Nucleotide sequence of larch endogenous strong promoter Pro-LarGRP1A and application
By constructing an expression vector using the endogenous strong promoter Pro-LarGRP1A nucleotide sequence in larch, the problem of low expression efficiency of target genes in woody gymnosperms was solved, achieving efficient breeding and cultivating excellent new larch varieties.
Patent Information
- Application Number
- CN202511500863.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-21
- Publication Date
- 2026-01-09
AI Technical Summary
Existing technologies are insufficient to efficiently initiate the expression of target genes in woody gymnosperms such as larch, resulting in low efficiency in biological breeding and an inability to quickly cultivate superior varieties.
Using the nucleotide sequence of the endogenous strong promoter Pro-LarGRP1A from larch, a plant expression vector was constructed through enzyme digestion and ligation. The target gene was inserted for genetic transformation, and Agrobacterium infection was used to achieve efficient expression of the target gene in larch.
The expression level of the target gene in transgenic larch was significantly improved, the breeding cycle was shortened, the breeding efficiency was improved, and new germplasm and new varieties with excellent performance in terms of biomass, volume and resistance were obtained.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to an endogenous strong promoter nucleotide sequence that can be efficiently expressed in larch in the field of biological breeding, and its application in the cultivation of transgenic larch and other woody gymnosperms using genetic engineering methods. Background Technology
[0002] Larch, belonging to the genus *Larix* of the family Pinaceae, is a typical coniferous tree species found in cold-temperate and temperate mountainous regions. It possesses excellent environmental adaptability, capable of growing in low-temperature and infertile mountainous areas, making it an important afforestation species. Furthermore, larch wood boasts superior properties: heavy, hard, with long fibers, a fine texture, high compressive and bending strength, good toughness, and resistance to decay. Therefore, larch is also an important timber species for construction and pulp production. Moreover, larch needles and bark contain high-value natural active ingredients such as arabinogalactan and dihydroquercetin, which exhibit significant effects in enhancing immunity, anti-inflammation, antibacterial properties, and antioxidant activity. Therefore, larch also has broad application prospects in the development of health and wellness products and pharmaceuticals. However, compared to angiosperms such as poplar and eucalyptus, larch grows slowly and has a long growth cycle; most conventional larch species typically take at least ten years from planting to maturity. The scarcity of fast-growing, high-volume, high-quality, and resilient larch varieties has become a key bottleneck restricting the widespread planting of larch and the realization of its ecological, timber, and medicinal values. Therefore, employing modern biological breeding strategies such as transgenics, gene editing, and gene aggregation is crucial for overcoming the challenges of larch breeding—specifically, the long growth cycle and complex genetic background of larch, which makes it difficult to cultivate superior varieties within a short period (3-5 years) using conventional hybridization methods. This is of great significance for fully realizing the ecological, timber, and medicinal value of larch.
[0003] Compared to traditional hybridization breeding methods, modern bio-breeding methods such as transgenics, gene editing, and gene polymerization are highly efficient and targeted, enabling the rapid and effective creation of new germplasm with directed improvements in target traits, significantly shortening the breeding cycle. Especially for woody gymnosperms with long growth cycles, such as larch, bio-breeding is one of the most effective measures for creating superior germplasm and cultivating new varieties. It can achieve the development of new varieties with superior performance in biomass, volume, and resistance in a shorter time than traditional breeding methods, and promote the iterative upgrading of varieties.
