Tobacco polygene editing expression vector as well as construction method and application thereof

Abstract

The invention relates to the technical field of gene editing, in particular to a tobacco multi-gene editing expression vector and a construction method and application thereof. According to the invention, a CRISPR / Cas9 gene editing system based on a tRNA spacer element is used for simultaneously targeting DHS, POD3, CSE, LPEAT, LHT1 and eIF4E of tobacco, mutant materials for simultaneously editing multiple genes are screened out, new germplasm is provided for creating excellent tobacco varieties, and the invention belongs to the technical field of gene editing.

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, and in particular to tobacco multi-gene editing expression vectors, their construction methods, and applications. Background Technology

[0002] Tobacco, as a model plant and an important economic crop, plays a vital role in the field of multi-gene editing research. CRISPR / Cas9 is a novel genome-directed editing technology that has been widely used in the targeted editing of the tobacco genome in recent years. CRISPR / Cas9-mediated multi-gene editing technology has shown great potential in many species. Currently, the most commonly used multi-gene editing vector systems primarily use a separate promoter to drive the expression of each sgRNA. This leads to complex system architectures, cumbersome and time-consuming construction procedures, and requires the selection of multiple different pol III promoters, which imposes many limitations. tRNA (transfer RNA) is a class of small ribonucleic acid molecules widely distributed in organisms for carrying and transporting amino acids. In the nucleus of eukaryotic cells, the precursor of tRNA is recognized by RNase P and RNase Z and cleaved at specific sites. The cleaved 5' and 3' redundant sequences have no sequence restriction. A polycistronic tRNA-gRNA (PTG) system was developed using the plant's endogenous tRNA processing and maturation mechanism. This system can simultaneously transcribe multiple sgRNAs using a single pol III promoter without requiring exogenous RNA processing and cutting tools. This method has been used in crops such as rice and tomato, but its feasibility and ability to simultaneously edit six gene loci and create materials in cultivated tobacco have not yet been verified. Summary of the Invention

[0003] In view of this, the purpose of this invention is to provide the application of the CRISPR / Cas9 gene editing system in tobacco multi-gene editing, so as to provide conditions for creating new tobacco germplasm with disease resistance, cold tolerance and improved quality traits.

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0005] This invention provides a tobacco multi-gene editing expression cassette containing sgRNAs of NtDHS, NtPOD3, NtCSE, NtLPEAT, NtLHT1, and NteIF4E.

[0006] In some specific embodiments of the present invention, the sequence of the sgRNA of the NtDHS in the above-mentioned tobacco multi-gene editing expression cassette is shown in SEQ ID NO: 1;

[0007] The sequence of the sgRNA of NtPOD3 is shown in SEQ ID NO: 2;

[0008] The sequence of the sgRNA of the NtCSE is shown in SEQ ID NO: 3;

[0009] The sequence of the sgRNA of NtLPEAT is shown in SEQ ID NO: 4;

[0010] The sequence of the sgRNA of NtLHT1 is shown in SEQ ID NO: 5;

[0011] The sequence of the sgRNA of NteIF4E is shown in SEQ ID NO: 6.

[0012] In some specific embodiments of the present invention, the above-mentioned tobacco multi-gene editing expression cassette also has a spacer sequence;

[0013] The spacer sequence is shown in SEQ ID NO: 22:

[0014] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA (SEQ ID NO: 22).

[0015] In some specific embodiments of the present invention, the above-mentioned tobacco multi-gene editing expression cassette has the sequence shown in SEQ ID NO: 7.

[0016] In some specific embodiments of the present invention, the above-mentioned tobacco multi-gene editing expression cassette further includes an AtU3 promoter, a gRNA scaffold, and a transcription termination signal with the sequence TTTTTT.

[0017] The present invention also provides an expression vector comprising the above-described tobacco multi-gene editing expression cassette.

[0018] The present invention also provides the application of the above-mentioned tobacco multi-gene editing expression cassette or the above-mentioned expression vector in any of the following:

[0019] (i) Improve tobacco properties;

[0020] (ii) Creating new tobacco germplasm;

[0021] (iii) Preparation of gene editing reagents for improving tobacco traits;

[0022] (iv) Preparation of gene editing reagents for creating new tobacco germplasm.

[0023] The present invention also provides a gene editing reagent comprising the above-described tobacco multi-gene editing expression cassette or the above-described expression vector.

[0024] In some specific embodiments of the present invention, the gene editing reagent further comprises identification primers;

[0025] The identification primers include Cas9 identification primers and target gene identification primers;

[0026] The Cas9 identification primers may be primers as shown in SEQ ID NO: 8~9;

[0027] The primers for target gene identification can be primers as shown in SEQ ID NO: 10~21.

[0028] The present invention also provides a gene editing method, which includes editing based on the above-described tobacco multi-gene editing expression cassette, the above-described expression vector, and the above-described gene editing reagent.

