A single tube quantitative detection of HCV viral load real-time fluorescent quantitative PCR kit

By using dual internal standard real-time fluorescence quantitative PCR technology, the problems of false positives and false negatives in HCV RNA detection have been solved, achieving high sensitivity and high accuracy in HCV viral load detection, covering multiple subtypes, and simplifying the operation process.

CN121272118BActive Publication Date: 2026-04-07BORUIYUAN BIOTECHNOLOGY (BEIJING) CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511813699.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-04
Publication Date
2026-04-07
Estimated Expiration
2045-12-04

AI Technical Summary

Technical Problem

Existing HCV RNA detection methods suffer from false positives and false negatives, and conventional internal standard methods have limitations in terms of detection sensitivity and quantitative accuracy, leading to inaccurate test results.

Method used

The dual internal standard technique, which involves adding two internal standards of known copy number to the same tube and combining them with real-time quantitative PCR, enables the quantitative detection of HCV RNA. This avoids the need for additional quantitative reference materials, simplifies the operation, and improves the accuracy and sensitivity of the detection.

Benefits of technology

It achieves highly sensitive detection of HCV viral load, with good repeatability, covers multiple subtypes, simplifies the operation process, and improves detection accuracy and reagent utilization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121272118B_ABST
    Figure CN121272118B_ABST
Patent Text Reader

Abstract

The application discloses a single-tube quantitative detection HCV viral load real-time fluorescent quantitative PCR kit and belongs to the technical field of molecular biological detection. The kit comprises a pair of primers and a probe combination, the primer and the probe combination comprise a primer pair and a probe for detecting a target gene and a probe for detecting an internal standard. The kit can detect HCV 1-6 common types in clinic, covers all types, can stably detect a viral load of 10 IU / mL, has high detection sensitivity and good repeatability, does not need additional quantitative reference product to construct a calibration curve, simplifies operation, improves the utilization rate of reagents, and avoids invalid results and repeated detection caused by the failure of calibration curve construction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biological detection technology, and in particular to a single-tube quantitative real-time fluorescence quantitative PCR kit for detecting HCV viral load. Background Technology

[0002] Hepatitis C virus (HCV) belongs to the Flaviviridae family. Its genome is a single-stranded positive-sense RNA that is prone to mutation. HCV can develop slowly over many years, usually without symptoms. Chronic infection can lead to chronic inflammation, necrosis, and fibrosis of the liver. Some patients may develop cirrhosis or even hepatocellular carcinoma (HCC), posing a significant threat to their health and lives and becoming a serious social and public health problem. HCV is a blood-borne virus, with most infections occurring through blood contact, including unsafe injection practices, unsafe healthcare practices, transfusions of unscreened blood, injection drug use, and sexual behaviors that can lead to blood contact. HCV is prevalent globally. According to the World Health Organization, there are approximately 50 million people living with chronic hepatitis C virus worldwide, with about 1 million new cases of hepatitis C each year.

[0003] Currently, commonly used laboratory testing methods include antibody screening and HCV RNA detection. False positives for anti-HCV may occur in some patients with autoimmune diseases, while false negatives may occur in patients undergoing hemodialysis, those with immunodeficiency, or those co-infected with HIV. Patients with acute hepatitis C may be negative for anti-HCV due to being in the window period. However, HCV RNA detection based on real-time quantitative PCR technology overcomes these shortcomings. It can be used to monitor HCV RNA levels and changes, analyze baseline viral load before antiviral therapy, and assess response after treatment. It offers advantages such as high automation, ease of operation, and high detection sensitivity.

[0004] Real-time quantitative PCR (qPCR) strategies are divided into external standard and internal standard methods. The commonly used method is the external standard method, which requires a series of quantitative reference standards of known concentrations to be detected simultaneously with the sample. The concentration of the test sample is calculated using the linear relationship between the log value (x) of the reference standard concentration and the amplified Ct value (y). This method requires additional reference standards per test, increasing experimental costs. Furthermore, differences in amplification efficiency or nucleic acid extraction processes between the sample and the reference standards can lead to poor quantification accuracy. The internal standard method, on the other hand, amplifies a known concentration of internal standard and the test sample in the same tube. The amount of the test sample is calculated based on the amount of internal standard, eliminating sample loading errors and amplification efficiency differences, thus improving the accuracy and reproducibility of the results. Conventional internal standard quantification often uses a single internal standard design, which has limitations in detection sensitivity and quantitative accuracy. A single internal standard may fluctuate under certain experimental conditions, introducing systematic errors and affecting the detection results.

