Use of pig gbp1 gene and overexpression cell line, medicine of pig delta coronavirus, proliferative cell line

Abstract

The application belongs to the technical field of biotechnology, and discloses use and expression promotion method of pig Gbp1 gene, medicine of pig delta coronavirus, and proliferated cell line. It is found that when the pig Gbp1 gene is overexpressed, the replication of the pig delta coronavirus can be inhibited, and when the pig Gbp1 gene is knocked out, the replication speed of the pig delta coronavirus is accelerated. The interaction mechanism between the pig Gbp1 gene expressed pig guanosine binding protein 1 and the pig delta coronavirus is verified through experiments.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to the use of the porcine Gbp1 gene and overexpression cell lines, drugs for porcine deltacoronavirus, and proliferating cell lines. Background Technology

[0002] Porcine deltacoronavirus (PDCoV) is an enterovirus that can cause acute diarrhea, vomiting, dehydration, and even death in newborn piglets and sows. However, research on PDCoV is currently limited, and its pathogenic mechanism and interaction with the host remain unclear. Furthermore, there are currently no effective drugs available on the market. For pathogens like PDCoV that pose a public health risk, identifying their antiviral genes, elucidating their pathogenic mechanisms, and developing effective antiviral drugs are of great significance.

[0003] In the antiviral innate immune response, interferon (IFN) family cytokines can induce hundreds of downstream interferon-stimulated genes (ISGs), which exert inhibitory effects on different stages of viral replication. The guanosine triphosphatase protein family (GBPs) are ISG molecules with hydrolytic enzyme activity that can hydrolyze GTP into GDP and GMP. Studies have found that guanosine-binding protein 1 (GBP1) resists infection by dengue virus, influenza virus, pharyngeal stomatitis virus, and hepatitis E virus through different mechanisms, but its role in porcine deltacoronavirus infection has not been reported.

[0004] However, guanylate-binding protein 7 (GBP7), which also belongs to the GBPs family, explains its promoting effect on influenza virus replication in the study of Feng Mingkai, Inducible Guanylate-Binding Protein 7 Inhibits Innate Immunity and Promotes Influenza Virus Replication [D]. Southern Medical University, 2020. DOI:10.27003 / d.cnki.gojyu.2020.000874. Additionally, Wang Fei's study, "The Interaction Between Hepatitis B Virus HBx Protein and Guanylate-Binding Protein GBP2 Regulates HBV Replication and the Development of Hepatocellular Carcinoma," further illustrates this effect. The study on the molecular mechanism [D]. Jilin University, 2024. DOI:10.27162 / d.cnki.gjlin.2024.006170. revealed that the expression of guanylate-binding protein 2 (GBP2) is increased in hepatitis B patients, and its expression is further increased after interferon treatment. GBP2 can stabilize HBx virus protein, promote HBV replication, and inhibit the antiviral function of interferon. It can be seen that even though they are all GBPs family proteins, each protein may have an inhibitory or promoting effect on viral replication.

[0005] The technical problem of this solution is: how to provide a gene encoding a protein that can inhibit the replication of porcine deltavirus. Summary of the Invention

[0006] The purpose of this application is to provide a gene encoding a protein that can inhibit the replication of porcine deltacoronavirus. This application has discovered a gene encoding GBP1 protein, which belongs to the GBPs protein family that can inhibit the replication of porcine deltacoronavirus. The GBP1 protein expressed by the porcine Gbp1 protein can inhibit the replication of porcine deltacoronavirus.

[0007] To achieve the above objectives, this application discloses the use of the porcine Gbp1 gene in the preparation of drugs against porcine deltacoronavirus.

[0008] Preferably, the porcine Gbp1 gene is used as the encoding gene for expressing porcine guanosine-binding protein 1.

[0009] Preferably, the porcine Gbp1 gene, as the encoding gene, expresses porcine guanosine-binding protein 1, which inhibits the replication of porcine deltacoronavirus by binding to the non-structural protein NSP8 and disrupting the binding between NSP8 and NSP12.

