Soybean bidirectional promoter, recombinant vector and construction method and application thereof

By using the soybean bidirectional promoter SXPRO10 and its recombinant vector, combined with the ZQ6 enhancement sequence and the 35S:MdMYB10 expression cassette, the problem of simultaneous expression of multiple genes was solved, achieving efficient gene synergistic regulation and plant trait improvement.

CN121294445AActive Publication Date: 2026-01-09INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511795020.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-02
Publication Date
2026-01-09
Estimated Expiration
2045-12-02

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve simultaneous expression of multiple genes in plants. Repetitive DNA sequences lead to gene silencing, affecting the genetic stability and expression consistency of transgenic plants. Traditional promoters are unable to meet the needs of multi-gene synergistic regulation.

Method used

The soybean bidirectional promoter SXPRO10 and its recombinant vector, combined with the ZQ6 enhancement sequence and the 35S:MdMYB10 expression cassette, were used to construct a recombinant vector to drive multi-gene synergistic expression, reduce repetitive sequences, and improve vector stability and Agrobacterium-mediated transformation efficiency.

Benefits of technology

It enables the simultaneous expression of multiple genes in plants, improves the stability and transformation efficiency of the vector, and can drive the synergistic expression of six or more genes, significantly improving the efficiency of plant trait improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294445A_ABST
    Figure CN121294445A_ABST
Patent Text Reader

Abstract

The invention discloses a soybean bidirectional promoter, a recombinant vector and a construction method and application thereof, and belongs to the technical field of plant genetic engineering. The soybean bidirectional promoter can simultaneously drive gene expression in two directions, the front end and the rear end of the bidirectional promoter are respectively connected with three genes in series, and simultaneous expression of six genes can be driven by one promoter. The bidirectional promoter is combined with a ZQ6 enhancement sequence and a 35S: MdMYB10 expression cassette, a method for simultaneously and remarkably improving the expression level of more than six genes is developed, and a method for enabling a plant to emit obvious self-luminescence under a dark condition is developed based on the method. The soybean two-way promoter mediated multi-gene efficient synergistic transformation method provided by the invention can be applied to the aspects of constructing a soybean multi-gene synergistic transformation system, realizing rapid polymerization of excellent characters, cultivating new soybean germplasm with excellent characters and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a soybean bidirectional promoter, recombinant vector, its construction method, and its application. Background Technology

[0002] In crop molecular breeding and functional genomics research, the development of multi-gene synergistic transformation and rapid trait aggregation technologies is a core direction for overcoming the bottlenecks of traditional genetic improvement techniques. Traditional single-gene transformation systems are ill-suited to the multi-gene regulatory network characteristics of complex agronomic traits such as crop yield, stress resistance, and quality, and cannot achieve the simultaneous introduction and synergistic expression of multiple functional genes. Currently, the cauliflower mosaic virus CaMV 35S promoter and the maize UBI promoter, as stable and efficient exogenous gene expression regulatory elements, remain commonly used tools in plant genetic engineering. However, in transgenic operations, repetitive DNA sequences easily induce gene silencing, a phenomenon that is significantly amplified during multi-gene transformation, severely affecting the acquisition of transgenic plants and the genetic stability of offspring. When introducing two or more exogenous genes, it is necessary to ensure that these genes maintain consistency in expression levels and spatiotemporal expression patterns to guarantee their normal biological function. Existing research confirms that the CaMV 35S promoter and the maize UBI promoter are insufficient to meet the above regulatory requirements, and these related technical difficulties have become key bottlenecks that urgently need to be overcome in the field of plant genetic engineering.

