Method for improving recombination efficiency of denitrifying hyphomicrobe and application

Abstract

The invention provides a method for improving the recombination efficiency of denitrifying hyphomicrobe and application, and belongs to the technical field of gene engineering. On the basis of a pK18mobsacB-Tc vector, a vector capable of simultaneously expressing exonuclease-recombinase and upstream and downstream homologous arms of a target gene is constructed, the vector is transformed into denitrifying hyphomicrobe for homologous recombination, mediation of other plasmids is not needed, traceless knockout of the target gene can be completed only through one round of transformation, and the method is simple and convenient to operate. Compared with existing gene knockout plasmids and transformation methods of denitrifying hyphomicrobe, the method is more efficient. Experiments prove that when the vector is used for constructing a denitrifying hyphomicrobium engineering strain, compared with plasmids without recombinase, the number of recombinants is remarkably increased, and the vector has the characteristics of simplicity, convenience and high efficiency.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method and application for improving the recombination efficiency of denitrified filamentous microorganisms. Background Technology

[0002] Microbial metabolites are characterized by structural diversity and significant biological activity, making them an important source of pharmaceuticals and health products. Pyrroloquinoline quinone (PQQ) is an aromatic ortho-quinone compound that exists in living organisms in three forms: quinone (PQQ), semi-quinone (PQQ+), and hydroquinone (PQQH2), depending on the binding of electrons and hydrogen ions. These forms can interconvert through electron and lipid transfer. PQQ is widely found in various common foods in nature, including fruits, vegetables, grains, and beverages, such as natto, parsley, green tea, green peppers, kiwifruit, and papaya. As a coenzyme, PQQ participates in the catalytic reactions of certain redox enzymes in the body. It has functions such as scavenging free radicals, protecting the body from oxidative damage, and stimulating cell growth, exhibiting physiological functions similar to vitamins and being an essential vitamin and nutrient for the human body.

[0003] Polyurethane (PQQ) has wide applications in the food, animal production, pharmaceutical, and plant sectors. Industrially, PQQ is typically produced through chemical methods and microbial fermentation. my country approved PQQ produced by chemical synthesis and fermentation as new food ingredients in 2022 (No. 1) and 2023 (No. 8), respectively. Compared to chemical synthesis, microbial fermentation offers advantages such as being more environmentally friendly, lower cost, and producing more natural products, making it the primary method for industrial production. Known microorganisms capable of producing PQQ include *Acinetobacter calcitrinum*, *Klebsiella pneumoniae*, *Glucosamine oxidans*, *Methylformobacterium flagellates*, *Methylformobacterium thuringiensis*, *Microbes filamentosa*, and *Methyl-eating bacteria*, among which *Microbes filamentosa* is the most commonly used and has the highest yield. While PQQ shows promising application prospects, its development faces numerous challenges, including low yield, complex separation systems, and difficulties in large-scale preparation.

[0004] Chinese invention patent application CN117946900A, published on April 30, 2024, discloses a denitrifying filamentous microorganism HRY-0816 and a method for fermenting pyrroloquinoline quinone. The disclosed high-yield denitrifying filamentous microorganism HRY-0816 for fermenting pyrroloquinoline quinone is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.28206. This denitrifying filamentous microorganism has a high methanol conversion rate, good potency, and good metabolic stability.

[0005] Chinese invention patent application document with publication date of July 1, 2025 and publication number CN120230685A discloses a denitrifying filamentous microbacterium JCSS230201 and its application in the production of pyrroloquinoline quinone. The denitrifying filamentous microbacterium JCSS230201 is a naturally high-yielding strain of pyrroloquinoline quinone, which can efficiently produce pyrroloquinoline quinone in a culture medium containing only methanol and inorganic salts without the need for complex control processes.

[0006] While existing technologies have identified denitrifying filamentous microorganisms with high PQQ yields, the promising application prospects and significant market demand for PQQ necessitate further improvements in its production efficiency to accelerate the large-scale industrial production of PQQ via microbial fermentation. Utilizing synthetic biology techniques to elucidate the mechanisms of metabolite synthesis and regulation at the molecular level can lay a solid foundation for increasing the yield of natural microbial metabolites. Therefore, constructing vectors suitable for the genetic modification of denitrifying filamentous microorganisms and establishing efficient genetic transformation systems for these strains are crucial underlying technologies for studying PQQ biosynthesis.

