Gene for regulating and controlling fish growth, application and regulating and controlling method

Abstract

The invention belongs to the technical field of aquaculture biological growth, and particularly relates to a gene for regulating fish growth, application and a regulating method. The gene for regulating the growth of the grass carp is a myogenesis inhibition gene mdfi of a myogenesis regulatory factor (MRFs) family; the base sequence of the gene is shown in SEQ ID NO: 1. The invention discloses a method for promoting proliferation of fish muscle cells. The expression level or protein activity of mdfi genes in grass carp muscle cells is inhibited. The inhibiting effect of the mdfi gene in the muscle growth of the grass carp is systematically clarified for the first time, the individual growth of the grass carp can be effectively promoted by establishing an mdfi gene knockout technology, and a new technical means and a new gene target are provided for the genetic breeding of the grass carp.

Description

Technical Field

[0001] This invention belongs to the field of aquaculture biological growth technology, specifically relating to a gene that regulates fish growth, its application, and a regulation method. Background Technology

[0002] grass carp( Ctenopharyngodon idella Fish protein is one of the core germplasm resources for freshwater aquaculture in my country, and its yield is directly related to the supply of aquatic protein and economic benefits. In order to meet the growing market demand for high-quality fish protein, genetic improvement of the key trait of muscle growth has become an urgent goal for the industry's development.

[0003] Muscle growth is a core physiological process shared by multiple species, and related research has been extensively conducted in various groups such as mammals, birds, and fish. Currently, a series of key factors directly involved in the regulation of muscle growth have been reported, including the insulin-like growth factor (IGF) family, myostatin (MSTN), and myogenic regulatory factors (MRFs) family. These factors collectively constitute a complex regulatory network for muscle growth through different pathways, such as promoting myocyte proliferation and differentiation, inhibiting excessive growth, or regulating myocyte fate. However, the upstream genes of MRFs... mdfi Research on (MyoD family inhibitors) is limited, and their function varies significantly across different species. Interference at the in vivo level in mice has been reported. mdfi It can promote muscle hypertrophy; and overexpression in porcine muscle cells mdfi This manifests as promoting skeletal muscle satellite cell proliferation and inhibiting differentiation, showing significant species differences in function compared to mouse experiments. Therefore, it is impossible to determine the effect of this on skeletal muscle satellite cells based on known mammalian observations. mdfi Gene research speculates mdfi The function of genes in fish.

[0004] Fish, as aquatic vertebrates, exhibit both common vertebrate characteristics and unique features due to their adaptation to the aquatic environment, leading to a later start in related research compared to mammals. Early studies focused primarily on the cloning and expression profiling of muscle growth-related genes. Recent research has gradually shifted towards functional validation of specific genes. For example, it is clear that the IGF family promotes myocyte proliferation and differentiation in grass carp, and the mechanism by which MSTN, as a negative regulator, inhibits muscle growth in grass carp has been validated. The MRF family, as core transcription factors directly regulating myocyte differentiation and myofiber formation, is known to include members such as myod, myf5, myog, and mrf4. However, some members of this family exhibit functional redundancy or differentiation. Based on current research, it is still impossible to definitively determine which members truly participate in muscle growth regulation. Furthermore, the regulatory network of muscle growth and development is complex and intricate, and current research has not yet systematically revealed its key inhibitory factors and overall pathways of action. Summary of the Invention

[0005] The purpose of this invention is to provide a gene for regulating fish growth, its application, and a method for regulation.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A gene that regulates fish growth; the gene regulating grass carp growth is a grass carp myogenesis regulator (MRF) gene. mdfi Gene; its base sequence is shown in SEQ ID NO:1.

[0007] SEQ ID NO:1: .

[0008] The application of the genes regulating fish growth, specifically the grass carp. mdfi Application of genes in regulating muscle growth in grass carp.

[0009] The grass carp mdfi Application of gene repression in promoting grass carp muscle cell proliferation.

[0010] The grass carp mdfi The use of genes or the proteins they encode as targets for promoting muscle growth.

[0011] A method to promote the proliferation of fish muscle cells and inhibit the proliferation of grass carp muscle cells. mdfi Gene expression levels or protein activity.

[0012] Introducing into the muscle cells of grass carp mdfi Gene inhibitors or knockout mdfi Gene.

[0013] The inhibitor is a targeted inhibitor. mdfi One of the gene's siRNA, shRNA, or sgRNA.

[0014] The siRNA has a sense strand (5'→3') of UCGUCGUCGUCCUCAUCUU (SEQ ID NO:2) and an antisense strand (5'→3') of AAGAGAGGACGACGACGA (SEQ ID NO:3). sgRNA is mG*mC*mA*CGAUGUUGCACAGUGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGGCU*mU*mU*mU (SEQ ID NO: 4).