[0003] The advancement of genomics has spurred the completion of genome sequencing for various organisms, and bioinformatics analysis has confirmed the existence of bidirectional promoters. This provides the possibility of utilizing endogenous bidirectional promoters in plants for transgenic operations and avoiding gene silencing caused by multi-gene insertion. Bidirectional promoters require only one element to drive the reverse transcription of two genes, significantly reducing repetitive sequences in vectors and lowering the risk of gene silencing caused by sequence duplication. Their shared cis-regulatory element characteristic ensures high synchronization of expression levels and spatiotemporal patterns between the two genes, meeting the needs of multi-gene co-expression in metabolic or signaling pathways. In vector construction, this promoter eliminates the need for separate expression cassettes for multiple genes, enabling simultaneous driving of multi-gene expression, significantly shortening vector length, and improving vector stability and Agrobacterium-mediated transformation efficiency. Some bidirectional promoters also possess tissue-specific or inducible response characteristics, enabling co-expression of two genes under specific conditions. As an important dual-purpose crop for both grain and oil, soybean's exploration of endogenous bidirectional promoters and their application to efficient multi-gene co-expression is of great significance for advancing the process of biobreeding. Summary of the Invention

[0004] To address the aforementioned shortcomings of existing technologies, the present invention aims to provide a soybean bidirectional promoter, a recombinant vector, its construction method, and its application, thereby providing an endogenous soybean bidirectional promoter and applying it to the efficient synergistic expression of multiple genes, improving vector stability and Agrobacterium-mediated transformation efficiency.

[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: a soybean bidirectional promoter SXPRO10 is provided, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] The present invention provides a recombinant vector containing the above-mentioned soybean bidirectional promoter SXPRO10, and the recombinant vector further includes a ZQ6 enhancement sequence and a 35S:MdMYB10 expression cassette.

[0007] Furthermore, the nucleotide sequence of the ZQ6 enhancement sequence is shown in SEQ ID NO.4; the nucleotide sequence of the 35S:MdMYB10 expression cassette is shown in SEQ ID NO.5.

[0008] This invention provides a method for constructing the above-mentioned recombinant vector, comprising the following steps: (1) The vectors PTF101-GFP-RUBY and Blunt-Zero-SXPRO10 were double-digested with restriction endonucleases SpeI and NcoI, respectively, and the target fragments were recovered by gel electrophoresis. (2) The target fragment obtained in step (1) was ligated using T4 DNA ligase and then transformed into E. coli to obtain the recombinant expression vector PTF101-GFP-SXPRO10-RUBY; (3) The ZQ6 enhancement sequence was integrated into both ends of the SXPRO10 promoter of the PTF101-GFP-SXPRO10-RUBY vector to obtain the intermediate vector SXPRO10-ZQ6-FAGUANG; (4) AscI and PmeI restriction sites were introduced at both ends of the 35S:MdMYB10 expression cassette sequence, and then double-digested with restriction endonucleases AscI and PmeI. The digested 35S:MdMYB10 expression cassette sequence was inserted into the SXPRO10-ZQ6-FAGUANG vector using T4 DNA ligase to obtain the cassette.

[0009] This invention provides an application of the above-mentioned recombinant vector in driving the expression of target genes in plants.

[0010] 6. A method for driving the expression of a target gene in a plant, comprising the following steps: (1) The recombinant vector was constructed using the above method and then subjected to double enzyme digestion; (2) The target gene is tandemly linked by a P2A linker peptide, and restriction enzyme sites are introduced at both ends of the target gene sequence, followed by restriction enzyme digestion. (3) The enzyme digestion products from step (2) are respectively ligated to the front and back ends of the SXPRO10 promoter of the recombinant vector from step (1); (4) After transferring the product obtained in step (3) into Agrobacterium tumefaciens by freeze-thaw method, Agrobacterium tumefaciens is injected into the plant to infect it.

[0011] This invention provides an application of the above-mentioned recombinant vector in improving plant traits, cultivating transgenic plants, or cultivating new plant varieties.

