFP groups, and the staining was deep, indicating that the powdery mildew infection was severe, while the mycelial structure of the CpWRKY51 overexpression group was sparse and the staining was light, indicating that overexpression of the gene significantly inhibited the mycelial infection and expansion of powdery mildew.
[0073] Further verification by disease index DI quantitative statistics showed that the DI of the WT group was 31.6a, the DI of the ZYMV-eGFP group was 29.2a, and there was no significant difference between the two groups, while the DI of the CpWRKY51 overexpression group was only 18.3b, which was significantly different from the previous two groups, and different letters represented P<0.05, which confirmed from the statistical point of view that overexpression of CpWRKY51 could significantly reduce the severity of powdery mildew in squash.
[0074] In summary, overexpression of CpWRKY51 can significantly enhance the resistance of squash to powdery mildew, providing direct phenotypic and physiological evidence for its application in disease resistance breeding of squash.
[0075] The results showed that in the overexpression CpWRKY51 plant, the control germplasm WT and CK, H2O2 and O2 - were accumulated at the infection site, but the production rate in the overexpression plant was significantly higher than that in WT and CK, as shown in Figure 3 A. Quantitative analysis confirmed that the levels of H2O2 and O2 - in the overexpression plant were significantly increased, as shown in Figure 3 B and C. Trypan blue staining showed that the induction of dead cells in the overexpression plant was more obvious compared with WT and CK, as shown in Figure 3 A, which was consistent with the accumulation pattern of H2O2 and O2 - .
[0076] Furthermore, biotic stress often induces severe oxidative damage in plants, impairing their growth and development. Analysis of antioxidant enzyme activity indicates that overexpression... CpWRKY51 The activities of SOD, CAT, and POD in the plants were significantly higher than those in WT and CK, such as Figure 3 The DF in the middle. These results combined indicate that, CpWRKY51 By triggering strong heart rate and cell death, while upregulating antioxidant enzymes to alleviate oxidative stress, it enhances resistance to powdery mildew.
[0077] 3. Subject to CpWRKY51 Screening of regulatory genes.
[0078] To identify the response of seed zucchini to powdery mildew infection. CpWRKY51 This invention compared the transcriptome profiles of overexpressing lines and control plants (CK) 24 hours after inoculation with powdery mildew using transcriptome sequencing. Differentially expressed genes were identified and screened based on a Foldchange ≥ 2 and a false discovery rate < 0.01. The results showed that the expression of 226 genes was significantly affected, with 191 upregulated and 35 downregulated, such as... Figure 4 In the GO enrichment analysis, the most significantly enriched item was "defense response," involving 12 genes, all of which showed increased expression levels in the overexpression lines.
[0079] These defense-related genes include disease-related protein genes. CpPR1a , CpPR1b , CpPR1c , CpPR1d , CpPR1e and CpPR1f Among them, pathogenesis-related proteins are abbreviated as PR. These PR genes are highly conserved across different plant species and are typically induced to express by pathogen infection, indicating that... CpWRKY51 It is possible that the expression of CpPR1b / e / f is positively regulated by modulating the CpPR gene, thereby enhancing the immunity of seed zucchini to powdery mildew infection. Transcriptomic analysis revealed that the expression levels of CpPR1b / e / f were most significantly upregulated, such as... Figure 5 A, it is speculated that it may be affected by CpWRKY51 Regulation of [the virus / organization]. To verify this, this invention compared [various parameters] using RT-qPCR. CpWRKY51 Overexpression lines and wild-type plants after powdery mildew infection CpPR1b / e / f Expression levels. Results showed that after powdery mildew infection, CpWRKY51 Overexpression lines CpPR1b / e / f The expression level was significantly higher than that of wild-type plants, such as Figure 5 B. Further identification via DAP-seq CpWRKY51 The genomic binding site. Analysis of the PR gene promoter revealed that...CpPR1b / e / f The promoter region contains W-box sequence and binding signal is detected in DAP-seq data. It is presumed that CpPR1b / e / f is CpWRKY51 a key target gene directly regulated.
[0080] 4、 CpWRKY51 is CpPR1b / e / f specifically bound to the promoter.