[0029] In some specific embodiments of the present invention, the above-mentioned gene editing method includes: transforming the above-mentioned expression vector into Agrobacterium, performing genetic transformation of tobacco using Agrobacterium-mediated transformation, identification, and completing gene editing.

[0030] The present invention also provides a method for creating new tobacco germplasm, which includes transforming the above expression vector into Agrobacterium, performing genetic transformation of tobacco using Agrobacterium-mediated transformation, screening, and obtaining new tobacco germplasm.

[0031] The present invention has the following beneficial effects:

[0032] This invention utilizes a CRISPR / Cas9 gene editing system based on tRNA spacer elements to simultaneously target genes such as DHS (growth and development), POD3 (sugar metabolism), CSE (regulating lignin synthesis and secondary metabolite production in tobacco), LPEAT (low temperature tolerance), LHT1 (regulating amino acid migration and distribution in plants), and eIF4E (antiviral resistance) in tobacco. By screening out mutant materials with simultaneous editing of multiple genes, this invention provides new germplasm for creating superior tobacco varieties and belongs to the field of gene editing technology. Attached Figure Description

[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0034] Figure 1 The p1301-CRISPR / Cas9 vector map is shown.

[0035] Figure 2 The diagram shows the structure of the CRISPR / Cas9 editing vector, where LB is the left boundary, AtU3 is the promoter, tRNA is the spacer repeat sequence, sgRNA1, sgRNA2, sgRNA3, sgRNA4, sgRNA5, and sgRNA6 are the sgRNAs corresponding to the DHS, POD3, CSE, LPEAT, LHT1, and eIF4E genes, respectively, 35S is the promoter, NOS is the terminator, and RB is the right boundary.

[0036] Figure 3 The results of identification of transgenic positive seedlings from some T0 generation regenerated plants are shown.

[0037] Figure 4 The Sanger sequencing results of some T0 generation regenerated plants are shown. Detailed Implementation

[0038] This invention discloses a tobacco multi-gene editing expression vector, its construction method, and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0039] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.

[0040] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.

[0041] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.

[0042] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and does not constitute a limitation on the scope of the invention. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.

[0043] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately". Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.

[0044] To explore the technical system of CRISPR / Cas9-mediated multi-gene editing in tobacco, this invention selects some negative regulatory genes related to tobacco growth and development (NtDHS), sugar metabolism (NtPOD3), lignin synthesis (NtCSE), low temperature resistance (NtLPEAT), amino acid migration and allocation (NtLHT1), and antiviral resistance (NteIF4E) for editing, and identifies excellent mutant materials to provide new germplasm for the creation of superior tobacco varieties.

[0045] In one implementation, the tobacco multi-gene editing vector is p1301-CRISPR / Cas9-DHS-POD3-CSE-LPEAT-LHT1-eIF4E, and the vector contains the coding sequences shown in SEQ ID NO: 1~6.

[0046] In specific implementation, the vector construction method includes: selecting DHS, POD3, CSE, LPEAT, LHT1, and eIF4E as target genes, and designing one sgRNA on the exons of each of these genes; synthesizing tandem sgRNA fragments and subcloning them into the p1301-CRISPR / Cas9 vector (see diagram). Figure 1 The tobacco knockout vector was obtained and named p1301-CRISPR / Cas9-DHS-POD3-CSE-LPEAT-LHT1-eIF4E.

[0047] In one example, the above-mentioned vector can be used to simultaneously target multiple negative regulatory genes in the tobacco genome or to simultaneously improve multiple traits in tobacco genetic transformation. The specific method includes: selecting multiple target genes and designing one sgRNA on the exons of each of these genes; synthesizing tandem sgRNA fragments and subcloning them into the p1301-CRISPR / Cas9 vector to obtain a tobacco knockout vector, which is then transformed into Agrobacterium; and using Agrobacterium-mediated transformation to perform tobacco genetic transformation.

[0048] In one example, the above-mentioned vector can be used to create new tobacco germplasm. The specific method includes: transforming Agrobacterium tumefaciens into the vector p1301-CRISPR / Cas9-DHS-POD3-CSE-LPEAT-LHT1-eIF4E; performing genetic transformation of tobacco using Agrobacterium-mediated transformation; and screening to obtain new tobacco germplasm.

[0049] In one example, the aforementioned vector can be used in tobacco gene editing, resulting in CRISPR / Cas9-DHS-POD3-CSE-LPEAT-LHT1-eIF4E gene knockout plants obtained through Agrobacterium-mediated tobacco genetic transformation. Leaves from T0 generation regenerated plants were used to extract genomic DNA. Verification confirmed that up to six sites were successfully edited simultaneously in the p1301-CRISPR / Cas9-DHS-POD3-CSE-LPEAT-LHT1-eIF4E event. The editing efficiency was 40.6% for DHS, 40.6% for POD3, 6.1% for CSE, 6.7% for LPEAT, 48.3% for LHT1, and 2.7% for eIF4E, resulting in a new tobacco germplasm exhibiting disease resistance, cold tolerance, and improved quality traits.