[0012] This invention also provides a method for preparing luminescent tobacco, comprising the following steps: (1) The BnC3'H1, AnNPGA and NnH3H-v2 genes were tandemly linked by the P2A linker peptide, and then NcoI and StuI restriction sites were introduced at both ends of the tandem sequence, respectively; after double digestion of the PTF101-GFP-SXPRO10-RUBY vector with NcoI and StuI, the tandem gene was linked to the SXPRO10 promoter front end of the PTF101-GFP-SXPRO10-RUBY vector; (2) The NnLuz-v4, NnCPH and McitHispS genes were tandemly linked by the P2A linker peptide, and then XbaI and HpaI restriction sites were introduced at both ends of the tandem sequence, respectively; after double digestion of the PTF101-GFP-SXPRO10-RUBY vector with XbaI and HpaI, the tandem gene was linked to the SXPRO10 promoter end of the PTF101-GFP-SXPRO10-RUBY vector; (3) The recombinant vector obtained in step (3) is transferred into Agrobacterium tumefaciens by freeze-thaw method and then used to infect tobacco to obtain the product.

[0013] This invention offers the following advantages: The soybean bidirectional promoter of this invention can simultaneously drive the expression of its upstream and downstream target genes. By introducing the soybean bidirectional promoter sequence into a vector, a recombinant vector PTF101-GFP-SXPRO10-RUBY is obtained. This recombinant vector effectively expresses the upstream and downstream RUBY and GFP genes in both a tobacco transient expression system and a soybean hairy root transformation system, indicating that this promoter can simultaneously drive gene expression in two directions. By tandemly connecting three genes at the front and back ends of this bidirectional promoter, the simultaneous expression of six genes can be achieved with a single promoter. Furthermore, by utilizing this bidirectional promoter in combination with the ZQ6 enhancement sequence and the 35S:MdMYB10 expression cassette, a method for simultaneously and significantly enhancing the expression levels of more than six genes was developed, and based on this, a method for enabling plants to emit noticeable autoluminescence under dark conditions was developed. The soybean bidirectional promoter-mediated efficient and coordinated multi-gene transformation method provided by this invention can be applied to constructing a soybean multi-gene coordinated transformation system, achieving rapid aggregation of superior traits, and cultivating new soybean germplasm with excellent traits. Attached Figure Description

[0014] Figure 1The vector map for PTF101-GFP-SXPRO10-RUBY; Figure 2 The results of verifying the function of the soybean bidirectional promoter using a tobacco transient expression system are shown in Figure A. Figure A shows the results under white light conditions, and Figure B shows the results of detecting GFP fluorescence signals using a plant in vivo imaging system. Figure 3 The results of verifying the function of the soybean bidirectional promoter using the soybean hairy root transformation system are shown in Figure A. Figure A shows the results under white light conditions; Figure B shows the RUBYC plot observed using a stereomicroscope and a plant in vivo imaging system; Figure C shows the results of detecting GFP fluorescence signals. Figure 4 The vector map of FAGUANG; Figure 5 Figure A shows the results of a bidirectional promoter driving the coordinated expression of multiple genes in plants. Figure B shows the results of a real-time PCR experiment using a tobacco transient expression system to verify the synchronous expression of six genes driven by the SXPRO10 promoter. Figure C shows the results of a real-time PCR experiment using a soybean hairy root system to verify the synchronous expression of six genes driven by the SXPRO10 promoter in soybean. Figure 6 The vector spectrum of ZQ6-SXPRO10-ZQ6-FAGUANG-35S-MdMYB10; Figure 7 The results show the effects of the bidirectional promoter SXPRO10 simultaneously upregulating the expression levels of multiple genes after binding to ZQ6 and MdMYB10 elements. Figure A shows the results of a real-time PCR experiment using a tobacco transient expression system to verify that the bidirectional promoter SXPRO10 simultaneously upregulates the expression levels of multiple genes after binding to ZQ6 and MdMYB10 elements. Figure B shows tobacco leaf parts transformed with the SXPRO10-ZQ6-FAGUANG-MdMYB10 vector exhibiting significant autoluminescence under dark conditions. Detailed Implementation

