High-specificity micro nucleic acid detection method based on segmented bridging probe and ligase
By using a segmented bridging probe and ligase method combined with rolling circle amplification technology, the problems of low reverse transcription efficiency and high false positive rate in existing miRNA detection technologies have been solved, achieving high specificity and high sensitivity of miRNA detection.
Patent Information
- Application Number
- CN202511615587.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-06
- Publication Date
- 2026-01-06
AI Technical Summary
Existing miRNA detection technologies suffer from low reverse transcription efficiency, high false positive rate, and insufficient sensitivity, failing to meet the detection needs of low-abundance miRNAs.
A segmented bridging probe and ligase method was used to divide the binding strand into three single strands. A stable ternary complex could only be formed when the target miRNA was present. The specific ligation was achieved through SplintR enzyme and combined with rolling circle amplification technology to improve detection sensitivity.
It achieves 100% connection specificity and high sensitivity detection from aM to fM, completely eliminating false positives and meeting the detection needs of low-abundance miRNAs.
Smart Images

Figure CN121272016A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of nucleic acid molecular detection technology, and in particular relates to a highly specific micronucleic acid detection method based on segmented bridging probes and ligases. Background Technology
[0002] miRNAs, a class of endogenous non-coding small RNA molecules approximately 18-25 nt in length, act as "molecular switches" in physiological and pathological processes such as apoptosis, tumorigenesis, and metabolic regulation. Abnormal miRNA expression levels are closely related to the early occurrence of major diseases such as cancer, cardiovascular disease, and neurodegenerative diseases. Clinical studies have shown that accurate detection of low-abundance miRNAs (fM-am level) in bodily fluids such as blood and cerebrospinal fluid can enable early warning and prognostic monitoring of diseases. Therefore, the performance of miRNA detection technology directly determines the timeliness and accuracy of disease diagnosis.
[0003] Existing miRNA detection technologies face significant technical bottlenecks: Traditional reverse transcription-dependent techniques, such as real-time quantitative PCR (RT-qPCR) and digital PCR (dPCR), require the miRNA to be reverse transcribed into cDNA first, resulting in sample loss due to the two-step reaction. Furthermore, the catalytic efficiency of reverse transcriptase for short-chain miRNAs is low, which cannot meet the needs of detecting low-abundance miRNAs. Although Northern blotting does not require reverse transcription, it is time-consuming (requiring 12-24 hours), has extremely low sensitivity (the detection limit is only at the nM level), and requires radiolabeling, thus limiting its clinical application. Existing SplintR ligase technology (also known as PBCV-1 DNA ligase or Chorella virus DNA ligase) solves the problem of reverse transcription dependence, but suffers from a high false positive rate due to off-target ligation (Jingmin Jin et al., Nucleic Acids Research, 2016; Eugene J.H et al., ACS Sens, 2016; He Yan et al., NAT BIOMED ENG 2023). The core reasons are: ① Probe self-circulation: Long single-stranded DNA binding strands (bridge probes) may fold into loops, mimicking the ligation substrate, and are non-specifically ligated by SplintR enzyme, thus generating a signal in subsequent PCR amplification; ② Template-free self-ligation: SplintR ligase can still induce self-ligation between the 5' and 3' ends of the linker strand even in the absence of miRNA "sandwich" template. Current industry solutions to this problem (such as adding inhibitors and optimizing buffer solutions) can only reduce the false positive rate, but cannot achieve 100% specificity. They also lead to a decrease in detection sensitivity, failing to balance specificity and sensitivity.