[0015] The knockout was based on the CRISPR-Cas9 system to knock out grass carp. mdfi Gene.

[0016] The knockout mdfi Application of genetically modified grass carp in breeding new grass carp strains with faster growth rates.

[0017] This invention is the first to utilize the key upstream repressor of MRFs. mdfi The expression pattern and functional application of the (myod family inhibitor) gene in grass carp have been clarified, demonstrating its role and efficacy for the first time; that is, it is the first time that the myod family inhibitor gene has been discovered in grass carp. mdfi The gene negatively regulates muscle growth. Experiments show that overexpression... mdfi The gene significantly inhibits grass carp muscle cell proliferation and myod protein synthesis; conversely, knocking down the gene using RNA interference technology significantly promotes grass carp muscle cell proliferation and myod protein synthesis. In particular, this is the first time that CRISPR-Cas9 gene editing technology has been used to knock down the gene. mdfi The application of genes to promote the growth of grass carp. Attached Figure Description

[0018] Figure 1 grass carp mdfi In vitro gene amplification gel image.

[0019] Figure 2 grass carp mdfi Genes mdfi -N1 carrier structure diagram.

[0020] Figure 3 for mdfi Expression profiles in various tissues of three-month-old and one-year-old grass carp.

[0021] Figure 4 For overexpression mdfi Effects on grass carp muscle cell proliferation (EdU assay).

[0022] Figure 5 For overexpression mdfi Effects on myod protein expression (immunofluorescence).

[0023] Figure 6 To verify siRNA interference mdfi Efficiency of expression.

[0024] Figure 7 For interference mdfi Effects on grass carp muscle cell proliferation (EdU assay).

[0025] Figure 8 For interference mdfi Effects on myod protein expression (immunofluorescence).

[0026] Figure 9 for mdfi Sequencing peak comparison between knockout grass carp and control grass carp.

[0027] Figure 10 Two months old mdfi Comparison of grass carp that were knocked out and control grass carp. Detailed Implementation

[0028] The technical solution of the present invention will be further described in detail with reference to the following specific examples. For specific experimental conditions not specified in the implementation scheme, they shall be carried out according to conventional conditions or conditions recommended in the manufacturer's instructions.

[0029] Example 1 This embodiment clones from grass carp muscle tissue. mdfi The full-length CDS of the gene was ligated into the PEGFP-N1 vector. Total RNA was extracted from the dorsal muscle tissue of three-month-old healthy grass carp using the TRIzol method. After genomic DNA contamination was removed by DNase I digestion, cDNA templates were obtained by reverse transcription using HiScript III RT Supermix for qPCR (Novozymes). The cDNA template was then obtained from the grass carp database of NCBI. mdfiGene reference sequence (GenBank accession number: XM_051913475.1), design specific primers: mdfi -F: 5'- ctaGCTAGCatgtccaaggaggac-3' (containing NheⅠ restriction site); mdfi -R: 5'-gcGTCGACtcaggaggaaaagca-3' (containing SalⅠ restriction site).

[0030] The PCR reaction used high-fidelity enzyme 2 × Phanta Max Master Mix (Dye Plus), and the amplification program was: 98℃ pre-denaturation for 3 min; 95℃ for 10 s, 60℃ for 30 s, 72℃ for 1 min, for a total of 35 cycles; extension at 72℃ for 10 min. Figure 1 The amplified products shown were verified by agarose gel electrophoresis and then purified using a gel extraction kit.

[0031] The purified PCR product and pEGFP-N1 vector were double-digested with NheⅠ and SalⅠ, respectively, and ligated overnight at 16℃ using T4 DNA ligase. The ligation product was transformed into DH5α competent cells, and positive clones were selected for colony PCR identification using universal primers for the vector. After sequencing verification of the positive recombinant plasmid, it was extracted in large quantities using an endotoxin-free plasmid large-scale extraction kit to obtain the recombinant expression vector. mdfi -N1. For example... Figure 2 The final constructed carrier shown contains mdfi Complete CDS area (blue highlighted part, 774bp).

[0032] Example 2 This embodiment used three biological replicates each of three-month-old and one-year-old grass carp (n = 3). After being temporarily held in the recirculating aquaculture system for 5 days, multiple tissue samples were taken from each fish: (1) Spleen, liver, intestine, muscle, gills, skin, eye, heart and brain tissue were collected from the three-month-old group; (2) Spleen, liver, intestine, muscle, gill, skin, eye, heart and adipose tissue were collected from one age group.

[0033] All tissue samples were immediately flash-frozen in liquid nitrogen after being removed from the body and then transferred to an ultra-low temperature freezer at -80°C for long-term storage.