[0015] The examples given below are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, conditions in the examples are performed under standard conditions or as recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0016] Example 1: Cloning of the soybean bidirectional promoter and its verification in tobacco and soybean hair roots (1) Cloning of the soybean bidirectional promoter Bioinformatics analysis revealed several potential bidirectional promoter sequences in the soybean genome. This invention uses DNA from the soybean variety Huang 13 (from the Institute of Crop Science, Chinese Academy of Agricultural Sciences) as a template to amplify the soybean bidirectional promoter (named SXPRO10, its nucleotide sequence shown in SEQ ID NO.1) using the following primers. Restriction sites NcoI and SpeI were introduced at both ends of the SXPRO10 sequence.

[0017] Primer SXPRO10-F: 5'-CATGCCATGGTGTTATGTTTGGTTTTCAATT-3' (SEQ ID NO. 2); Primer SXPRO10-R: 5'-GACTAGTGCTAAGGAGAAACAGAGGAA GAA-3' (SEQ ID NO.3).

[0018] The amplification products were separated by 1% agarose gel electrophoresis, and the target band (1032 bp in size) was recovered from the gel and ligated into the cloning vector of the TA / Blunt-Zero Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number C601-01). The vector was transformed into E. coli Fast-T1, and the ligated target sequence was confirmed to be correct after sequencing, thus obtaining the Blunt-Zero-SXPRO10 vector.

[0019] (2) Construction of recombinant expression vector ① The PTF101-GFP-RUBY vector, which was previously constructed and preserved in the laboratory, was double-digested with restriction endonucleases SpeI and NcoI in a 50 μL system (1.5 μg of PTF101-GFP-RUBY vector, 1.5 μl each of SpeI and NcoI, 5 μl of Cutsmart buffer, and ddH2O to make up to 50 μL) at 37℃. The reaction time was 3 hours. The target fragment that needed to be recovered by gel electrophoresis was approximately 14412 bp.

[0020] ② The Blunt-Zero-SXPRO10 vector was double-digested with restriction endonucleases SpeI and NcoI in a 50 μL system (1.5 μg of Blunt-Zero-SXPRO10 vector, 1.5 μl each of SpeI and NcoI, 5 μl of Cutsmart buffer, and ddH2O to bring the total volume to 50 μL) at 37 °C for 3 hours. The target fragment to be recovered by 1% agarose gel electrophoresis was approximately 1021 bp.

[0021] ③ Using T4 DNA ligase (Beijing Bailinke Biotechnology Co., Ltd., catalog number M0202T), the target fragments obtained in steps ① and ② were ligated, and the mixture was transformed into E. coli Fast-T1 to obtain the recombinant expression vector PTF101-GFP-SXPRO10-RUBY, as shown in the diagram. Figure 1 As shown in the figure. This vector contains two marker genes, GFP and RUBY, located on either side of the soybean bidirectional promoter SXPRO10, for the purpose of verifying the function of the bidirectional promoter.

[0022] (3) Verify the function of the soybean bidirectional promoter using a tobacco transient expression system. ① The recombinant vector PTF101-GFP-SXPRO10-RUBY was transformed into Agrobacterium tumefaciens GV3101 (PSoup-P19, Shanghai Weidi Biotechnology Co., Ltd., catalog number AC1003L) competent cells using the freeze-thaw method to obtain recombinant Agrobacterium, which was named GV3101-PTF101-GFP-SXPRO10-RUBY.