[0004] Therefore, developing a miRNA detection technology that is non-reverse transcription-free, false positive-free, and highly sensitive is a key technical problem that urgently needs to be solved in the fields of clinical diagnosis and molecular biology research, and has significant scientific value and clinical significance. Summary of the Invention
[0005] In view of this, the purpose of this invention is to provide a highly specific micronucleic acid detection method based on segmented bridging probes and ligases, which overcomes the defects of existing SplintR ligase detection technology, completely eliminates off-target ligation, achieves 100% ligation specificity, and further improves detection sensitivity through isothermal amplification.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a method for detecting micronucleic acids, comprising the following steps: 1) The binding strand that binds to the miRNA sample is divided into three single strands: strand A, strand B, and strand C. Strand A has a sequence that is anti-complementary to the 3' end of the miRNA, strand C has a sequence that is anti-complementary to the 5' end of the miRNA, and strand B is completely anti-complementary to the middle sequence of the miRNA. 2) Connect the 5' end of chain A and the 3' end of chain C to obtain a chain loop; 3) The binding strand, the B-strand, and the miRNA sample were bridged and SplintR enzyme-linked reaction was performed to form a complete circular ligation product. 4) After SplintR enzyme-linked reaction, Bst DNA polymerase and RCA reaction substrate are added for rolling circle amplification to generate a large number of long-chain DNA with repetitive sequences. Then, fluorescent probes and primers are added for PCR amplification to quantitatively detect the miRNA content.
[0007] Preferably, the bridging reaction system in step 3) is: 4 μL miRNA sample, 4 μL 100 nM binding strand cyclic strand, 4 μL 100 nM binding strand B strand, and 28 μL ddH2O.
[0008] Preferably, the bridging temperature in step 3) is 80~90℃, and the bridging time is 1~3min.
[0009] Preferably, the SplintR enzyme-linked reaction system in step 3) is: 10×Reaction-buffer 2μL, 1nMSubstrate 2μL, SplintR-ligase 1μL, and ddH2O 15μL.
[0010] Preferably, the SplintR enzyme-linked reaction program in step 3) is: 25℃, 60min, 1Cycle; 95℃, 3min, 1Cycle; 25℃, 2min, 1Cycle.
[0011] Preferably, the 5' and 3' ends of the probe in step 4) are modified with fluorescent groups.
[0012] Preferably, the reaction system for rolling circle amplification in step 4) is: 10×IsothermalAmp Buffer 1μL, 100mM MgSO4 0.6μL, 25mM dNTP Mix 0.6μL, Bst-II DNA Polymerase 0.4μL, ddH2O 5.4μL, and sample 2μL.
[0013] Preferably, the reaction program for rolling circle amplification in step 4) is: 60℃, 60min, 1Cycle; 95℃, 3min, 1Cycle; 25℃, 2min, 1Cycle.
[0014] Preferably, the PCR amplification reaction system in step 4) is: 10 μL of 2×Taq-mix, 1 μL of 10 μM primer, 0.2 μL of 10 μM probe, 6.3 μL of ddH2O, and 2.5 μL of sample.
[0015] Preferably, the PCR amplification reaction program in step 4) is: 95℃, 3min, 1Cycle, 95℃, 15s, and 65℃, 30s, 45Cycle.
[0016] Compared with the prior art, the present invention has the following beneficial effects: This invention employs a binding strand design of "LR circular chain + independent M chain" to form a stable ternary complex only when the target miRNA is present, triggering the specific ligation of the SplintR enzyme, thereby increasing the detection specificity of miRNA to 100% and completely eliminating false positives caused by non-specific ligation.
[0017] This invention achieves a breakthrough from "reducing false positives" to "high sensitivity at the aM-fM level" by optimizing the basic segmentation in optimization 1 to RCA amplification in optimization 4. Even with tiny nucleic acid concentrations at the micromolar level, it can completely eliminate false positives caused by nonspecific ligation, maintain 100% specificity, and balance specificity and sensitivity. miRNA is improved from undetectable to detectable. The use of isothermal amplification further improves the detection limit.
[0018] This invention allows the entire reaction process—enzyme-linked immunosorbent assay (ELISA), RCA amplification, and PCR detection—to be completed in the same reaction tube, eliminating the need for reverse transcription and high-temperature steps, thus maintaining the advantage of "one-tube" detection.