[0050] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in this invention are all commercially available products and can be purchased from the market.

[0051] The present invention will be further illustrated below with reference to the embodiments.

[0052] Example 1: Obtaining the p1301-CRISPR / Cas9-DHS-POD3-CSE-LPEAT-LHT1-eIF4E vector

[0053] This invention selects DHS, POD3, CSE, LPEAT, LHT1, and eIF4E as target genes. Using the CRISPR target design website CRISPRREGN tools (http: / / www.rgenome.net / cas-designer / ), based on the CDS sequences of DHS, POD3, CSE, LPEAT, LHT1, and eIF4E, highly specific targets with GC content between 40% and 60% are selected. One sgRNA is designed on the exons of each of these genes. The coding sequences of the sgRNAs are as follows:

[0054] sgRNA - DHS: 5' - GTTAAGCCAGGACAGAAGAC - 3' (SEQ ID NO: 1);

[0055] sgRNA - POD3: 5' - GCCACCAGAGGATAAGCCAC - 3' (SEQ ID NO: 2);

[0056] sgRNA - CSE: 5' - GGACGACCTCGTCTACAAAC - 3' (SEQ ID NO: 3);

[0057] sgRNA - LPEAT: 5' - GTGGCCGATCGTCTTTGGTA - 3' (SEQ ID NO: 4);

[0058] sgRNA - LHT1: 5' - GTACCATCCAAGTTGTGCCA - 3' (SEQ ID NO: 5);

[0059] sgRNA - eIF4E: 5' - TGTGGATGAATCTGATGATA - 3' (SEQ ID NO: 6).

[0060] Shenzhen BGI Genomics Co., Ltd. synthesized a tandem sgRNA fragment in the order sgRNA-DHS-POD3-CSE-LPEAT-LHT1-eIF4E. The p1301-CRISPR / Cas9 vector was digested with BsaI, and then the tandem sgRNA fragment was cloned into the digested p1301-CRISPR / Cas9 vector using the CloneEZ recombination cloning kit (recombination system shown in Table 1), resulting in the tobacco knockout vector, named p1301-CRISPR / Cas9-DHS-POD3-CSE-LPEAT-LHT1-eIF4E (structure shown in Table 1). Figure 2 The sequence of the sgRNA expression cassette of the Cas9 multiplex gene editing system is shown in SEQ ID NO: 7. After obtaining the vector p1301-CRISPR / Cas9-DHS-POD3-CSE-LPEAT-LHT1-eIF4E, it was sent to Shenzhen BGI Genomics Co., Ltd. for sequencing analysis to further confirm the successful construction of the vector. The vector was then transformed into Agrobacterium competent cells LBA4404 for later use.

[0061] Table 1: Recombination system of sgRNA fragment and vector

[0062]

[0063] The sequence of the sgRNA expression cassette in the Cas9 multiplex gene editing system described above is as follows:

[0064] ggtctcttgcaGTTAAGCCAGGACAGAAGACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAGCCACCAGAGGATAAGCCACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAGGACGACCTCGTCTACAAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAGTGGCCGATCGTCTTTGGTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAGTACCATCCAAGTTGTGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCATGTGGATGAATCTGATGATAgttttgagacc (SEQ ID NO: 7).

[0065] Example 2: Agrobacterium-mediated genetic transformation of tobacco

[0066] The p1301-CRISPR / Cas9-DHS-POD3-CSE-LPEAT-LHT1-eIF4E editing vector was transformed into Agrobacterium LBA4404, and tobacco leaves were transformed using the leaf disc method. Positive transgenic materials were obtained through resistance screening and molecular identification.

[0067] Preliminary PCR identification of transgenic tobacco: Since all positive transgenic materials obtained contain the Cas9 gene, but not all materials with the Cas9 gene have been edited (because if the Cas9 gene is not detected in the transgenic material, it has not been edited), it is necessary to first identify the transgenic materials containing the Cas9 gene using PCR technology to screen for edited positive plants. The specific method is as follows:

[0068] 1. Extract genomic DNA from genetically modified tobacco;

[0069] 2. Design detection primers Cas9, which can effectively and specifically amplify the Cas9 gene. The detection primers Cas9 include:

[0070] Sixth forward primer (CAS9-JCF):

[0071] ACATCGTGGAACGAAGTGCTTATC (SEQ ID NO: 8);

[0072] Sixth reverse primer (CAS9-JCR):

[0073] ATATCACTCAGAAGTATAGCGTCC (SEQ ID NO: 9);

[0074] 3. Preliminary PCR identification of transgenic tobacco was performed using the aforementioned detection primer Cas9, such as... Figure 3 As shown. By Figure 3 It is known that transgenic materials containing the Cas9 gene have been obtained, providing materials for the next step of screening to obtain plants with multiple gene editing.