[0004] Plant expression vectors are core tools for transgenic, gene editing, and multi-gene aggregation breeding. The efficiency of promoter elements on these vectors in initiating target gene expression is crucial for effectively improving traits. The CaMV35S promoter from cauliflower mosaic virus and the Act and Ubi promoters from rice and maize have been widely used in the construction of plant expression vectors. Plant expression vectors containing these promoters have been proven to efficiently express target genes in herbaceous angiosperms such as rice, maize, cabbage, and broccoli. However, research has found that, unlike herbaceous angiosperms, woody gymnosperms such as larch, due to their large and complex genomes, exhibit low or even non-functional promoter activity for some promoters that are highly effective in initiating target gene expression in herbaceous angiosperms. Therefore, obtaining promoter sequences that can efficiently initiate the expression of target genes in gymnosperms such as larch and using them for the construction of expression vectors for larch transgenic, gene editing and multi-gene aggregation biobreeding is of great significance for improving the efficiency of larch biobreeding and solving the technical problems of larch and other woody gymnosperm biobreeding. Summary of the Invention
[0005] The purpose of this invention is to provide a nucleotide sequence of the endogenous strong promoter Pro-LarGRP1A from larch, which can efficiently initiate the expression of target genes in larch and other woody gymnosperms. Furthermore, it aims to construct plant expression vectors carrying this promoter sequence, and to create new germplasm and lines of larch and other woody gymnosperms with excellent performance in terms of biomass, timber volume, and stress resistance through transgenic methods, gene editing, etc. To achieve the above objective, this invention discloses the following technical solution: A nucleotide sequence of a strong endogenous promoter Pro-LarGRP1A from larch, characterized in that the promoter nucleotide sequence is shown in SEQ ID NO.1.
[0006] A method for constructing plant expression vectors that can function efficiently in gymnosperms such as larch using the above promoter sequences includes the following steps: (1) Synthesis of Pro-LarGRP1A promoter nucleotide sequence with restriction enzyme site: EcoR I and Nco The Pro-LarGRP1A sequence of the I double restriction site is shown in SEQ ID NO.2.
[0007] The sequence was synthesized by General Biotechnology (Anhui) Co., Ltd. and retained in the TA cloning plasmid.
[0008] (2) The LarGRP1A promoter nucleotide sequence with restriction enzyme sites was digested to obtain the Pro-LarGRP1A promoter fragment with sticky ends: EcoR I and Nco A TA clone plasmid containing the Pro-LarGRP1A sequence with double restriction enzyme sites was transformed into *E. coli* DH5α using a 42℃ heat shock method. Positive single clones were selected for amplification culture, and the plasmid was extracted. The plasmid was then subjected to... EcoR I and Nco I. Enzyme digestion. Digestion system 20 μL: plasmid 2 μg (9 μL), 10×T buffer 2.0 μL, Nco I (25 U / μL) 2.0 μL, EcoR I (50 U / μL) 2.0 μL, sterile water 5 μL, vortex to mix, incubate at 16℃ for 16 h. Agarose gel electrophoresis, for those with... EcoR I and Nco The Pro-LarGRP1A promoter sequence at the sticky end was recovered by I enzyme digestion.
[0009] (3) Enzyme digestion of plant expression vectors to obtain linearized expression vectors with sticky enzyme ends: Commonly used plant expression vectors such as the pCAMBIA series and pBI121 are used... EcoR I and Nco I. The vector was subjected to double enzyme digestion to remove promoter elements such as CaMV35S from the original vector, thus linearizing the vector. The linearized vector was then separated using 0.8% agarose gel and recovered using a gel recovery method.
[0010] (4) Constructing an expression vector containing the Pro-LarGRP1A promoter sequence: The promoter element is removed, and the vector containing the Pro-LarGRP1A promoter sequence is... EcoR I and Nco Linearized expression vectors with sticky ends cleaved by enzyme I, and those containing EcoR I and NcoThe larch Pro-LarGRP1A promoter sequence with sticky ends was ligated using enzyme I. The ligation system consisted of: 5 μL linearized vector (approximately 2 μg), 5 μL Pro-LarGRP1A promoter sequence with sticky ends (approximately 3 μg), 2 μL 10× ligation buffer, 1 μL ligase, and 7 μL ddH2O. The mixture was incubated at 16°C for 16 h. The ligation product was then transformed into *E. coli* DH5α competent cells using a 42°C heat shock method and cultured overnight at 37°C on LB agar plates containing Kan (150 mg / L). Positive clones were picked and expanded in LB liquid medium containing Kan. The bacterial culture was collected, and the recombinant plasmid was extracted using a plasmid extraction kit to obtain the backbone expression vector containing the nucleotide sequence of the strong endogenous larch promoter Pro-LarGRP1A.