[0019] In addition to miRNA detection, this method can be directly applied to the detection of short single-stranded DNA molecules. Attached Figure Description
[0020] Figure 1 This optimizes the miRNA-specific detection results in step 1. Figure 2 This optimizes the miRNA-specific detection results in step 2; Figure 3 This is a schematic diagram of miRNA binding strand linkage; Figure 4 This optimizes the specific detection results of miRNAs in three categories; Figure 5 This optimizes the specific detection results of miRNA 4. Detailed Implementation
[0021] This invention provides a method for detecting micronucleic acids, comprising the following steps: 1) The binding strand that binds to the miRNA sample is divided into three single strands: strand A, strand B, and strand C. Strand A has a sequence that is anti-complementary to the 3' end of the miRNA, strand C has a sequence that is anti-complementary to the 5' end of the miRNA, and strand B is completely anti-complementary to the middle sequence of the miRNA. 2) Connect the 5' end of chain A and the 3' end of chain C to obtain a chain loop; 3) The binding strand, the B-strand, and the miRNA sample were bridged and SplintR enzyme-linked reaction was performed to form a complete circular ligation product. 4) After SplintR enzyme-linked reaction, Bst DNA polymerase and RCA reaction substrate are added for rolling circle amplification to generate a large number of long-chain DNA with repetitive sequences. Then, fluorescent probes and primers are added for PCR amplification to quantitatively detect the miRNA content.
[0022] In this invention, the binding strand that binds to the miRNA sample is divided into three single strands: strand A, strand B, and strand C. Strand A contains a sequence that is anticomplementary to the 3' end of the miRNA, strand C contains a sequence that is anticomplementary to the 5' end of the miRNA, and strand B is completely anticomplementary to the middle sequence of the miRNA. The preferred nucleotide sequence of the miRNA is UAUCGGGAGGAGUGAUGGAUUUAU (SEQ ID NO:1), the preferred nucleotide sequence of strand A is CACGATGAACAGCATCAGATATA AATCC (SEQ ID NO:7), the preferred nucleotide sequence of strand B is ATCACTCC (SEQ ID NO:8), and the preferred nucleotide sequence of strand C is TCCCGATATCGACTGTATGCCTGACTCG (SEQ ID NO:9).
[0023] In this invention, the 5' end of the binding strand A and the 3' end of the binding strand C are connected to obtain a binding strand ring. The preferred nucleotide sequence of the binding strand ring is TCCCGATATCGACTGTATGCCTGACTCGCACGATGAACAGCATCAGATATAAATCC (SEQ ID NO:10).
[0024] In this invention, the binding strand ring strand, the binding strand B strand, and the miRNA sample are bridged and SplintR enzyme-linked reaction is performed to form a complete circular ligation product. The bridging reaction system consists of: 4 μL miRNA sample, 4 μL 100 nM binding strand circular strand, 4 μL 100 nM binding strand B strand, and 28 μL ddH2O; the bridging temperature is preferably 80-90℃, more preferably 82-88℃, and even more preferably 85℃; the bridging time is preferably 1-3 min, more preferably 1.5-2.5 min, and even more preferably 2 min; the SplintR enzyme-linked reaction system consists of: 2 μL 10×Reaction-buffer, 2 μL 1 nM Substrate, 1 μL SplintR-ligase, and 15 μL ddH2O; the SplintR enzyme-linked reaction program is 25℃, 60 min, 1 cycle; 95℃, 3 min, 1 cycle; and 25℃, 2 min, 1 cycle.