[0005] Therefore, this application develops an HCV nucleic acid quantitative detection kit based on the competitive internal standard method, which uses dual internal standard technology to improve the accuracy and sensitivity of HCV detection, providing an accurate and reliable basis for HCV detection. Summary of the Invention

[0006] The purpose of this invention is to provide a single-tube real-time quantitative PCR kit for detecting HCV viral load, employing dual internal standard technology to address the problems existing in the prior art. This kit covers multiple HCV subtypes, can stably detect viral loads up to 10 IU / mL, exhibits high sensitivity and good repeatability, and eliminates the need for additional quantitative references to construct a quantitative standard curve, simplifying operation and improving reagent utilization.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] In a first aspect, the present invention provides a primer and probe combination for single-tube quantitative detection of HCV viral load by real-time fluorescence quantitative PCR, including primer pairs and probes for detecting target genes, and probes IC-P1 and IC-P2 for detecting internal standards.

[0009] The primer pair for detecting the target gene includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2;

[0010] The nucleotide sequence of the probe for detecting the target gene is shown in SEQ ID NO.3;

[0011] The nucleotide sequence of the probe IC-P1 for detecting the internal standard is shown in SEQ ID NO.12;

[0012] The nucleotide sequence of the probe IC-P2 for detecting the internal standard is shown in SEQ ID NO.13.

[0013] Preferably, the probe for detecting the target gene is labeled with a FAM group at its 5' end and a BHQ1 group at its 3' end;

[0014] The probe IC-P1 for detecting the internal standard is labeled with the ROX group at its 5' end and the BHQ2 group at its 3' end.

[0015] The probe IC-P2, used to detect the internal standard, is labeled with a CY5 group at its 5' end and a BHQ2 group at its 3' end.

[0016] Secondly, the present invention also provides the application of the primer and probe combination described above in the preparation of a single-tube quantitative real-time fluorescence quantitative PCR kit for detecting HCV viral load.

[0017] Thirdly, the present invention also provides a single-tube quantitative real-time fluorescence quantitative PCR kit for detecting HCV viral load, the kit comprising the aforementioned primer and probe combination.

[0018] Preferably, the single-tube quantitative HCV viral load real-time fluorescence quantitative PCR kit further includes RT-qPCR buffer, enzyme mixture, negative control, positive control, weak positive control and internal standard.

[0019] Preferably, the RT-qPCR Buffer comprises 200 μM dATP, 200 μM dCTP, 240 μM dGTP, 240 μM dUTP, 5.5 mM MgCl2, 80 mM KCl and 30 mM Tris-HCl.

[0020] Preferably, the enzyme mixture comprises 3 U / reaction of hot-start Taq enzyme, 0.2 U / reaction of uracil glycosylation enzyme, and 100 U / reaction of reverse transcriptase.

[0021] Preferably, the internal standard includes armor RNA IC1 and armor RNA IC2; the nucleotide sequence of armor RNA IC1 is shown in SEQ ID NO.10; and the nucleotide sequence of armor RNA IC2 is shown in SEQ ID NO.11.

[0022] Preferably, the positive control and the weak positive control are armored RNA containing the HCV target fragment at different concentrations, and their nucleotide sequences are shown in SEQ ID NO.14.

[0023] The present invention discloses the following technical effects:

[0024] (1) The kit of the present invention can detect common clinical types of HCV 1-6, and has comprehensive coverage of types.

[0025] (2) The kit of this invention uses a competitive dual internal standard method for quantification. Two internal standards with known copy numbers are added to the sample to be tested, and nucleic acid extraction and RT-qPCR amplification are performed simultaneously with the sample. The internal standard Ct value is introduced into the quantification formula to complete the quantification of HCV RNA. No additional quantitative reference is required to construct a calibration curve, which simplifies the operation, improves the utilization rate of reagents, and avoids invalid results and duplicate detection caused by calibration curve construction failure. The use of two internal standards can mutually verify and compensate for each other, greatly reducing the deviation introduced by internal standard fluctuations, making the quantification results more accurate and reliable. The combined use of dual internal standards improves the accuracy of quantification.

[0026] (3) The kit of the present invention can stably detect viral load of 10 IU / mL, with high detection sensitivity and good repeatability. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 The amplification curve (A) and amplification efficiency graph (B) of the target are shown.