[0034] Total RNA was extracted from tissues using the TRIzol method (Novozymes), and genomic DNA contamination was removed by DNase I digestion. 1 μg of total RNA was used for reverse transcription, and the resulting cDNA was stored at -20°C for later use.

[0035] The qPCR-specific primers are designed as follows: Internal reference gene β-actin: β-actin-qR-F: 5'-GGCTGTGCTGTCCCTGTA-3' (SEQ ID NO: 5) β-actin-qR-R: 5'-GGGCATAACCCTCGTAGAT-3' (SEQ ID NO: 6) Target gene mdfi : mdfi -qR-F: 5'-GACCCATGCCCAGTAGGGAA-3' (SEQ ID NO:7) mdfi -qR-R: 5'-GTGAGGTCTGGTTGGGACAG-3' (SEQ ID NO: 8).

[0036] One sample from each tissue was selected for qPCR primer validation. In qPCR reactions using cDNA from nine tissues as templates, the melting curves of both primers were single-peaked, and the Tm values ​​were all between 83℃ and 85℃. The qPCR reactions used the SYBR Green method, with three technical replicates per sample, using β-actin as an internal control and gill tissue as a reference. -ΔΔCt The relative expression level was calculated using this method. The results are as follows: Figure 3 As shown, the muscle tissue of grass carp at different ages... mdfi The expression level is moderate in a variety of tissues.

[0037] Example 3 This embodiment uses an EdU detection kit for detection. mdfi The effect of overexpression on the proliferation capacity of grass carp myocytes. A commercial grass carp myocyte cell line (…) was used. Ctenopharyngodon idella Experiments were conducted using the Muscle Cell Line. Cells were cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FeBCO) and 1% triple antibodies (penicillin-streptomycin-amphotericidal), and cultured at 28°C with 5% CO2. When the cell density reached 70-80% confluence, overexpression was performed using the Lipo8000™ transfection reagent to transfect the cells obtained in Example 1. mdfiThe -N1 overexpression vector and the empty pEGFP-N1 vector (N1) were transfected into the cultured cells described above, with three biological replicates. Six hours after transfection, the medium was replaced with complete medium for further culturing. Twenty-four hours after transfection, cell proliferation was analyzed using the Beyotime EdU assay kit. Cells were incubated with 50 μM EdU working solution for 4 hours, fixed with 4% paraformaldehyde, and then subjected to Click reaction (Alexa Fluor 488 labeling) and DAPI nuclear staining. Finally, five fields of view were randomly selected for cell counting using a fluorescence microscope. The experimental results are as follows: Figure 4 The results showed that, compared with the empty vector control group, mdfi The EdU positivity rate in the overexpression group was significantly reduced by approximately 50% (P<0.01), indicating that... mdfi Overexpression can significantly inhibit the proliferation of grass carp muscle cells.

[0038] Example 4 This embodiment uses immunofluorescence technology for detection. mdfi Effect of overexpression on myod protein expression in grass carp muscle cells. The experiment used grass carp muscle cell lines obtained by transfection with Lipofectamine 8000 as described in the above examples. mdfi The N1 overexpression plasmid and pEGFP-N1 vector (N1) were transfected into the cultured cells described above, and the experiment was performed in triplicate. After 24 hours, cells were fixed and permeabilized: fixed in 4% paraformaldehyde at room temperature for 15 minutes, permeabilized in 0.1% Triton X-100 for 10 minutes, and washed three times with PBS. Rabbit anti-myod polyclonal antibody (Tri-Engine, 1:200 dilution) was used as the primary antibody, and the cells were incubated overnight at 4°C; CoraLite® Plus 594-labeled goat anti-rabbit IgG (RGAR004, 1:200 dilution) was used as the secondary antibody, and the cells were incubated at room temperature in the dark for 1 hour. Cell nuclei were stained with DAPI (1 μg / mL) for 10 minutes. Images were acquired using a fluorescence microscope, such as... Figure 5 As shown, compared with the transfected empty vector group and the control group, overexpression mdfi The immunofluorescence signal intensity of myod decreased by approximately 54%, indicating that mdfi Overexpression inhibited the synthesis of myod protein.

[0039] Example 5 This embodiment uses small interfering RNA (siRNA) technology to knock down... mdfi Gene expression.

[0040] Targeted transfection using Zeta transfection reagent mdfi siRNA (si- mdfiThe three siRNAs (si-nc) and negative control siRNAs were transfected into the cells to verify the knockdown efficiency. The sequences are shown in Table 1. The experimental method is the same as described in Example 3.

[0041] Table 1 siRNA sequences

[0042]

[0043] Verification of low efficiency can be achieved as follows Figure 6 The results showed that, compared to the group transfected with si-nc, only the group transfected with si-nc... mdfi -2 showed a significant knockdown effect. Subsequent knockdown experiments all involved transfection with si- mdfi -2.