[0025] In this invention, after SplintR enzyme-linked reaction, Bst DNA polymerase and RCA reaction substrate are added for rolling circle amplification to generate a large number of long-chain DNA with repetitive sequences. Then, fluorescent probes and primers are added for PCR amplification to quantitatively detect the miRNA content. The rolling circle amplification reaction system is as follows: 10×IsothermalAmp Buffer 1 μL, 100mM MgSO4 0.6 μL, 25mM dNTP Mix 0.6 μL, Bst-II DNA Polymerase 0.4 μL, ddH2O 5.4 μL, and sample 2 μL; the rolling circle amplification reaction program is 60℃, 60min, 1 cycle; 95℃, 3min, 1 cycle; 25℃, 2min, 1 cycle; the preferred nucleotide sequence of the probe is AATCCATCACTCCTCCC (SEQ ID NO:6), and the 5' and 3' ends of the probe are modified with fluorescent groups, preferably TexasRed at the 5' end and MGB at the 3' end; the preferred nucleotide sequences of the primers are CGAGTCAGGCATACAGTC (SEQ ID NO:4) and CACGATGAACAGCATCAG (SEQ ID NO:6). NO:5); the PCR amplification reaction system is as follows: 10 μL of 2×Taq-mix, 1 μL of 10 μM primer, 0.2 μL of 10 μM probe, 6.3 μL of ddH2O, and 2.5 μL of sample; the PCR amplification reaction program is 95℃, 3 min, 1 cycle, 95℃, 15 s, and 65℃, 30 s, 45 cycles.
[0026] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0027] Example 1
[0028] Optimization 1: Combined with the two-stage split design of the chain
[0029] Technical approach: To address false positives caused by the binding strand itself forming a loop, the traditional complete long binding strand is split into two independent short binding strands. The two strands bind complementary to different regions of the miRNA (5' end region and 3' end region), reducing the probability of a single binding strand folding into a loop by splitting the structure.
[0030] The specific implementation process is as follows: a miRNA sequence (named miR-1p) was synthesized by artificial chemical synthesis. Taking the detection of this sequence as an example, the probe and primer sequences used for bridging with the detection sequence and in the subsequent PCR detection system are as follows: the 3' and 5' ends of miR-1p-L and miR-1p-R have sequences that are inversely complementary to miR-1p (underlined parts).
[0031] Table 1. Optimized nucleotide sequences.
[0032] The specific steps are as follows: 1) First, prepare the following system for bridging. After heating at 85℃ for 2 minutes, remove it and place it at room temperature before centrifuging. The composition of each component of the bridging system is shown in Table 2.
[0033] Table 2 Composition of each component in the optimized bridging system 1
[0034] 2) SplintR enzyme-linked reaction was then performed. SplintR enzyme was purchased from New England Biolabs (Lot: M0375). The reaction system is shown in Table 3 and the reaction procedure is shown in Table 4.
[0035] Table 3 Optimization of SplintR enzyme-linked reaction system
[0036] Table 4. Optimized SplintR enzyme-linked reaction program
[0037] 3) PCR amplification detection, the reaction system is shown in Table 5, and the reaction procedure is shown in Table 6.
[0038] Table 5 Optimization of PCR amplification reaction system
[0039] Table 6 Optimized PCR amplification reaction program
[0040] Experimental results: such as Figure 1 As shown. From Figure 1 The results show that the inhibition effect of binding strand segmentation on non-specific linkages is poor, and strong non-specific linkages still exist in the reaction system, making it impossible to achieve 100% specific miRNA detection.
[0041] Optimization results: After the chain segmentation, the probability of self-circulation is significantly reduced, and the number of off-target ligation products is reduced. However, a small number of off-target ligations still exist, and the false positive problem has not been completely solved.
[0042] Example 2
[0043] Optimization 2: Combining the three-segment splitting design of the chain
[0044] Technical approach: To further enhance specificity, the binding strand is split into three independent short strands. Each of the three strands is completely complementary to the first half, middle half, and second half of the miRNA sequence, forming a multi-site complementary binding mode of "three-segment strand - target miRNA". This increases binding specificity and inhibits non-specific binding.