[0011] This invention further discloses a method for creating and cultivating transgenic larch with targeted improved agronomic traits using the above-mentioned expression vector containing the Pro-LarGRP1A nucleotide sequence of the larch endogenous strong promoter, which includes the following steps: (1) Pro-LarGRP1A: Construction of the target gene recombinant expression vector and preparation of Agrobacterium infection solution: The target gene or reporter genes such as GUS and GFP, which regulate the main agronomic and economic traits of wood biomass, wood properties, insect resistance, disease resistance, salt resistance or drought resistance, are inserted into the modified backbone expression vector with the Pro-LarGRP1A promoter element by enzyme digestion and ligation, to obtain the recombinant expression vector in which the target gene or GUS and GFP reporter genes are expressed by the endogenous strong promoter Pro-LarGRP1A of larch. The specific process is as follows: The target gene or GUS reporter gene is cloned by PCR amplification or direct sequence synthesis, and the gene clone fragment is inserted into the modified backbone expression vector with the Pro-LarGRP1A promoter element disclosed in this invention by enzyme digestion and ligation or seamless cloning, to obtain the recombinant expression vector in which the target gene or GUS reporter gene is expressed by the Pro-LarGRP1A promoter.
[0012] (2) Transform the above recombinant expression vector into Agrobacterium to obtain Agrobacterium infection solution containing the recombinant expression vector: Transform GV3101 or EHA105 into competent Agrobacterium cells by heat shock method, electroporation method, etc. Spread the transformed Agrobacterium on LB agar containing 150 mg / L rifampin, and incubate upside down at 28℃ for 3 days. Pick positive clones and inoculate them into 100 mL of liquid LB medium containing 150 mg / L rifampin. Incubate at 28℃ with shaking for 36 h. Collect the bacterial cells by centrifugation at 4000 rpm for 20 min. Resuspend the bacterial cells in 2 mL of 1 / 2 MS liquid medium. Take 1 mL of the resuspended bacterial cells and add it to 100 mL of 1 / 2 MS liquid medium. Mix thoroughly and OD of the bacterial solution. 600 Adjust the pH to 0.6, add 100 μM / L acetylsalicylic acid, 150 mg / Kan, and 0.02% sliwet-l 77 to the above bacterial solution to obtain Agrobacterium infection solution for genetic transformation of larch.
[0013] (3) Using Agrobacterium tumefaciens bacterial suspension containing recombinant expression vector to infect hypocotyl stem segments of larch seedlings: larch seedlings grown for about 30 days in a 1:1 mixture of peat moss and vermiculite at a temperature between 22℃ and 24℃ ( Figure 1 a) The hypocotyl is cut off and disinfected in a clean bench with 2% sodium hypochlorite for 5 min, followed by three 1.5 min washes with distilled water; then disinfected with 75% alcohol for 3 min, followed by three 1.5 min washes with distilled water; finally, it is disinfected with 1% mercuric chloride for 3 min, followed by three 1 min washes with distilled water. The hypocotyl is then cut into small segments of about 5-10 mm and pre-cultured in MS solid medium for 2 days as stable transformation material. Figure 1 b) (4) Deseptication culture of hypocotyl stem segments of infected larch seedlings: The pre-cultured larch hypocotyl segments were placed in Agrobacterium infection solution containing recombinant expression vector, and infected under vacuum for 10 min. The infection solution was filtered off, and the segments were evenly spread on solid medium containing 1 / 2 DCR + 100 μM / L acetylsylgenone and co-cultured for 5 days. The co-cultured larch hypocotyl segments were washed with sterile water containing low concentration of termethin and 100 μM / L acetylsylgenone for 2 min. The washing process was repeated 5-7 times. The surface moisture was filtered off, and the segments were spread evenly on solid medium containing DCR + 0.5 mg / L 6-BA + 0.2 mg / L NAA + 300 μL / L termethin and desepticated for 5 days. Figure 1 c) (5) Differentiation culture of hypocotyl stem segments of infected larch seedlings: The sterilized hypocotyls were transferred to differentiation medium (DCR + 4 mg / L 6-BA + 1.5 mg / L NAA + 3 mg / L Basta) for differentiation induction culture to generate adventitious shoots. Figure 1d).