[0010] In addition, this application also discloses a proliferating cell line of porcine deltacoronavirus, wherein the proliferating cell line is a cell line in which the porcine Gbp1 gene is knocked out.

[0011] Preferably, the proliferating cell line is an ST cell line with bases 155-156 knocked out in exon 2 of the porcine Gbp1 gene.

[0012] In addition, this application also discloses a drug against porcine deltacoronavirus, which contains porcine guanosine-binding protein 1 expressed by the porcine Gbp1 gene as the encoding gene.

[0013] In addition, this application also discloses a porcine Gbp1 gene overexpression cell line, which is obtained by infecting ST cells with porcine Gbp1 overexpression lentivirus.

[0014] Preferably, the method for preparing the porcine Gbp1 overexpressing lentivirus is as follows: first, the porcine Gbp1 gene is cloned into the pLVX-ISRE-Puro vector, and the pLVX-ISRE-puro-sGBP1 plasmid and pspax2, pMD2G plasmids are co-transfected into HEK293T cells. Then, the supernatant is collected and resuspended to obtain the porcine Gbp1 overexpressing lentivirus.

[0015] The beneficial effects of this application are: this application discovered that when the porcine Gbp1 gene is overexpressed, the replication of porcine deltacoronavirus can be inhibited, and when the porcine Gbp1 gene is knocked out, the replication rate of porcine deltacoronavirus is accelerated. Furthermore, the interaction mechanism between porcine guanosine-binding protein 1 expressed by the porcine Gbp1 gene and porcine deltacoronavirus was verified through experiments. Attached Figure Description

[0016] Figure 1 A schematic diagram illustrating PDCoV infection-induced sGBP1 expression;

[0017] Figure 2 A schematic diagram illustrating how stable overexpression of sGBP1 inhibits PDCoV expression. Figure 2 In this figure, A represents the result of immunofluorescence detection of PDCoV replication levels in wild-type cells and sGBP1 stably overexpressing cells. Figure 2 In this context, B represents the viral titer of PDCoV proliferation in wild-type ST cells and sGBP1 stably overexpressing cell lines;

[0018] Figure 3 A schematic diagram illustrating how knocking out sGBP1 promotes PDCoV replication; Figure 3 In the diagram, A represents the sGBP1 gene knockout. Figure 3 B in the figure represents the expression of sGBP1 in sGBP1 knockout cells as verified by Western blotting. Figure 3 In the figure, C represents the result of immunofluorescence detection of PDCoV replication levels in wild-type cells and sGBP1 knockout cells. Figure 3 In this context, D represents the viral titer of PDCoV proliferation in wild-type ST cells and sGBP1 knockout cell lines.

[0019] Figure 4 A schematic diagram of protein immunoprecipitation for the identification of the interaction between sGBP1 and NSP8;

[0020] Figure 5 This is a schematic diagram of protein immunoprecipitation in which sGBP1 and NSP12 competitively bind to NSP8. Detailed Implementation

[0021] The present invention will now be clearly and completely described in conjunction with embodiments thereof. It should be noted that, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0022] Before demonstrating the embodiments, the source information of the raw materials used in the experiment will be explained as follows:

[0023] ST cells, HEK-293T (human embryonic kidney, 293T) cells, pLVX-ISRE-Puro, pspax2, pMD2G, pSpCas9(BB)-2A-Puro plasmids and PDCoV HeN17 strain were all derived from the Institute of Animal Health, Guangdong Academy of Agricultural Sciences.

[0024] FLAG-tagged, HA-tagged, and Myc-tagged monoclonal antibodies were purchased from CellSignaling Technology (CST) in Massachusetts, USA.

[0025] The polyclonal antibodies against GBP1 and ACTIN were purchased from Proteintech.