[0045] Implementation process: Three binding strands are added to the detection system. Only when miRNA is present can the three binding strands be precisely aligned under the "clamping" effect of miRNA, and SplintR ligase will catalyze the ligation reaction of the three strands. Without miRNA, the three strands are difficult to ligate because they cannot be aligned.
[0046] To further reduce non-specific ligation, the miRNA binding strand was split into three segments, as shown below. The other primer and probe sequences used are consistent with those in Optimization 1. Specifically, miR-1p-1L and miR-1p-1R have sequences at their 3' and 5' ends that are inversely complementary to miR-1p, while miR-1p-1M is completely inversely complementary to the middle sequence of miR-1p (underlined portion). Table 7 shows the optimized nucleotide sequences.
[0047] 1) First, prepare the following system for bridging. After heating at 85°C for 2 minutes, remove it and place it at room temperature before centrifuging. The bridging reaction system is shown in Table 8.
[0048] Table 8 Optimization of the bridging reaction system
[0049] 2) SplintR enzyme-linked reaction was then performed. The reaction system is shown in Table 9, and the reaction procedure is shown in Table 10.
[0050] Table 9. Optimization of the SplintR enzyme-linked reaction system
[0051] Table 10 Optimized SplintR enzyme-linked reaction program
[0052] 3) PCR amplification detection, the reaction system is shown in Table 11, and the reaction procedure is shown in Table 12.
[0053] Table 11 Optimized 2PCR amplification reaction system
[0054] Table 12 Optimized 2PCR amplification reaction program
[0055] Experimental results: such as Figure 2 As shown. By Figure 2 The reaction results showed that there were no non-specific peaks in the blank control of this system, achieving 100% detection specificity. However, this detection system had low sensitivity for miRNA detection, with low overall fluorescence values and a high detection limit.
[0056] Optimization results: 100% detection specificity is achieved, with no non-specific ligation products generated, and the false positive problem is completely solved; however, due to the low binding efficiency of the three binding strands to miRNA (the probability of simultaneous binding of multiple strands decreases), the detection sensitivity is low.
[0057] Example 3
[0058] Optimization 3: Combining the chain's "circular complementarity + single-segment auxiliary" design
[0059] Technical approach: Based on the specificity of optimization 2, and balancing binding efficiency and sensitivity, the binding chain is designed as a "two-stage combination structure": The first segment: The L segment and R segment in optimization 2 are paired at the beginning and end to form a circular pre-formed strand (denoted as LR circular strand). The inner base sequence of this circular strand is complementary to the 5' end and 3' end of the miRNA. The second segment retains the M segment (denoted as the independent M chain) from optimization 2, whose sequence is complementary to the middle segment of the miRNA.
[0060] By combining the LR circular chain with an independent M chain, the circular structure reduces the probability of non-specific ligation, while the M chain enhances the binding efficiency with miRNA (forming a stable ternary complex of "circular chain-target-M chain"). SplintR ligase only catalyzes the specific ligation of the LR circular chain and the M chain in the presence of miRNA, forming a complete circular product. A schematic diagram of the ligation process is shown below. Figure 3 As shown.
[0061] Implementation process: Building upon optimization 2, this optimization strategy further enhances detection sensitivity while maintaining 100% ligation specificity. The primary optimization involves linking the 5' end of the miR-1p-1L binding strand to the 3' end of the miR-1p-1R strand, increasing the binding efficiency of these two segments with the miRNA. The other primer and probe sequences used in this optimization strategy are consistent with those in optimization 1. Specifically, the 3' and 5' ends of miR-1p-1RL contain sequences that are reverse complementary to miR-1p, and miR-1p-1M is completely reverse complementary to the central sequence of miR-1p (underlined portion). Table 13 shows the optimized nucleotide sequences.
[0062] 1) First, prepare the following system for bridging. After heating at 85°C for 2 minutes, remove it and place it at room temperature before centrifuging. The bridging reaction system is shown in Table 14.