[0081] Numerous studies have shown that WRKY transcription factors regulate gene expression by specifically recognizing W-box cis-acting elements in the promoter of target genes. In the present application, CpWRKY51 overexpression of CpPR1b / e / f significantly up-regulates, and bioinformatics analysis identifies a typical W-box motif in the CpPR1b / e / f promoter region, which indicates that CpPR1b / e / f may be CpWRKY51 a direct target. To verify this hypothesis, yeast one-hybrid experiments were performed under the screening condition of 500 ng / mL of Aureobasidin A (AbA). The experimental group Y1HGold[CpPR1b / e / f-AbAi+pGADT7-CpWRKY51] and the positive control Y1HGold[p53-AbAi+pGADT7-p53] both grew normally on the SD / -Leu-Ura / AbA medium, while all the negative controls were completely inhibited, as Figure 6 , which confirms that CpWRKY51 has a specific interaction with the CpPR1b / e / f promoter. In vitro binding experiments further show that the purified GST-CpWRKY51 fusion protein forms a DNA-protein complex with the biotin-labeled CpPR1b / e / f promoter probe, which is evidenced by a clear change in electrophoretic mobility, as Figure 7 . The probe containing a mutated W-box core sequence does not form a specific complex. No migration band is observed for the GST-tagged control protein, ruling out non-specific interactions. In summary, these results show that CpWRKY51 directly binds to the W-box element in the CpPR1b / e / f promoter, laying a molecular foundation for its potential role in regulating CpPR1b / e / f transcription.
[0082] And WRKY transcription factor is the core regulatory factor in plant disease resistance signaling pathway, CpWRKY51 can enhance the systemic resistance of plants to powdery mildew by activating the pathogenesis-related genes in the chloroplast, such as activating PR genes. This disease resistance strategy based on gene regulation has the advantages of resistance persistence, environmental friendliness and independence on chemical pesticides, and can provide a new solution for zucchini powdery mildew prevention and treatment from the molecular level, and fill the gap of the prior art.
[0083] It should be noted that when the present application claims involving numerical ranges, it should be understood that each numerical range of two endpoints and any number between the two endpoints can be selected, in order to prevent repetition, the present application describes the preferred embodiments.
[0084] Although the preferred embodiments of the present application have been described, those skilled in the art can make further changes and modifications to these embodiments once they know the basic inventive concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present application.
[0085] Obviously, those skilled in the art can make various modifications and variations to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application also intends to include these modifications and variations.
Claims
1. CpWRKY51 In the use in the regulation of resistance to powdery mildew in zucchini, characterized in that, The CpWRKY51 The nucleotide sequence is shown in SEQ ID NO.1; The modulation is by overexpression of said CpWRKY51 Increasing resistance of zucchini to powdery mildew.
2. Use according to claim 1, characterized in that, The method for overexpressing the CpWRKY51 The method is as follows: taking zucchini cDNA as a template to perform PCR amplification to obtain an amplification product. The amplified product is ligated to the vector ZYMV-eGFP to obtain an overexpression vector. Overexpression vector transformed Agrobacterium, infected zucchini and upregulated the aforementioned CpWRKY51 The amount of expression.
3. Use according to claim 2, characterized in that, The primer sequence used in the PCR amplification is shown in SEQ ID NO. 3~SEQ ID NO.
4.
4. Use according to claim 2, characterized in that, When the amplified product is ligated to the vector ZYMV-eGFP, the enzyme cutting sites are BamH I and Sac I.
5. Use according to claim 2, characterized in that, The connected reaction system is as follows: ZYMV-eGFP, CpWRKY51 Purpose fragment, 10x T4 Buffer, T4 DNA Ligase, ddH2O.
6. Use according to claim 2, characterized in that, The improved resistance of the zucchini to the powdery mildew is manifested as a decrease in the powdery patches.
7. A method of increasing resistance to powdery mildew in Cucurbita pepo, characterized in that, The method of claim 1, wherein the plant is a Cucurbita pepo plant CpWRKY51 introducing into Cucurbita pepo, overexpressing said CpWRKY51 thereby increasing the resistance of Cucurbita pepo to powdery mildew.