[0023] ② Agrobacterium injection infection of tobacco: Firstly, bacterial activation is performed. For the first activation, 100 μL of preserved GV3101 bacterial suspension is added to 5 mL of LB+Rif+Spe liquid medium and incubated at 220 rpm for 12 h at 28℃. Then, a second activation is performed by transferring 200 μL of the first-activated bacterial suspension to 200 mL of LB+Rif+Spe liquid medium and incubating at 220 rpm for 14 h at 28℃. When the bacterial suspension reaches OD600 = 0.8-1.0, the suspension is centrifuged (6000 rpm, 10 min), the supernatant is discarded, and the bacterial cells are retained. Then, an infection solution (100 mL) is prepared by weighing 0.4 g of MgCl2·6H2O, 150 μL of 0.1 M acetylsyleugenone, and 0.4 g of MES monohydrate, and bringing the volume to 100 mL with water. The bacterial cells are then resuspended in the infection solution until OD600 = 0.5. After the bacterial culture was left to stand at room temperature for 3 hours, it was injected into 5-6 week old tobacco leaves with a 1 mL syringe. The leaves were then treated in the dark for 24 hours and then transferred to a greenhouse at 25°C for 3-5 days of cultivation before further observation.

[0024] Depend on Figure 2 As shown in Figure A, tobacco leaves injected with recombinant Agrobacterium GV3101-PTF101-GFP-SXPRO10-RUBY exhibited a magenta color from betalains, indicating that SXPRO10 drove the expression of the RUBY gene. Subsequently, this invention utilized a plant in vivo imaging system to detect the GFP fluorescence signal. The results are as follows... Figure 2As shown in Figure B, the GFP gene was also driven to express. These results demonstrate that the soybean bidirectional promoter SXPRO10 can simultaneously drive the expression of both the RUBY and GFP genes in tobacco.

[0025] (4) Verify the function of the soybean bidirectional promoter using the soybean hairy root transformation system. ① The recombinant vector PTF101-GFP-SXPRO10-RUBY was transformed into competent Agrobacterium rhizogenes K599 cells (from the Institute of Crop Science, Chinese Academy of Agricultural Sciences) by electroporation to obtain recombinant Agrobacterium, which was named K599-PTF101-GFP-SXPRO10-RUBY.

[0026] ② Induction of hairy roots by puncture method: First, take plump and uniform soybean seeds of variety Jack (from the Institute of Crop Science, Chinese Academy of Agricultural Sciences) that are free from diseases, pests and spots, and plant them in nutrient soil. Cultivate them for 7 days at 28℃ under 16 hours of light / 8 hours of darkness.

[0027] ③ Preparation of bacterial culture: Take a small amount of the preserved hairy rhizome culture carrying the target vector and add it to 20 mL of YEP liquid medium containing the corresponding antibiotic. Incubate overnight at 28°C with shaking to complete the first activation of the bacterial culture. Add the first activated bacterial culture to fresh medium containing the corresponding antibiotic at a ratio of 1 / 1000 and incubate at 28°C with shaking until the OD600 value is about 0.6-0.8 to complete the second activation of the bacterial culture.

[0028] ④ Using a 1mL syringe, inject K599-PTF101-GFP-SXPRO10-RUBY into the hypocotyl. Cover the pot with a transparent plastic bag to keep it moist. Culture at 28℃ for 15 days under 16 hours of light / 8 hours of darkness until roots develop. Then test the results.

[0029] Depend on Figure 3 As can be seen, untransformed soybean hair roots are white, while positive hair roots transformed with Agrobacterium tumefaciens PTF101-GFP-SXPRO10-RUBY show a magenta color resembling betaine, indicating that SXPRO10 drives the expression of the RUBY gene. Subsequently, this invention uses a stereomicroscope equipped with a fluorescence excitation module (Nikon INTENSILIGHT C-HGFI) to identify the GFP signal. It was found that hair roots expressing the RUBY gene emitted green fluorescence under excitation light, indicating that the GFP gene was also driven to express. These results demonstrate that the soybean bidirectional promoter SXPRO10 can simultaneously drive the expression of both the RUBY and GFP genes in soybean.