[0014] (6) Molecular identification of positive transformation explants obtained after differentiation culture of hypocotyl stem segments of larch seedlings: Explants grown on resistance selection medium were transferred to DCR medium containing 0.1 mg / L 6-BA + 0.01 mg / L NAA + 1 g / LAC for resistance selection culture. After 30 days, the positive transformation seedlings that could grow normally were transferred to nutrient soil to continue growing. Figure 1 e). After 20 days of growth in nutrient soil, individual samples were taken from the transformed seedlings, and their leaves were collected. DNA was extracted using the standard CTAB plant genome extraction method and used as a template for PCR molecular identification of positive plants. Two primers were used for PCR molecular identification: the upstream primer was designed based on the vector sequence, and the downstream primer was designed based on the target gene sequence. The expected size fragment was amplified in the positive transformed lines, while no amplification product was found in the non-positive transformed lines.
[0015] (7) Evaluation of target gene expression in positive transgenic materials: The protein expression level of GUS in transgenic positive larch materials transformed with the GUS reporter gene was detected after basta resistance screening and combined primer PCR molecular identification. Chemical staining results showed that GUS was highly expressed in basta-resistant positive transformation materials. Figure 2 The results demonstrate that the larch strong promoter disclosed in this invention can initiate the efficient expression of the target gene in larch transformation materials.
[0016] RNA was extracted from positively transformed seedlings obtained through basta resistance screening and PCR molecular identification using combined primers. Quantitative PCR primers were designed based on the target gene sequence, and the expression level of the target gene in the positively transformed plants was detected and analyzed by qRT-PCR. The expression level of the target gene in the transgenic lines was more than 8 times that of transgenic lines obtained by genetic transformation using a known conventional plant expression vector as the backbone vector. Figure 3 Compared with the control, at the same growth stage, the transgenic larch obtained by genetic transformation using the plant expression vector modified with the Pro-LarGRP1A sequence of the larch strong promoter disclosed in this invention showed highly efficient improvement in the target trait. Figure 4 ).
[0017] The beneficial effects of the nucleotide sequence of the larch endogenous strong promoter Pro-LarGRP1A disclosed in this invention and its application are as follows: To address the challenges of time-consuming and inefficient conventional breeding methods for cultivating high-quality new varieties of woody gymnosperms such as larch, while bio-breeding methods such as transgenics and gene editing offer advantages such as high efficiency, strong targeting, and significantly shortened breeding cycles, the lack of efficient promoters and other expression vector construction elements in larch hinders the effective utilization of these advantages. This paper discloses a strong endogenous promoter sequence for larch and its application in constructing efficient expression vectors for larch and other woody gymnosperms, providing core components for the creation and cultivation of fast-growing, stress-resistant, and high-quality new germplasm, materials, and varieties of larch and other woody gymnosperms.
[0018] The construction of the expression vector with the nucleotide sequence of the larch endogenous strong promoter Pro-LarGRP1A (SEQ ID NO: 1) described in this invention refers to the modification of the expression vector by replacing the promoter element sequence of known conventional plant expression vectors, including but not limited to pBI121, pBI221, and pCAMBIA series vectors, such as pCAMBIA1300, pCAMBIA1301, pCAMBIA3301, and pCAMBIA3300, with the nucleotide sequence of the larch endogenous strong promoter Pro-LarGRP1A through enzyme digestion and ligation.
[0019] This invention also discloses the application of an expression vector containing the nucleotide sequence of the larch endogenous strong promoter Pro-LarGRP1A (SEQ ID NO: 1) in the molecular improvement of major agronomical and economic traits such as wood biomass, wood properties, insect resistance, disease resistance, salt tolerance, or drought resistance in woody gymnosperms such as larch. Experimental results show that, using the expression vector containing the larch endogenous strong promoter Pro-LarGRP1A as a backbone, key regulatory genes related to wood biomass, wood properties, insect resistance, disease resistance, salt tolerance, or drought resistance, as well as lignin synthesis and cellulose synthesis, are inserted to form a recombinant expression vector of the larch strong promoter Pro-LarGRP1A::target gene. This vector is then genetically transformed into larch, resulting in target gene expression levels in positive transformed lines that are more than 8 times higher than those obtained with conventional expression vectors. This demonstrates that the Pro-LarGRP1A nucleotide sequence of the larch endogenous strong promoter disclosed in this invention has significant effects in creating new transgenic larch germplasm, new materials and varieties that efficiently express target trait genes.