[0029] Figure 2 The amplification curve (A) and amplification efficiency graph (B) of the internal standard IC1 are shown.

[0030] Figure 3 The amplification curve (A) and amplification efficiency graph (B) of the internal standard IC2 are shown.

[0031] Figure 4 Amplification curve for a 10 IU / mL sensitivity reference standard;

[0032] Figure 5 This is a schematic diagram of the linear range;

[0033] Figure 6 This is a schematic diagram showing the test results for different types of HCV.

[0034] Figure 7 This is a schematic diagram of the sample test results. Detailed Implementation

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0040] Example 1: Design and Screening of Target Primers and Probes

[0041] A comparative analysis of the HCV whole genome sequences reported in the National Center for Biotechnology Information (NCBI) was performed. Three sets of specific primers and probes were designed based on conserved regions, and the designed primer and probe sequences were artificially synthesized, as detailed in Table 1. The amplification effects of the target primer and probe sets were compared using three HCV-positive samples (Table 2). The results showed that primer sets F1, R1, and P1 had the best detection sensitivity and were selected as the primer and probe sets ultimately used in this invention.

[0042] Table 1 Target primer and probe sequences

[0043]

[0044] Table 2 Comparison of target primer-probe amplification effects

[0045]

[0046] Example 2: Design and screening of internal standard sequences and probes

[0047] The internal standard sequence includes sequences identical to those of the HCV-specific primers at both ends, and a complementary sequence identical or opposite to that of the internal standard-specific probe sequence in the middle.

[0048] Internal standard IC1 sequence (SEQ ID NO.10): 5'-agagccatagtggtctgcggaaccggtgagtacaccggaattaccggaaagactgggtcctttcttggataaacccactctatgtccggtcatttgggcgtgcccccgcaagactgctagccgagtagcgtTCGGT GTGGCCCTCGCAGAGGCCAGGTCGACAAATGTCGCTGGTCATCCATGGACgaggtctcgtagaccgtgcatcatgagcacaaatcctaaacctcaaagaaaaaccaaaagaaacacaaaccgccgcccacaggacgttaagtt-3';

[0049] Internal standard IC2 sequence (SEQ ID NO.11): 5'-agagccatagtggtctgcggaaccggtgagtacaccggaattaccggaaagactgggtcctttcttggataaacccactctatgtccggtcatttgggcgtgcccccgcaagactgctagccgagtagcgtAAGGCG TACACTGCCGCTCGTCGCGGCAATTGGAGGTACCGTACCAGGACTCCGGgaggtctcgtagaccgtgcatcatgagcacaaatcctaaacctcaaagaaaaaccaaaagaaacacaaaccgccgcccacaggacgttaagttc-3';

[0050] Internal control probes were designed at different positions in the IC1 and IC2 sequences, with no cross-reactivity between the target probe and the internal control probe. Probes with the same amplification efficiency as the target were selected as the probes used in this embodiment: IC-P1 (SEQ ID NO.12): ROX-tcggtgtggccctcgcagaggccaggtcg-BHQ2 and IC-P2 (SEQ ID NO.13): CY5-aaggcgtacactgccgctcgtcgcggcaat-BHQ2. Amplification curves and amplification efficiency graphs for the target, internal control IC1, and internal control IC2 are shown in [reference needed]. Figures 1-3 .

[0051] Example 3: A single-tube real-time fluorescence quantitative PCR kit for quantitative detection of HCV viral load

[0052] The real-time quantitative PCR kit includes the following components:

[0053] RT-qPCR reaction solution, enzyme mixture, negative control, positive control, weak positive control, and two internal standards;

[0054] The components are detailed below:

[0055] The RT-qPCR reaction solution includes: RT-qPCR Buffer, primer pair F1 / R1 and probe P1 for detecting the target gene, and probes IC-P1 and IC-P2 for detecting the internal standard;

[0056] The RT-qPCR Buffer contains 200 μM dATP, 200 μM dCTP, 240 μM dGTP, 240 μM dUTP, 5.5 mM MgCl2, 80 mM KCl and 30 mM Tris-HCl (pH 8.0);

[0057] The enzyme mixture includes 3 U / reaction of hot-start Taq enzyme, 0.2 U / reaction of uracil glycosylation enzyme, and 100 U / reaction of reverse transcriptase;

[0058] Two internal standards (IC1 and IC2) were artificially synthesized armor RNAs (Armor RNA IC1 and Armor RNA IC2), prepared by General Biotech Inc. according to the nucleotide sequences shown in SEQ ID NO.10 and SEQ ID NO.11. The prepared armor RNAs were diluted to specific concentrations using phosphate buffer at pH 8.0, and the diluted solutions were used as internal standards in the kit.