[0026] Horseradish peroxidase (HRP)-labeled anti-mouse antibody, horseradish peroxidase (HRP)-labeled anti-rabbit antibody, and Alexa Fluor 488-labeled goat anti-rabbit IgG were all purchased from Thermo Fisher Scientific (Massachusetts, USA).

[0027] A polyclonal antibody against the N protein of porcine deltacoronavirus (PDCoV) (patent application number: 202410515685.7, invention title: a polyclonal antibody based on the N protein of porcine deltacoronavirus) was prepared and preserved by the Institute of Animal Health, Guangdong Academy of Agricultural Sciences.

[0028] The GenBank accession number for PDCoV HeN17 strain is OR230676.1, which is the strain referred to as "PDCoV" in this article.

[0029] The sGBP1 gene has a GenBank accession number of 100151938;

[0030] Furthermore, it should be noted that the specification of this application is attached with Figure 1-3 middle The representatives show significant differences. The more numbers there are, the more significant the difference will be.

[0031] Example 1: PDCoV promotes GBP1 overexpression

[0032] ST cells were infected with PDCoV at different MOIs (0.01, 0.1, and 1 MOI) for 12 hours, and the mRNA expression level of GBP1 was detected by real-time quantitative PCR (qPCR). It should be noted that all experiments used in this study employed the PDCoV HeN17 strain (GenBank accession number: OR230676.1), which is the strain referred to as "PDCoV" in this study.

[0033] Results analysis: such as Figure 1 As shown, sGBP1 mRNA expression increased in a dose-dependent manner 12 h after PDCoV infection, indicating that PDCoV can induce GBP1 expression.

[0034] Example 2: sGBP1 inhibits PDCoV replication

[0035] To investigate the function of sGBP1 in PDCoV infection, a stable ST cell line overexpressing sGBP1 protein (ST-sGBP1) was established using lentivirus. The specific preparation method was as follows: the porcine Gbp1 (sGbp1) gene was cloned into the pLVX-ISRE-Puro vector. HEK293T cells were transfected with pLVX-ISRE-puro-sGBP1 plasmid and pspax2, pMD2G plasmids at a ratio of 4:3:1. The culture medium was changed after 6 h, and cell supernatants were collected at 24 h and 48 h. Cell debris was removed by centrifugation at 3000 rpm for 10 min, and the cells were centrifuged at 30000 rpm at 4℃ for 2 h in a 70 mL ultrafiltration tube. The virus was resuspended in 3 mL PBS, aliquoted, and stored at -80℃ to obtain Lenti-sGBP1 overexpressing lentivirus. ST cells were then infected with Lenti-sGBP1 lentivirus particles in the presence of 8 mg / ml polybrene. Three days after infection, cells were treated with 1.5 mg / mL puromycin for two weeks. The overexpression efficiency of sGBP1 was assessed by Western blotting, and the cell line was named ST-sGBP1.

[0036] ST wild-type cells and ST-sGbp1 stably overexpressing cells were infected with PDCoV at 0.01 MOI for 12 h. Cell counts were determined by immunofluorescence (IFA) and TCID50 staining. 50 The experiment analyzed the replication of PDCoV in ST wild-type cells and ST-sGbp1 cells.

[0037] Immunofluorescence (IFA): Cells were fixed, permeabilized, blocked, stained with primary and secondary antibodies, and then photographed using a fluorescence microscope. The primary antibody was a rabbit polyclonal antibody against the N protein of PDCoV (patent number: ZL 2024 1 0515685.7), and the secondary antibody was Alexa Fluor 488-labeled goat anti-rabbit IgG. After sample processing, images were taken and observed using a fluorescence microscope.

[0038] Half-maximal concentration (TCID) of cells 50 Experiment: ST cells were seeded into 96-well plates, and after growing into a confluent monolayer the next day, TCID was performed. 50 The PDCoV virus was serially diluted 10-fold, with a dilution gradient of 10. -1 ~10 -8Add 0.1 mL of diluted virus to each well, repeating each dilution gradient in 12 wells. Incubate at room temperature for 60 min, then aspirate any unadsorbed virus, wash once with PBS, add 0.1 mL of DMEM containing 10 μg / mL trypsin to each well, and incubate at 37°C. Observe continuously for seven days, count the number of diseased wells, and calculate the viral TCID using the Reed-Münch method. 50 .