[0020] The method disclosed in this invention, which utilizes the endogenous strong promoter Pro-LarGRP1A nucleotide sequence of larch to create new germplasm, new materials, and varieties of woody gymnosperms such as transgenic larch with significantly improved wood biomass, wood properties, insect resistance, disease resistance, salt tolerance, or drought resistance through biological breeding techniques, has the following positive effects compared with existing technologies: (1) High efficiency: Genetic transformation of larch using conventional plant expression vectors generally suffers from low transformation efficiency. Furthermore, even if the target gene is successfully transferred into larch, it often fails to be efficiently expressed within the recipient. Conventional plant expression vectors commonly use the CaMV35S promoter, derived from cauliflower mosaic virus. The inability of this promoter to efficiently initiate target gene expression in woody gymnosperms such as larch is the primary bottleneck preventing efficient improvement of the target trait in transgenic larch. However, by using the expression vector disclosed in this invention, which carries the nucleotide sequence of the larch endogenous strong promoter Pro-LarGRP1A, genetic transformation of larch can yield transgenic materials with efficient target gene expression, significantly increasing the number of breeding-value transgenic materials with significantly improved target traits. For woody gymnosperms such as larch, which have very low transformation efficiency and are difficult to regenerate, this invention can effectively improve the expression level of target genes in the transformed lines. It is one of the most effective measures to efficiently obtain valuable breeding transgenic larch and other woody gymnosperm materials with improved target traits.
[0021] (2) Simple operation and high versatility: It is only necessary to replace the promoter in a conventional plant expression vector with the Pro-LarGRP1A nucleotide sequence disclosed in this invention by using an enzyme digestion and ligation method to obtain a backbone vector for efficient genetic transformation of woody gymnosperms such as larch. Subsequently, the target gene can be inserted after the Pro-LarGRP1A nucleotide sequence according to conventional meristematic molecular biology operation methods, and the transgenic material with efficient expression of the target gene can be obtained by genetic transformation of woody gymnosperms such as larch. Attached Figure Description
[0022] Figure 1 (a, b, c, d, e) Schematic diagram of genetic transformation of hypocotyls in larch seedlings and regeneration of positive explants; where a shows larch seedlings; b shows hypocotyl segments of larch seedlings; c shows the swelling and development of hypocotyl segments after infection and sterilization culture; d shows the early explants formed from hypocotyl stem calluses; e shows the explants after genetic transformation. Figure 2A schematic diagram of GUS expression levels in positive transformants of larch obtained by genetic transformation of larch using the endogenous strong promoter Pro-LarGRP1A:GUS reporter gene recombinant expression vector; the left side shows the GUS staining results of the whole seedling of the transformant; the right side shows the GUS staining results of the apical bud of the transformant seedling. Figure 3 Pro-LarGRP1A, an endogenous strong promoter from larch: LkMYBS3 In the positive transformants obtained by genetic transformation of larch with the target gene recombinant expression vector LkMYBS3 Expression level diagram: WT indicates untransformed larch seedlings; 35S- LkMYBS3 -Lin1、35S- LkMYBS3 -Lin2、35S- LkMYBS3 -Lin6 indicates that genetic transformation with a known conventional plant expression vector containing a 35S promoter yielded... LkMYBS3 Transgenic larch material; LarGRP1A- LkMYBS3 -Lin5、LarGRP1A- LkMYBS3 -Lin9、LarGRP1A- LkMYBS3 -Lin12 indicates the result obtained through genetic transformation using the larch Pro-LarGRP1A promoter expression vector disclosed in this invention. LkMYBS3 Genetically modified larch material; Figure 4 (a, b) Target gene initiated by the larch promoter Pro-LarGRP1A LkMYBS3 Schematic diagram of the drought resistance of the transgenic larch created; where a is the drought stress phenotype of untransformed larch seedlings; b shows the expression of Pro-LarGRP1A: LkMYBS3 Drought stress phenotype of transgenic larch material. Detailed Implementation
[0023] The present invention is further illustrated with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). All biochemical reagents, enzymes, vectors, and strains used in this invention are readily available from various biological reagent companies.