[0030] Example 2: Bidirectional promoters drive the coordinated expression of multiple genes in plants (1) Construction of bidirectional promoter-mediated multi-gene expression vectors ① Soybean codon bias optimization was performed on genes BnC3'H1, AnNPGA, NnH3H-v2, NnLuz-v4, NnCPH, and McitHispS (for related gene information, please refer to the literature Zheng, P., et al. (2023). Metabolic engineering and mechanical investigation of enhanced plant autoluminescence. Plant Biotechnology Journal 21, 1671-1681.).

[0031] ② Genes BnC3'H1, AnNPGA, and NnH3H-v2 were synthesized and tandemly linked by a P2A linker peptide. NcoI and StuI restriction sites were introduced at both ends of the entire sequence. The PTF101-GFP-SXPRO10-RUBY vector was digested with NcoI and StuI, and the tandem genes were then ligated to the SXPRO10 promoter. Simultaneously, genes NnLuz-v4, NnCPH, and McitHispS were synthesized and tandemly linked by a P2A linker peptide, with XbaI and HpaI restriction sites introduced at both ends. After XbaI and HpaI digestion of the vector, the tandem genes were ligated to the SXPRO10 promoter. The final bidirectional promoter-mediated multi-gene expression vector was named FAGUANG (see [link to FAGUANG]). Figure 4 ).

[0032] (2) Detection of multi-gene expression levels mediated by bidirectional promoters To verify the ability of the SXPRO10 promoter to drive the simultaneous expression of six genes, this invention first conducted experiments using a tobacco transient expression system. The recombinant vector FAGUANG was transformed into competent Agrobacterium tumefaciens GV3101 cells (containing PSoup-P19, Shanghai Weidi Biotechnology Co., Ltd., catalog number AC1003L) using a freeze-thaw method to construct recombinant Agrobacterium GV3101-FAGUANG. Using a blank vector as a control, tobacco was infected with Agrobacterium by injection according to the method described in Example 1 (3). After 24 hours of darkness, the cells were transferred to a 25°C greenhouse for 48 hours of incubation. Leaf samples were collected, and total RNA was extracted using the FastPure Universal Plant Total RNA Isolation Kit (Nanjing Novizan Biotechnology Co., Ltd., RC411-01). Reverse transcription was performed using the HiScript III All-in-one RT SuperMix Perfect for qPCR (Nanjing Novizan Biotechnology Co., Ltd., R333-01). NnActin was used as an internal control gene, and quantitative real-time PCR was performed using the ChamQ Universal SYBR qPCR Master Mix (Nanjing Novizan Biotechnology Co., Ltd., Q711-03). Results showed that the expression of BnC3'H1, AnNPGA, NnH3H-v2, NnLuz-v4, NnCPH, and McitHispS genes was almost undetectable in the control group transformed with the blank vector, while the SXPRO10 promoter effectively drove the co-expression of all six genes (see...). Figure 5 A).

[0033] To further verify the ability of the SXPRO10 promoter to drive the co-expression of six genes in soybean, the recombinant vector FAGUANG was transformed into Agrobacterium rhizogenes K599 competent cells to construct recombinant Agrobacterium K599-FAGUANG. Using K599 cells transformed with the blank vector as a control, soybean hairy root genetic transformation was performed according to the method in Example (4). Positive hairy roots were sampled, and quantitative real-time PCR was performed according to the method in Example 2 (2). The results showed that in the control group hairy roots transformed with the blank vector, the expression of BnC3'H1, AnNPGA, NnH3H-v2, NnLuz-v4, NnCPH, and McitHispS genes was almost undetectable; while the SXPRO10 promoter could effectively drive the co-expression of the above six genes in soybean hairy roots (see Example 2). Figure 5 B).