[0075] Example 3: Genotyping of CRISPR / Cas9 gene editing

[0076] The steps are as follows:

[0077] 1. Design a second identification primer that specifically amplifies the NtDHS, NtPOD3, NtCSE, NtLPEAT, NtLHT1, and NteIF4E sequences from the tobacco genome. The amplified sequences contain the CRISPR-edited target sequences in this embodiment, thereby identifying gene editing status. The second identification primer includes:

[0078] NtDHS1-jcF: GCTACCCTGGTATTTATCATCAT (SEQ ID NO: 10);

[0079] NtDHS1-jcR: TAATCCAAAAGACAGCACCAG (SEQ ID NO: 11);

[0080] NtPOD3-jcF: ATGGAGAAATATTTAGGGTTTTTGG (SEQ ID NO: 12);

[0081] NtPOD3-jcR: CCTACCTCATCTAAATTGAAACGG (SEQ ID NO: 13);

[0082] NtCSE-jcF: CGCCAAAGCTCTCATTCTCT (SEQ ID NO: 14);

[0083] NtCSE-jcR: TGCCACATTCCTGGATACAA (SEQ ID NO: 15);

[0084] NtLPEAT-jcF: AACAATGGTTATCCAATCCAATAGA (SEQ ID NO: 16);

[0085] NtLPEAT-jcR: AAACGCTGTACAAACCTTACAAATC (SEQ ID NO: 17);

[0086] NtLHT1-jcF: ATGGGATTATAT TAAATTTAT (SEQ ID NO: 18);

[0087] NtLHT1-jcR: ATAAAAGTTAAATCTTGAATA (SEQ ID NO: 19);

[0088] NteIF4E-jcF: AAGTTACAGTCCAAACTGAGGAAAA (SEQ ID NO: 20);

[0089] NteIF4E-jcR: GAACCGAGGGAATATGAAATAACTT (SEQ ID NO: 21).

[0090] 2. Extract transgenic tobacco genomic DNA;

[0091] 3. Using the DNA obtained above as a template, PCR amplification was performed using the fifth forward primer and the fifth reverse primer. The amplification product was ligated into the pBlunt-T vector, and single clones were picked for identification, such as... Figure 4 As shown. By Figure 4 It is known that NtDHS, NtPOD3, NtCSE, NtLPEAT, NtLHT1, and NteIF4E gene-edited materials were obtained.

[0092] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A tobacco multi-gene editing expression cassette, characterized in that, The sgRNAs containing NtDHS, NtPOD3, NtCSE, NtLPEAT, NtLHT1, and NteIF4E are included.

2. The tobacco multi-gene editing expression cassette as described in claim 1, characterized in that, The sequence of the sgRNA of the NtDHS is shown in SEQ ID NO: 1; The sequence of the sgRNA of NtPOD3 is shown in SEQ ID NO: 2; The sequence of the sgRNA of the NtCSE is shown in SEQ ID NO: 3; The sequence of the sgRNA of NtLPEAT is shown in SEQ ID NO: 4; The sequence of the sgRNA of NtLHT1 is shown in SEQ ID NO: 5; The sequence of the sgRNA of NteIF4E is shown in SEQ ID NO:

6.

3. The tobacco multi-gene editing expression cassette as described in claim 1, characterized in that, It also has an interval sequence; The spacer sequence is shown in SEQ ID NO:

22.

4. The tobacco multi-gene editing expression cassette as described in claim 1, characterized in that, It has the sequence shown in SEQ ID NO:

7.

5. The tobacco multi-gene editing expression cassette as described in claim 1, characterized in that, It also includes the AtU3 promoter.

6. An expression carrier, characterized in that, It includes the tobacco multi-gene editing expression cassette according to any one of claims 1 to 5.

7. The use of the tobacco multi-gene editing expression cassette according to any one of claims 1 to 5 or the expression vector according to claim 6 in any one of the following: (i) Improve tobacco properties; (ii) Creating new tobacco germplasm; (iii) Preparation of gene editing reagents for improving tobacco traits; (iv) Preparation of gene editing reagents for creating new tobacco germplasm.

8. A gene editing reagent, characterized in that, It comprises the tobacco multi-gene editing expression cassette according to any one of claims 1 to 5 or the expression vector according to claim 6.

9. The gene editing reagent as described in claim 8, characterized in that, It also includes identification primers.

10. A gene editing method, characterized in that, Editing includes editing based on the tobacco multi-gene editing expression cassette according to any one of claims 1 to 5, the expression vector according to claim 6, or the gene editing reagent according to claim 8 or 9.

Images