[0024] The sources of the biochemical reagents and enzymes required for this invention are shown in the table below:
[0025] Example 1 A method for constructing plant expression vectors that work efficiently in woody gymnosperms such as larch using the above promoter sequences includes the following steps: (1) Synthesis of Pro-LarGRP1A promoter nucleotide sequence with restriction enzyme site: EcoR I and Nco The Pro-LarGRP1A sequence with double restriction sites I consists of the 5' sequence. GAATTCCCATGG 3' Composition (SEQ ID NO: 2) underlined indication EcoR I and Nco I restriction site sequence.
[0026] The sequence was synthesized by General Biotechnology (Anhui) Co., Ltd. and retained in the TA cloning plasmid.
[0027] (2) The LarGRP1A promoter nucleotide sequence with restriction enzyme sites was digested to obtain the Pro-LarGRP1A promoter fragment with sticky ends: EcoR I and Nco TA clones of the Pro-LarGRP1A sequence with double restriction enzyme sites were transformed into *E. coli* DH5α using a 42℃ heat shock method. Positive single clones were selected for amplification culture, and plasmids were extracted. The plasmids were then subjected to... EcoR I and Nco I. Enzyme digestion. Digestion system 20 μL: plasmid 2 μg (9 μL), 10×T buffer 2.0 μL, Nco I (25 U / μL) 2.0 μL, EcoR I (50 U / μL) 2.0 μL, sterile water 5 μL, vortex to mix, incubate at 16℃ for 16 h. Agarose gel electrophoresis, for those with... EcoR I and Nco The Pro-LarGRP1A promoter sequence at the sticky end was recovered by I enzyme digestion.
[0028] (3) The plant expression vector was digested with enzymes to obtain a linearized expression vector with sticky ends: The well-known pCAMBIA3301 plant expression vector was used to digest the plant expression vector with enzymes to obtain a linearized expression vector with sticky ends. EcoR I and Nco I. The vector was subjected to double enzyme digestion to remove promoter elements such as CaMV35S from the original vector, thus linearizing the vector. The linearized vector was then separated using 0.8% agarose gel and recovered using a gel recovery method.
[0029] (4) Constructing an expression vector containing the Pro-LarGRP1A promoter sequence: The promoter element is removed, and the vector containing the Pro-LarGRP1A promoter sequence is... EcoR I and Nco Linearized pCAMBIA3301 expression vector with sticky ends digested by enzyme I, and containing EcoR I and NcoLigation was performed using the larch Pro-LarGRP1A promoter sequence with sticky ends digested with enzyme I. The ligation system consisted of: 5 μL linearized pCAMBIA3301 vector (approximately 2 μg), 5 μL Pro-LarGRP1A promoter sequence with digested sticky ends (approximately 3 μg), 2 μL 10× ligation buffer, 1 μL ligase, and 5 μL ddH2O. The mixture was incubated at 16°C for 16 h. The ligation product was then transformed into *E. coli* DH5α competent cells using a 42°C heat shock method and cultured overnight at 37°C on LB agar plates containing Kan (150 mg / L). Positive clones were picked and expanded in LB liquid medium containing Kan. The bacterial culture was collected, and the recombinant plasmid was extracted using a plasmid extraction kit to obtain the pCAMBIA3301 backbone expression vector containing the nucleotide sequence of the strong endogenous larch promoter Pro-LarGRP1A.
[0030] Furthermore, using the expression vector containing the nucleotide sequence of the strong endogenous promoter Pro-LarGRP1A from larch, transcription factors from larch were overexpressed. LkMYBS3 Methods for creating and cultivating drought-resistant transgenic larch ( LkMYBS3 In the NCBI database (Accession number: Lk24264), it includes the following steps: (1) Pro-LarGRP1A: LkMYBS3 Construction of recombinant expression vector and preparation of Agrobacterium infection solution: LkMYBS3 The pCAMBIA3301 backbone expression vector containing the Pro-LarGRP1A promoter element was inserted into the modified pCAMBIA3301 backbone using an enzyme digestion and ligation method to obtain a larch endogenous strong promoter Pro-LarGRP1A-driven expression vector. LkMYBS3 The recombinant expression vector Pro-LarGRP1A is used for expression: LkMYBS3 The specific process is as follows: A direct sequence synthesis method is used to synthesize sequences containing... EcoR I and Hind III. Enzyme cleavage site LkMYBS3 Perform synthesis, and synthesize LkMYBS3 The gene was inserted into the modified pCAMBIA3301 backbone expression vector containing the Pro-LarGRP1A promoter element disclosed in this invention via enzyme digestion and ligation, thereby obtaining an expression vector driven by the Pro-LarGRP1A promoter. LkMYBS3 Recombinant expression vectors.