[0059] The negative control is human negative serum;

[0060] The positive control was armored RNA containing the target HCV fragment, at a concentration of 6.0 × 10⁻⁶. 5IU / mL, its sequence information is as follows: 5'-cgacactcatactaacgccatgggggcgacactccgccatgaatcactcccctgtgaggaactactgtcttcacgcagaaagcgtctagccat ggcgttagtatgagtgtcgtacagcctccaggcccccccctcccgggagagccatagtggtctgcggaaccggtgagtacaccggaattaccggaaagactgggtccttt cttggataaacccactctatgtccggtcatttgggcgtgcccccgcaagactgctagccgagtagcgttgggttgcgaaaggccttgtggtactgcctgatagggtgctt gcgagtgccccgggaggtctcgtagaccgtgcatcatgagcacaaatcctaaacctcaaagaaaaaccaaaagaaacacaaaccgccgcccacaggacgttaagttc-3' (SEQ ID NO.14);

[0061] The preparation method of the positive control is as follows: Armored RNA was prepared by General Biotechnology Co., Ltd. according to the nucleotide sequence shown in SEQ ID NO.14. The prepared armored RNA was diluted to serial concentrations using phosphate buffer with a pH of 8.0. The concentration of armored RNA was determined using the National Reference Standard for Hepatitis C Virus Nucleic Acid from the China National Institutes for Food and Drug Control, and diluted to 6.0 × 10⁻⁶. 5 IU / mL, the diluted liquid is used as the positive control in the kit.

[0062] The weak positive control was armored RNA containing the target HCV fragment, at a concentration of 6.0 × 10⁻⁶. 3 The sequence of the weakly positive control sample (IU / mL) is shown in SEQ ID NO.14. The preparation method of this weakly positive control is as follows: Armored RNA was prepared by General Biotechnology Co., Ltd. according to the nucleotide sequence shown in SEQ ID NO.14. The prepared armored RNA was diluted to serial concentrations using phosphate buffer (pH 8.0). The concentration of armored RNA was determined using the National Reference Standard for Hepatitis C Virus Nucleic Acid from the China National Institutes for Food and Drug Control, and diluted to 6.0 × 10⁻⁶. 3 IU / mL, the diluted liquid was used as a weak positive control in the kit.

[0063] The method for single-tube quantitative detection of HCV viral load using the above kit is as follows:

[0064] Nucleic acid was extracted using nucleic acid extraction reagents to obtain RNA from the sample to be tested. Then, PCR amplification was performed according to the following reaction system and amplification procedure:

[0065] Reaction system: Through repeated experiments, the optimal reaction system was determined to be 28 μL of RT-qPCR reaction solution added to each reaction tube. Each reaction solution contained 200 μM dATP, 200 μM dCTP, 240 μM dGTP, 240 μM dUTP, 5.5 mM MgCl2, 80 mM KCl, and 30 mM Tris-HCl (pH 8.0), all at a concentration of 0.32 μM for target primers, 0.12 μM for target probes, and 0.06 μM for internal control probes IC-P1 and IC-P2. Before detection, 2 μL of enzyme mixture and 20 μL of template were added.

[0066] Amplification program: PCR amplification was performed on the Yarui MA-6000 real-time fluorescence PCR instrument. The preferred implementation scheme was as follows: 50℃, 30 min, 1 cycle; 95℃, 3 min, 1 cycle; 95℃, 15 s followed by 60℃, 45 s, 45 cycles, during which FAM, ROX, and CY5 fluorescence signals were collected.

[0067] Quantitative result calculation:

[0068]

[0069] Where * represents a multiplication sign, and FAM_Ct is the target Ct value. CY5_Ct is the Ct value of internal index 1, and CY5_Ct is the Ct value of internal index 2.