[0034] Example 3: A method that can simultaneously and significantly upregulate the expression levels of six or more genes (1) Construction of recombinant vectors for bidirectional promoter-mediated upregulation of multiple gene expression First, the ZQ6 sequence (nucleotide sequence shown in SEQ ID NO.4) was synthesized and integrated into both ends of the promoter of the FAGUANG vector SXPRO10, specifically between the StuI / SacI restriction sites and between the XbaI / SpeI restriction sites, to construct the intermediate vector SXPRO10-ZQ6-FAGUANG. Subsequently, the 35S:MdMYB10 expression cassette sequence (SEQ ID NO.5) was synthesized, and AscI and PmeI restriction sites were introduced at both ends of this sequence. Using double digestion and ligation techniques, the above expression cassette sequence was inserted into the SXPRO10-ZQ6-FAGUANG vector, finally completing the construction of the recombinant vector SXPRO10-ZQ6-FAGUANG-MdMYB10. Figure 6 ).

[0035] (2) Detection of gene expression levels To verify whether the bidirectional promoter SXPRO10, after binding with ZQ6 and MdMYB10 elements, has the ability to simultaneously upregulate the expression levels of multiple genes, this invention first conducted experiments using a tobacco transient expression system. Using a blank vector as a control, Agrobacterium tumefaciens GV3101-FAGUANG, GV3101-SXPRO10-ZQ6-FAGUANG, and GV3101-SXPRO10-ZQ6-FAGUANG-MdMYB10, which had been respectively introduced into each recombinant vector, was used to inject tobacco with Agrobacterium tumefaciens according to the method in Example 1 (3). After 24 hours of darkness, the infected tobacco was transferred to a 25°C greenhouse for 48 hours of cultivation; subsequently, leaf samples were collected, and the expression levels of the target genes were analyzed according to the detection method in Example 2 (2). Experimental results showed that when the bidirectional promoter SXPRO10 was coupled with ZQ6 sequences at both ends, the expression levels of the six target genes driven by it did not show significant differences; however, when the SXPRO10 promoter was coupled with ZQ6 sequences at both ends, and the 35S:MdMYB10 expression cassette was simultaneously introduced into the vector, the expression levels of the six genes BnC3'H1, AnNPGA, NnH3H-v2, NnLuz-v4, NnCPH, and McitHispS were all significantly upregulated (see [link to experimental results]). Figure 7 A). In addition to the efficient synergistic expression of the above six genes, the Bar gene and the MdMYB10 gene can also be stably expressed, and this vector can simultaneously mediate the efficient expression of eight genes.

[0036] The results of this invention show that no significant self-luminescence was observed in the material sites transformed with the FAGUANG or SXPRO10-ZQ6-FAGUANG supports under dark conditions; however, the sites transformed with the SXPRO10-ZQ6-FAGUANG-MdMYB10 support exhibited significant self-luminescence under dark conditions (see...). Figure 7 B).

[0037] The above results demonstrate that this invention can drive the synergistic expression of the six genes using only the bidirectional promoter SXPRO10, without the need to construct separate expression cassettes for each gene. Furthermore, combining the ZQ6 sequence with the 35S:MdMYB10 expression cassette successfully achieved significant synergistic upregulation of the six genes, confirming that this method can be used to create self-luminous plants.

[0038] In summary, the combination of the soybean bidirectional promoter SXPRO10 with the ZQ6 sequence and the 35S:MdMYB10 expression cassette can effectively mediate a significant and synergistic upregulation of the expression levels of six or more genes.

[0039] The nucleotide sequences involved in this invention are shown below: (1) Soybean bidirectional promoter SXPRO10: (2) ZQ6: GTTAGACTGGTAGCTATTAACAAGTTAGACTGGTTAGACTGGTAGCTATTAACAAGTTAGACTGGTAGCTATTAACAACTGGTAGCTATTAACAAGTTAGACTGGTAGCTATTAACAAGTTAGACTGTGTGTGTGTGTGTATTTCACAAGTTAGACTGGTAGCTATTAACAA (SEQ ID NO.4); (3) 35S: MdMYB10 expression cassette sequence:

[0040] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A soybean bidirectional promoter SXPRO10, characterized in that, The nucleotide sequence of the soybean bidirectional promoter SXPRO10 is shown in SEQ ID NO.