[0031] (2) Transform the above recombinant expression vector into Agrobacterium to obtain Agrobacterium infection solution containing the recombinant expression vector: Pro-LarGRP1A:: LkMYBS3Recombinant expression was transformed into EHA105 Agrobacterium competent cells. The transformed Agrobacterium was plated on LB agar plates containing 150 mg / L rifampin and incubated upside down at 28°C for 3 days. Positive clones were picked and inoculated into 100 mL of liquid LB medium containing 150 mg / L rifampin and cultured with shaking at 28°C for 36 h. The cells were collected by centrifugation at 4000 rpm for 20 min, and the cells were resuspended in 2 mL of 1 / 2 MS liquid medium. 1 mL of the resuspended cells was added to 100 mL of 1 / 2 MS liquid medium and mixed thoroughly. The OD of the bacterial culture was then calculated. 600 Adjust the pH to 0.6, add 100 μM / L acetylsalicylic acid, 150 mg / Kan, and 0.02% sliwet-l 77 to the above bacterial solution to obtain Agrobacterium infection solution for genetic transformation of larch.
[0032] (3) Using Pro-LarGRP1A: LkMYBS3 Agrobacterium tumefaciens, containing the recombinant expression vector, was used to infect hypocotyl segments of larch seedlings. Hypocotyls of larch seedlings grown for approximately 30 days in a 1:1 mixture of peat moss and vermiculite at 22℃-24℃ were cut off. The hypocotyls were then disinfected in a clean bench with 2% sodium hypochlorite for 5 min, followed by three 1.5 min washes with distilled water; 75% alcohol for 3 min, followed by three 1.5 min washes with distilled water; and 1% mercuric chloride for 3 min, followed by three 1 min washes with distilled water. The hypocotyls were then cut into 5-10 mm segments and pre-cultured on MS solid medium for 2 days as stable transformation material.
[0033] (4) Deseptication culture of hypocotyl stem segments of infected larch seedlings: The pre-cultured larch hypocotyl segments were placed in Agrobacterium infection solution containing recombinant expression vector, and vacuum-infected for 10 min. The infection solution was filtered off, and the segments were evenly spread on solid medium containing 1 / 2 DCR + 100 μM / L acetylsylgenone and co-cultured for 5 days. The co-cultured larch hypocotyl segments were washed with sterile water containing low concentration of termethin and 100 μM / L acetylsylgenone for 2 min. The washing process was repeated 5-7 times. The surface moisture was filtered off, and the segments were spread evenly on solid medium containing DCR + 0.5 mg / L 6-BA + 0.2 mg / L NAA + 300 μL / L termethin and desepticated for 5 days. (5) Differentiation culture of hypocotyl stem segments of infected larch seedlings: The sterilized hypocotyls were transferred to differentiation medium (DCR+4 mg / L 6-BA+1.5 mg / L NAA+3 mg / L Basta) for differentiation induction culture to generate adventitious shoots.