[0070] Example 4: Validation of the lowest detection limit

[0071] The sensitivity reference sample was obtained from the National Reference Standard for Hepatitis C Virus Nucleic Acid of the China National Institutes for Food and Drug Control, with an HCV RNA content of 8.0 × 10⁻⁶. 6 IU / vial. Human negative serum was diluted to 7.5 IU / mL, 10 IU / mL, and 20 IU / mL as sensitivity references. Twenty PCR tests were performed on each concentration of the sensitivity reference. The detection rate of samples at each concentration was calculated to determine the limit of detection (LOD) (according to the definition of LOD, the lowest concentration with a detection rate ≥95% was defined as the LOD).

[0072] Experimental results (Table 3 and Figure 4The results show that the kit provided in Example 3 of this invention has a positive detection rate of 100% for 20 IU / mL samples, a positive detection rate of 95% for 10 IU / mL samples, and a positive detection rate of 85% for 7.5 IU / mL samples. Therefore, the limit of detection of the kit of this invention is 10 IU / mL.

[0073] Table 3. Results of Sensitivity Detection Experiment

[0074]

[0075] Note: " / " in the table indicates no Ct value.

[0076] Example 5: Limit of Quantitation Validation

[0077] The national reference standard for hepatitis C virus nucleic acid was diluted with human negative serum to 40 IU / mL, 20 IU / mL, and 10 IU / mL. Using the kit described in Example 3, 10 replicate PCR tests were performed on each concentration of the sensitivity reference standard. All samples requiring the limit of quantitation (LOQ) concentration must be detected. The LQ can be set when the difference Δlg between the measured logarithm of the concentration (lg IU / mL) and the theoretical logarithm of the concentration (lg IU / mL) is within ±0.5, and the CV value of the measured logarithm of the concentration (lg IU / mL) is ≤10%.

[0078] The experimental results are shown in Table 4. When the sample concentration was 40, 20, and 10 IU / mL, the detection rate was 100%, and the difference Δlg between the measured logarithm of the concentration (lg IU / mL) and the theoretical logarithm of the concentration (lg IU / mL) was within ±0.5. At sample concentrations of 40 and 20 IU / mL, the CV value of the measured logarithm of the concentration (lg IU / mL) was <10%, meeting the requirements. At a sample concentration of 10 IU / mL, the CV value of the measured logarithm of the concentration (lg IU / mL) was >10%. Therefore, the limit of quantitation for this kit is 20 IU / mL.

[0079] Table 4 Results of Limit of Quantitation Detection Experiment

[0080]

[0081] Example 6: Linear Range Detection

[0082] HCV armor RNA, whose concentration was calibrated using the national reference standard for hepatitis C virus nucleic acid from the China National Institutes for Food and Drug Control, was diluted with human negative serum to obtain a concentration of 1.0 × 10⁻⁶. 8 IU / mL, 1.0×10 7 IU / mL, 1.0×10 6 IU / mL, 1.0×105 IU / mL, 1.0×10 4 IU / mL, 1.0×10 3 IU / mL, 1.0×10 2 Samples were prepared at concentrations of 1 U / mL, 40 IU / mL, and 20 IU / mL. Amplification and detection were performed on samples of each concentration, with three replicates per concentration. Linear fitting was performed using the logarithm of the measured concentration as X and the Ct value as Y. The linear correlation coefficient R was calculated. If |R| ≥ 0.980, the concentration series was considered to be within the linear range of this kit.

[0083] 20 IU / mL ~ 1.0 × 10 8 The data for each IU / mL concentration were fitted, and the results are as follows: Figure 5 And as shown in Table 5. Linear curve R 2 =0.9968, R=0.9984>0. Therefore, the linear range of this kit is 20 IU / mL to 1.0×10⁻⁶. 8 IU / mL.

[0084] Table 5. Experimental Results of Linear Range Detection

[0085]

[0086] Example 7 Precision Test

[0087] Precision test: The national reference standard for hepatitis C virus nucleic acid was diluted to three levels (1.0 × 10⁻⁶) using human negative serum. 5 IU / mL, 1.0×10 4 IU / mL, 1.0×10 3 Ten samples at each level (IU / mL) were used as precision references. Thirty samples were tested and analyzed using the kit of this invention. The CV value of the logarithmic value (lg IU / mL) of the measured concentration of each sample should be ≤5.0%.

[0088] The test results are shown in Table 6. The CV values ​​of the measured concentration logarithmic values ​​of the three different concentrations of precision reference materials are all <5%, indicating that the precision of the kit of this invention meets the requirements.