[0039] Results analysis: such as Figure 2 As shown in Figure A, the green fluorescence intensity of PDCoV N protein in ST-sGbp1 cells was significantly lower than that in ST wild-type cells. Consistent with the immunofluorescence results, stable overexpression of sGBP1 significantly reduced the viral titer of PDCoV in cells. Figure 2 (B in the text). The above results indicate that overexpression of sGBP1 can inhibit the replication of PDCoV.

[0040] Example 3: Knockout of sGBP1 promotes PDCoV replication

[0041] ST-sGbp1 - / - Cell preparation: sGBP1 knockout ST cell lines were prepared using CRISPR / Cas9 technology. Based on the sGbp1 gene sequence, a specific sgRNA (sGBP1-sgRNA1, forward, ATGTGGGCCTGTACCGCACAGG, reverse, CCTGTGCGGTACAGGCCCACGAT) was designed and synthesized on the second exon of the gene. The sgRNA was then constructed into the pSpCas9(BB)-2A-Puro vector. This plasmid was transfected into ST cells using lip3000. After 48 h, the cells were passaged, and sGBP1 knockout monoclonal cell lines were obtained through serial dilution. Finally, sequencing and Western blotting (WB) were used to detect the absence of sGBP1 in the monoclonal cell lines. The resulting sGBP1-deficient cell line was named ST-sGbp1. - / - .

[0042] Western blot of proteins: Collection of wild-type and correctly sequenced ST-sGbp1 - / -Cells were collected by first discarding the cell supernatant, washing twice with PBS, centrifuging to collect cells, resuspending in 100 µL of cell lysis buffer, lysing on ice for 30 min, centrifuging at 12000 rpm at 4 °C for 20 min, collecting the supernatant, adding protein sample loading buffer, denaturing at 100 °C, and then performing SDS-PAGE electrophoresis. Electrophoresis conditions: 80 V for 30 min, 120 V for 90 min. After bromophenol blue migrated to the bottom of the gel, the protein sample on the gel was transferred to a PVDF membrane via a constant current of 230 mA for 90 min. The membrane was blocked with TBST containing 5% skim milk at room temperature for 2 h, and the corresponding primary antibody was added according to the target protein and incubated overnight at 4 °C. The next day, the primary antibody was collected, and the membrane was washed with TBST 3 × 10 min / time. A secondary antibody homologous to the primary antibody was added, and the membrane was incubated at room temperature for 1 h, washed with TBST 3 times for 10 min each time. After incubation with HRP-labeled secondary antibody, the membrane was developed using the ECL method.

[0043] ST wild-type cells and ST-ST-sGbp1 cells were infected with PDCoV at 0.01 MOI, respectively. - / - Cells were knocked out 12 h later. Immunofluorescence (IFA) and total cellularity index (TCID) were used to determine the cell composition. 50 Experimental analysis of PDCoV in ST wild-type cells and ST-ST-sGbp1 - / - Replication status in knockout cells. IFA and TCID 50 The experimental method is the same as in Example 2.

[0044] Results: Sequencing results showed that deletion of two bases at positions 155 and 156 of the second exon of the sGbp1 gene in ST cells via CRISPR / Cas9 technology resulted in a frameshift mutation in the sGbp1 gene, successfully deleting the sGBP1 protein in ST cells. Figure 3 (A in 3 and B in 3). Immunofluorescence (IFA) results showed that 12 h after PDCoV (0.01 MOI) infection, ST-sGbp... - / - The green fluorescence intensity of N protein in cells increased significantly ( Figure 3 (C in TCID) 50 The results showed that, compared with ST wild-type cells, ST-sGbp - / - The PDCoV viral titer in cells was significantly increased ( Figure 3 (D in the above results). Based on the above results, it is proven that sGBP1 is a key host gene for inhibiting PDCoV replication.