[0034] (6) Molecular identification of positive transformation explants obtained after differentiation culture of hypocotyl stem segments of larch seedlings: Explants grown on resistance selection medium were transferred to DCR medium containing 0.1 mg / L 6-BA + 0.01 mg / L NAA + 1 g / LAC for resistance selection culture. After 30 days, the positive transformation seedlings that grew normally were transferred to nutrient soil for continued growth. After 20 days of growth in nutrient soil, individual samples were taken from the transformation seedlings, and their leaves were taken. DNA was extracted according to the conventional CTAB plant genome extraction method. The extracted DNA was used as a template for PCR molecular identification of positive plants. Two primers were used for PCR molecular identification, with the upstream primer designed based on the vector sequence and the downstream primer designed based on the target gene sequence. The expected size fragment was amplified in the positive transformation lines, while no amplification product was found in the non-positive transformation lines. The amplification primer sequences are as follows: LkMYBS3-F: 5' CCAACCAATCATCGCTGTAG 3' (SEQ ID NO: 3) LkMYBS3-R: 5'AGCAATGCCATTAGCGTAGTC3' (SEQ ID NO: 4) Primer sequences were synthesized by Suzhou Genewiz Biotechnology Co., Ltd.
[0035] (7) Evaluation of target gene expression levels in positive transgenic materials: RNA was extracted from positive transformed seedlings obtained through basta resistance screening and combined primer PCR molecular identification, and expressed according to... LkMYBS3 Quantitative PCR primers were designed based on sequence, and the expression level of LkMYBS3 in positive transformants was detected and analyzed by qRT-PCR. The expression level of the target gene in the transgenic lines was more than 8 times that of transgenic lines obtained by genetic transformation using a known conventional plant expression vector as the backbone vector. Figure 4 Compared with the control, at the same growth stage, the LkMYBS3 transgenic larch obtained by genetic transformation using the plant expression vector modified with the Pro-LarGRP1A sequence of the larch strong promoter disclosed in this invention showed significantly improved drought tolerance.
Claims
1. A nucleotide sequence Pro-LarGRP1A of the LarGRP1A promoter region of the larch gene, characterized in that... The promoter nucleotide sequence is shown in SEQ ID NO.
1.
2. A method for modifying or constructing a plant expression vector suitable for efficient operation in larch woody gymnosperms using the Pro-LarGRP1A nucleotide sequence of the LarGRP1A promoter region of the larch gene as described in claim 1, characterized in that... It proceeds in the following steps: (1) Synthesis of Pro-LarGRP1A promoter nucleotide sequence with restriction enzyme site; (2) The nucleotide sequence of the Pro-LarGRP1A promoter with restriction sites was digested to obtain the Pro-LarGRP1A promoter fragment with sticky ends. (3) The plant expression vector was digested with enzymes to obtain a linearized expression vector with enzyme-digested sticky ends; (4) Construct an expression vector containing the Pro-LarGRP1A promoter sequence.
3. A method for creating and cultivating transgenic larch trees with directed improvements in major agronomical and economic traits such as wood biomass, timber properties, insect resistance, disease resistance, salt tolerance, and drought resistance, using an expression vector constructed from the Pro-LarGRP1A sequence of the larch gene endogenous strong promoter as described in claim 1, characterized in that... Includes the following steps: (1) The target gene that regulates the main agronomic and economic traits such as wood biomass, wood properties, insect resistance, disease resistance, salt resistance or drought resistance is inserted into the plant expression vector with the Pro-LarGRP1A promoter sequence disclosed in this invention to obtain Pro-LarGRP1A: target gene recombinant expression vector. (2) Transform the above recombinant expression vector into Agrobacterium to obtain Agrobacterium infection solution containing the recombinant expression vector; (3) Agrobacterium tumefaciens with recombinant expression vector was used to infect the hypocotyl stem segments of larch seedlings; (4) Desiccation culture of hypocotyl stem segments of infected larch seedlings; (5) Differentiation culture of hypocotyl stem segments of infected larch seedlings; (6) Molecular identification of positive transformation explants obtained after differentiation culture of hypocotyl stem segments of larch seedlings; (7) Evaluation of the expression level of the target gene in positive transgenic materials.
4. The application of constructing a plant expression vector suitable for efficient operation in larch woody gymnosperms using the endogenous strong promoter Pro-LarGRP1A nucleotide sequence of larch as described in claim 1, and creating and cultivating transgenic larch with targeted improvement of target agronomic traits.
5. The application of claim 4, wherein the application of creating and cultivating transgenic larch with targeted improvement of target agronomic traits refers to: creating and cultivating larch woody gymnosperms with high biomass, fast growth, salt resistance, drought resistance, disease resistance, insect resistance, and excellent wood properties.