[0089] Table 6 Precision Test Results

[0090]

[0091] Example 8 Evaluation of detection capabilities for different types

[0092] The kit described in Example 3 was used to detect hepatitis C virus genotypes 1a, 1b, 2i, 3a, 4r, 5a, and 6l in the WHO Non-WHO Reference Material 4th HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques (NIBSC code: 14 / 290), evaluating the kit's ability to detect different genotypes. The results showed that the kit effectively detected all of the above genotypes. Figure 6 ).

[0093] Example 9 Sample Detection

[0094] Three HCV-positive samples with known results validated by high-throughput sequencing and one known-negative sample were used as test samples to verify the detection performance of the kit prepared in this invention. The amplification results are shown in Table 7 and... Figure 7 As shown in the figure. The results show that the kit of the present invention can accurately detect HCV positive samples, while negative samples were not detected.

[0095] Table 7 Sample Detection Results

[0096]

[0097] Note: " / " in the table indicates no Ct value and no quantitative results.

[0098] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer and probe combination for real-time quantitative PCR of HCV viral load in a single tube based on a competitive dual internal standard method, characterized in that, This includes primer pairs and probes for detecting target genes, as well as probes IC-P1 and IC-P2 for detecting internal standards; The primer pair for detecting the target gene includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2; The nucleotide sequence of the probe for detecting the target gene is shown in SEQ ID NO.3; The nucleotide sequence of the probe IC-P1 for detecting the internal standard is shown in SEQ ID NO.12; The nucleotide sequence of the probe IC-P2 for detecting the internal standard is shown in SEQ ID NO.

13.

2. The primer and probe combination according to claim 1, characterized in that, The probe for detecting the target gene is labeled with the FAM group at the 5' end and the BHQ1 group at the 3' end; The probe IC-P1 for detecting the internal standard is labeled with the ROX group at its 5' end and the BHQ2 group at its 3' end. The probe IC-P2, used to detect the internal standard, is labeled with a CY5 group at its 5' end and a BHQ2 group at its 3' end.

3. The use of the primer and probe combination according to any one of claims 1-2 in the preparation of a single-tube quantitative real-time fluorescence PCR kit for detecting HCV viral load based on a competitive dual internal standard method.

4. A single-tube real-time fluorescence quantitative PCR kit for quantitative detection of HCV viral load based on a competitive dual internal standard method, characterized in that, The kit includes the primer and probe combination as described in any one of claims 1-2.

5. The single-tube quantitative real-time fluorescence quantitative PCR kit for detecting HCV viral load according to claim 4, characterized in that, The single-tube quantitative HCV viral load real-time fluorescence quantitative PCR kit also includes RT-qPCR buffer, enzyme mixture, negative control, positive control, weak positive control and internal standard.

6. The single-tube quantitative real-time fluorescence quantitative PCR kit for detecting HCV viral load according to claim 5, characterized in that, The RT-qPCR Buffer comprises 200 μM dATP, 200 μM dCTP, 240 μM dGTP, 240 μM dUTP, 5.5 mM MgCl2, 80 mM KCl, and 30 mM Tris-HCl.

7. The single-tube quantitative real-time fluorescence quantitative PCR kit for detecting HCV viral load according to claim 5, characterized in that, The enzyme mixture comprises 3 U / reaction of hot-start Taq enzyme, 0.2 U / reaction of uracil glycosylation enzyme, and 100 U / reaction of reverse transcriptase.

8. The single-tube quantitative real-time fluorescence quantitative PCR kit for detecting HCV viral load according to claim 5, characterized in that, The internal standards include armor RNA IC1 and armor RNA IC2; the nucleotide sequence of armor RNA IC1 is shown in SEQ ID NO. 10; and the nucleotide sequence of armor RNA IC2 is shown in SEQ ID NO.

11.

9. The single-tube quantitative real-time fluorescence quantitative PCR kit for detecting HCV viral load according to claim 5, characterized in that, The positive control and the weak positive control are armored RNA containing the HCV target fragment at different concentrations, and their nucleotide sequences are shown in SEQ ID NO.14.

Citation Information

Patent Citations

  • High-precision nucleic acid quantitative detection kit for hepatitis C virus (HCV)

    CN103642942A

  • Kit stored at 2 to 8 DEG C and used for rapidly detecting hepatis c virus nucleic acid

    CN108977580A

  • Method for Detection of HCV at the Real Time PCR with Intercalating Dye

    US20100173284A1