1.

2. A recombinant vector containing the soybean bidirectional promoter SXPRO10 as described in claim 1, characterized in that, The recombinant vector also includes the ZQ6 enhancement sequence and the 35S:MdMYB10 expression cassette.

3. The recombinant vector according to claim 2, characterized in that, The nucleotide sequence of the ZQ6 enhancement sequence is shown in SEQ ID NO.4; the nucleotide sequence of the 35S:MdMYB10 expression cassette is shown in SEQ ID NO.

5.

4. The method for constructing the recombinant vector according to claim 2 or 3, characterized in that, Includes the following steps: (1) The vectors PTF101-GFP-RUBY and Blunt-Zero-SXPRO10 were double-digested with restriction endonucleases SpeI and NcoI, respectively, and the target fragments were recovered by gel electrophoresis. (2) The target fragment obtained in step (1) was ligated using T4 DNA ligase and then transformed into E. coli to obtain the recombinant expression vector PTF101-GFP-SXPRO10-RUBY; (3) The ZQ6 enhancement sequence was integrated into both ends of the SXPRO10 promoter of the PTF101-GFP-SXPRO10-RUBY vector to obtain the intermediate vector SXPRO10-ZQ6-FAGUANG; (4) AscI and PmeI restriction sites were introduced at both ends of the 35S:MdMYB10 expression cassette sequence, and then double-digested with restriction endonucleases AscI and PmeI. The digested 35S:MdMYB10 expression cassette sequence was inserted into the SXPRO10-ZQ6-FAGUANG vector using T4 DNA ligase to obtain the cassette.

5. The use of the recombinant vector according to claim 2 or 3 in driving the expression of the target gene in plants.

6. A method for driving the expression of a target gene in a plant, characterized in that, Includes the following steps: (1) Construct a recombinant vector using the method of claim 4, and then perform double enzyme digestion; (2) The target gene is tandemly linked by a P2A linker peptide, and restriction enzyme sites are introduced at both ends of the target gene sequence, followed by restriction enzyme digestion. (3) The enzyme digestion products from step (2) are respectively ligated to the front and back ends of the SXPRO10 promoter of the recombinant vector from step (1); (4) After transferring the product obtained in step (3) into Agrobacterium tumefaciens by freeze-thaw method, Agrobacterium tumefaciens is injected into the plant to infect it.

7. The use of the recombinant vector according to claim 2 or 3 in improving plant traits, cultivating transgenic plants, or cultivating new plant varieties.

8. A method for preparing luminescent tobacco, characterized in that, Includes the following steps: (1) The BnC3'H1, AnNPGA and NnH3H-v2 genes were tandemly linked by the P2A linker peptide, and then NcoI and StuI restriction sites were introduced at both ends of the tandem sequence, respectively; after double digestion of the PTF101-GFP-SXPRO10-RUBY vector with NcoI and StuI, the tandem gene was linked to the SXPRO10 promoter front end of the PTF101-GFP-SXPRO10-RUBY vector; (2) The NnLuz-v4, NnCPH and McitHispS genes were tandemly linked by the P2A linker peptide, and then XbaI and HpaI restriction sites were introduced at both ends of the tandem sequence, respectively; after double digestion of the PTF101-GFP-SXPRO10-RUBY vector with XbaI and HpaI, the tandem gene was linked to the SXPRO10 promoter end of the PTF101-GFP-SXPRO10-RUBY vector; (3) The recombinant vector obtained in step (3) is transferred into Agrobacterium tumefaciens by freeze-thaw method and then used to infect tobacco to obtain the product.

Citation Information

Patent Citations

  • Method for constructing soybean chromosome loss induction line and method for inducing haploid or aneuploid in soybean

    CN118048363A

  • Soybean bidirectional promoter and application thereof

    CN120796272A

  • Application of bi-directional promoters for modification of gene expression

    US20020108142A1