[0045] Example 4: Mechanism verification of the interaction between sGBP1 and PDCoV

[0046] 4.1 sGBP1 binds to the non-structural protein NSP8

[0047] FLAG-NSP8 and HA-sGBP1 plasmids, 2 μg each, were transfected into HEK293T cells, either separately or co-transfected. After 36 h, the cells were collected using the same method as in Example 3. The collected cell lysate was divided into two portions at a ratio of 3:7. 30 µL of the cell lysate was used as the input sample, and protein sample loading buffer was added. The sample was incubated in a 100 °C metal bath for 10 min and then stored at 4 °C for Western blotting. 70 µL of cell lysis buffer was used as the IP sample, and the volume was brought up to 400 µL with cell lysis buffer. 30 µL of Flag-beads were added, and the IP sample was placed on a 4°C rotary mixer and incubated overnight. PBS was diluted 1:1 with the cell lysis buffer to serve as the IP elution buffer. The beads bound to the cell lysis buffer were washed five times with this elution buffer (4°C, 5000 rpm, 2 min). After the fifth wash, the elution buffer was completely discarded, leaving only the beads. One volume of protein sample loading buffer was added, and the sample was incubated in a 100°C metal bath for 10 min. The sample was then stored at 4°C for later use. The processed input and IP samples were analyzed for the interaction between NSP8 and sGBP1 using Western blotting. The Western blotting method was the same as in Example 3.

[0048] See results Figure 4 As shown, the immunoprecipitation experiment demonstrated that in ST cells infected with porcine deltacoronavirus, the non-structural protein NSP8 and sGBP1 formed a complex, further proving that the two proteins bind to each other.

[0049] 4.2 SGBP1 inhibits PDCOV replication by disrupting the interaction between NSP8 and NSP12.

[0050] NSP8 and NSP12 are key components of the coronavirus replication-transcriptional complex (RTC). We hypothesized that the interaction between GBP1 and NSP8 might disrupt the formation of the PDCoV retroviral complex (RTC), thereby inhibiting viral infection. To verify this hypothesis, FLAG-NSP12, Myc-NSP8, and HA-sGBP1 plasmids were transfected into HEK293T cells, individually or in combination, for 36 h. Samples were then collected for IP experiments and Western blot analysis. Sample collection, processing, and analysis methods were the same as in Example 4.1.

[0051] Competitive co-immunoprecipitation results showed no interaction between sGBP1 and NSP12; however, the interaction between NSP12 and NSP8 was weakened upon the addition of sGBP1. Figure 5 This indicates that the antiviral effect of sGBP1 against porcine deltavirus is achieved through its interaction with NSP8, which disrupts the binding between NSP8 and NSP12, thereby inhibiting viral transcription and replication.

Claims

1. Use of the porcine Gbp1 gene in the preparation of a drug against porcine deltacoronavirus, wherein the porcine Gbp1 gene, as the encoding gene, expresses porcine guanosine-binding protein 1, which inhibits the replication of porcine deltacoronavirus by binding to the non-structural protein NSP8 of porcine deltacoronavirus and disrupting the binding between NSP8 and NSP12. The porcine Gbp1 gene has a GenBank accession number of 100151938 and was last updated on September 5, 2025.

2. A cell line for the proliferation of porcine deltacoronavirus, characterized in that, The proliferating cell line is the ST cell line with the porcine Gbp1 gene knocked out; The porcine Gbp1 gene has a GenBank accession number of 100151938 and was last updated on September 5, 2025.

3. The porcine deltacoronavirus proliferating cell line according to claim 2, characterized in that, The proliferating cell line is the ST cell line with bases 155-156 knocked out in exon 2 of the porcine Gbp1 gene.

Images