[0044] Example 6 This embodiment uses small interfering RNA (siRNA) technology to knock down... mdfi Gene expression. Detection. mdfi The effect of knockdown on the proliferation capacity of grass carp muscle cells was investigated using the same experimental method as described in Example 3.

[0045] Experimental results are as follows Figure 7 The results showed that, compared with the control group, mdfi The EdU positivity rate in the interference group was significantly increased by approximately 36% (P<0.01), indicating inhibition. mdfi Gene expression can significantly promote the proliferation of grass carp muscle cells.

[0046] Example 7 This embodiment uses small interfering RNA (siRNA) technology to knock down... mdfi Gene expression was investigated to study its effect on myod protein in grass carp muscle cells. The target gene was expressed using Zeta transfection reagent. mdfi siRNA (si- mdfi The siRNA and negative control siRNA (si-nc) were transfected into the cells, and the experimental method was the same as described in Example 4.

[0047] like Figure 8 As shown, compared with the control group, the interference mdfi The immunofluorescence signal intensity of myod increased significantly by 103%, indicating inhibition. mdfi Expression can promote the synthesis of myod protein.

[0048] Example 8 Knockout of grass carp using CRISPR-Cas9 technology mdfi Genetic, specifically including: targeting grass carp mdfi Gene exon-specific sgRNA design: mG*mC*mA*CGAUGUUGCACAGUGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGGCU*mU*mU*mU (SEQ ID NO: 17).

[0049] The obtained sgRNA was synthesized via in vitro transcription and mixed with Cas9 mRNA at a ratio of 1.2:1 (v / v). The mixture was then microinjected at a rate of 200 μL into grass carp fertilized eggs. After microinjection, 189 eggs emerged from the membrane, with 44 surviving, resulting in a survival rate of 23.2%. On the third day after fertilization, four samples were randomly collected. A special primer pair was designed: mdfi -KO-F:5'-TGCAGTCGAACCCATCCATC-3' (SEQ ID NO:18) mdfi -KO-R: 5'-CGACAACTAACCCTGCTCCT-3' (SEQ ID NO: 19).

[0050] like Figure 9 The F0 generation with missing fragments was obtained through PCR and sequencing verification, as shown.

[0051] like Figure 10 As shown, compared with the wild type, the 3-month-old mutant had a significantly increased body length of 39.2% (7.1 cm vs 5.1 cm) and a significantly increased weight of 97.1% (3.45 g vs 1.75 g). These results indicate that knockout... mdfi Genes can effectively promote the growth of grass carp's body length and weight, significantly improving its growth performance.

[0052] In conclusion, regarding grass carp... mdfi Gene suppression can promote muscle growth in grass carp, while simultaneously establishing... mdfi Gene knockout technology to knock out the gene in grass carp mdfi Genes can effectively promote the growth of grass carp individuals. It is evident that this invention provides solid experimental evidence and a feasible technical path for cultivating new high-yield and fast-growing grass carp strains, and has important application value for fish genetic breeding.

Claims

1. A gene that regulates fish growth, characterized in that: The genes that regulate the growth of grass carp are myogenic inhibitory genes of the MRF family of myogenic regulators. mdfi Its base sequence is shown in SEQ ID NO:

1.

2. The application of the gene regulating fish growth according to claim 1, characterized in that: grass carp mdfi Application of genes in regulating muscle growth in grass carp.

3. The application of the gene regulating fish growth according to claim 2, characterized in that: grass carp mdfi Application of gene repression in promoting grass carp muscle cell proliferation.

4. The application of the gene regulating fish growth according to claim 1, characterized in that: grass carp mdfi The use of genes or the proteins they encode as targets for promoting muscle growth.

5. A method for promoting the proliferation of fish muscle cells, characterized in that, Inhibit grass carp muscle cells mdfi Gene expression levels or protein activity.

6. The method for promoting fish muscle cell proliferation according to claim 5, characterized in that, Introducing into the muscle cells of grass carp mdfi Gene inhibitors or knockout mdfi Gene.

7. The method for promoting fish muscle cell proliferation according to claim 6, characterized in that, The inhibitor is a targeted inhibitor. mdfi One of the gene's siRNA, shRNA, or sgRNA.

8. The method for promoting fish muscle cell proliferation according to claim 7, characterized in that, The siRNA has a sense strand 5'→3' of UCGUCGUCGUCCUCAUCUU and an antisense strand 5'→3' of AAGAGAGGACGACGACGA. sgRNA is mG*mC*mA*CGAUGUUGCACAGUGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGUGCU*mU*mU*mU.

Images