[0063] Table 14 Optimization of the 3-Bridging Reaction System
[0064] 2) SplintR enzyme-linked reaction was then performed. The reaction system is shown in Table 15 and the reaction procedure is shown in Table 16.
[0065] Table 15 Optimized 3SplintR enzyme-linked reaction system
[0066] Table 16 Optimized 3SplintR enzyme-linked reaction program
[0067] 3) PCR amplification detection, the reaction system is shown in Tables 17 and 18, and the reaction procedure is shown in Table 19.
[0068] Table 17 Optimized 3PCR amplification probe method reaction system
[0069] Table 18 Optimized 3PCR amplification dye method reaction system
[0070] Table 19 Optimized 3PCR amplification reaction procedure
[0071] Experimental results: such as Figure 4As shown in the figure. The results of the dye method in optimization 3 show that the system in the blank control group still has strong non-specific binding. However, the results of the probe method show that using miR-1p-1RL as the binding strand can maintain 100% detection specificity, with no non-specific peaks. At the same time, the detection sensitivity is significantly improved compared to optimization 2.
[0072] Optimization results: Specificity: Only the complete circular product specifically ligated by SplintR enzyme can bind to the fluorescent probe and emit light, while the non-specific ligation product has no fluorescent signal, achieving 100% detection specificity; Sensitivity: The detection limit reaches 20 nt / μL (i.e., fM level), which meets the detection requirements of low abundance miRNA; False positive resolution: Completely solves the problem of non-specific ligation of SplintR enzyme, with no self-circulation or target ligation phenomena.
[0073] Example 4
[0074] Optimization 4: Design to enhance sensitivity of rolling circle amplification (RCA)
[0075] Technical approach: Based on optimization 3, rolling circle amplification (RCA) technology is introduced. The RCA enzyme (selected as Bst DNA polymerase, which has strand displacement activity) is used to exponentially amplify specific circular ligation products, thereby further improving detection sensitivity.
[0076] Implementation process: Based on the system of optimization 3, Bst II DNA polymerase (Vazyme, Lot:P702-01) was introduced to pre-amplify the circular DNA molecules generated by miR-1p-1RL and miR-1p-1M (rolling circle amplification RCA) to further improve the detection sensitivity. The primer and probe sequences used in this optimization strategy are consistent with those of optimization 3.
[0077] 1) First, prepare the following system for bridging. After heating at 85°C for 2 minutes, remove it and place it at room temperature before centrifuging. The bridging reaction system is shown in Table 20.
[0078] Table 20 Optimization of the 4-Bridging Reaction System
[0079] 2) Perform SplintR enzyme-linked reaction. The reaction system is shown in Table 21, and the reaction procedure is shown in Table 22.
[0080] Table 21 Optimized 4SplintR enzyme-linked reaction system
[0081] Table 22 Optimized 4SplintR enzyme-linked reaction program
[0082] 3) Conduct the isothermal amplification reaction. The reaction system is shown in Table 23, and the reaction procedure is shown in Table 24.
[0083] Table 23 Isothermal Amplification Reaction System
[0084] Table 24 Isothermal Amplification Reaction Procedure
[0085] 4) PCR amplification and detection: The reaction system is shown in Table 25, and the reaction procedure is shown in Table 26.
[0086] Table 25 Optimization of 4PCR amplification reaction system
[0087] Table 26 Optimized 4PCR amplification reaction program
[0088] Experimental results: such as Figure 5 As shown. From Figure 5 The results showed that Bst II DNA polymerase can amplify the circular DNA molecules generated by miR-1p-1RL and miR-1p-1M, which significantly improves the detection sensitivity. The Ct value is reduced by about 8.8, and the detection sensitivity is increased by more than 400 times. At the same time, no non-characteristic peaks were observed in the blank control, proving that the system can detect miRNA with 100% specificity.
[0089] Optimization results: Specificity: Bst enzyme amplifies only the circular product specifically linked to SplintR as a template, with no non-specific amplification, maintaining 100% specificity; Sensitivity: Compared to Optimization 3, the sensitivity is improved by about 400 times, and the detection limit can be as low as am level, meeting the needs of accurate detection of trace amounts of miRNA.
[0090] As can be seen from the above embodiments, the present invention, through the binding strand design of "LR circular chain + independent M chain", can only form a stable ternary complex when the target miRNA is present, triggering the specific ligation of SplintR enzyme, improving the detection specificity to 100%, completely eliminating false positives caused by non-specific ligation, and achieving a breakthrough in high sensitivity at the aM-fM level.
[0091] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method for detecting a micro nucleic acid, characterized by, The method comprises the following steps: 1) the binding chain combined with the miRNA sample is divided into three single strands, A chain, B chain and C chain, the A chain has a sequence complementary to the 3' end of the miRNA, the C chain has a sequence complementary to the 5' end of the miRNA, and the B chain is completely complementary to the middle sequence of the miRNA; 2) the 5' end of the A chain and the 3' end of the C chain are connected to obtain a binding chain ring chain; 3) the binding chain ring chain, the binding chain B chain and the miRNA sample are bridged to perform a SplintR enzyme-linked reaction to form a complete circular connection product; 4) after the SplintR enzyme-linked reaction, Bst DNA polymerase and RCA reaction substrates are added to perform rolling circle amplification to generate a long-chain DNA with a large number of repeated sequences, and then a fluorescent probe and a primer are added to perform PCR amplification to quantitatively detect the content of the miRNA.
2. The method of claim 1, wherein the micro nucleic acid is a micro RNA. The reaction system for the bridging in step 3) is 4 μL of the miRNA sample, 4 μL of 100 nM binding chain ring chain, 4 μL of 100 nM binding chain B chain and 28 μL of ddH2O.
3. The method of claim 1, wherein the micro nucleic acid is a micro RNA. The temperature for the bridging in step 3) is 80-90 ℃, and the time for the bridging is 1-3 min.
4. The method of claim 1, wherein the micro nucleic acid is a micro RNA. The SplintR enzyme-linked reaction system in step 3) is 2 μL of 10×Reaction-buffer, 2 μL of 1 nM Substrate, 1 μL of SplintR-ligase and 15 μL of ddH2O.
5. The method of claim 1, wherein the micro nucleic acid is a micro RNA. The SplintR enzyme-linked reaction program in step 3) is 25 ℃, 60 min, 1 Cycle, 95 ℃, 3 min, 1 Cycle and 25 ℃, 2 min, 1 Cycle.
6. The method of claim 1, wherein the micro nucleic acid is a micro RNA. The 5' end and the 3' end of the probe in step 4) are modified with fluorescent groups.
7. The method of claim 1, wherein the micro nucleic acid is a micro RNA. The reaction system for the rolling circle amplification in step 4) is 1 μL of 10×IsothermalAmp Buffer, 0.6 μL of 100 mM MgSO4, 0.6 μL of 25 mM dNTP Mix, 0.4 μL of Bst-II DNA Polymerase, 5.4 μL of ddH2O and 2 μL of the sample.
8. The method of claim 1, wherein the micro nucleic acid is a micro RNA. The reaction program for the rolling circle amplification in step 4) is 60 ℃, 60 min, 1 Cycle, 95 ℃, 3 min, 1 Cycle and 25 ℃, 2 min, 1 Cycle.
9. The method of claim 1, wherein the micro nucleic acid is a micro RNA. The reaction system for the PCR amplification in step 4) is 10 μL of 2×Taq-mix, 1 μL of 10 μM primer, 0.2 μL of 10 μM probe, 6.3 μL of ddH2O and 2.5 μL of the sample.
10. The method of claim 1, wherein the micro nucleic acid is a micro RNA. The reaction program for the PCR amplification in step 4) is 95 ℃, 3 min, 1 Cycle, 95 ℃, 15 s, 65 ℃, 30 s, 45 Cycle.