[0007] In recent years, although genetic transformation methods have been reported for methyl-eating strains, the vectors and transformation methods suitable for gene modification of denitrifying filamentous microorganisms remain immature due to the significant differences in the restriction modification systems of different genera of methyl-eating microorganisms. Problems such as low integration efficiency and long transformation cycles persist. Therefore, constructing plasmids suitable for gene modification of denitrifying filamentous microorganisms and optimizing competent cell preparation and genetic transformation methods are of great significance for future molecular studies of the regulatory mechanism of the PQQ synthesis pathway and for improving its yield. Summary of the Invention

[0008] The first objective of this invention is to provide a method for improving the recombination efficiency of denitrified raw silk microorganisms, in order to solve the problem that the recombination efficiency of denitrified raw silk microorganisms needs to be improved in the prior art.

[0009] The second objective of this invention is to provide a method for improving the recombination efficiency of denitrifying filamentous microorganisms and its application in increasing the yield of pyrroloquinoline quinone, thereby providing engineered strains of denitrifying filamentous microorganisms with higher yields for the production of pyrroloquinoline quinone.

[0010] To achieve the above objectives, the technical solution adopted in this invention for improving the recombination efficiency of denitrifying raw silk microorganisms is as follows: A method for improving the recombination efficiency of denitrifying mycelial microbes includes the following steps: constructing a vector that simultaneously expresses a fusion fragment of an exonuclease-recombinase system, an upstream homologous arm of a target gene, and a downstream homologous arm of a target gene; transforming the vector into denitrifying mycelial microbes; and culturing and identifying the vector. The exonuclease-recombinase system is one of the RecET recombination system, the Orf47+Orf48 recombination system, or the OrfB+OrfC recombination system. The RecET recombination system includes the nucleotide sequence shown in SEQ ID NO.1; the Orf47+Orf48 recombination system includes the nucleotide sequence shown in SEQ ID NO.2; and the OrfB+OrfC recombination system includes the nucleotide sequence shown in SEQ ID NO.3.

[0011] The beneficial effects of the above scheme are as follows: This invention, a method for improving the recombination efficiency of denitrifying filamentous microorganisms, is a pioneering invention. Based on the pK18mobsacB-Tc vector, this invention constructs a vector that simultaneously expresses exonuclease-recombinase and the upstream and downstream homologous arms of the target gene. Transforming this vector into denitrifying filamentous microorganisms for homologous recombination does not require the mediation of other plasmids; only one round of transformation is needed to achieve traceless knockout of the target gene, which is more efficient than existing gene knockout plasmids and transformation methods for denitrifying filamentous microorganisms. Furthermore, experiments have shown that when constructing engineered strains of denitrifying filamentous microorganisms using this vector, the number of recombinants is significantly increased compared to plasmids without recombinase, demonstrating its simplicity and high efficiency.

[0012] As a further improvement, the length of the homologous arm is 600~1200bp.

[0013] As a further improvement, the length of the homologous arm is 800~1000bp.

[0014] As a further improvement, the vector also includes a constitutive promoter and a terminator for driving the exonuclease-recombinase system.

[0015] As a further improvement, the constitutive promoter is the glyceraldehyde-3-phosphate dehydrogenase promoter of *Glucosinolates methylglucosinolates*, with the nucleotide sequence shown in SEQ ID NO.4; the terminator is the terminator of the methanol dehydrogenase gene of *Denitrifying Mycorrhizal*, with the nucleotide sequence shown in SEQ ID NO.5.

[0016] As a further improvement, the target gene is a denitrifying filamentous microbe. hdrA Gene.

[0017] As a further improvement, the starting vector of the vector is the Corynebacterium glutamicum gene knockout vector pK18mobsacB.

[0018] As a further improvement, the conversion is to electroconversion, wherein the electroconversion conditions are an electric shock voltage of 2~2.5KV, 2~3 electric shocks, and incubation at 30~32℃ for 6~12h after the electric shock is completed.

[0019] As a further improvement, the conditions for the electroconversion also include a heat shock at 42-45°C for 2-2.5 minutes after the electric shock.

[0020] To achieve the above objectives, the technical solution adopted in this invention for improving the recombination efficiency of denitrifying microorganisms in increasing the yield of pyrroloquinoline quinone is as follows: An application of a method to improve the recombination efficiency of denitrifying filamentous microbes in increasing the yield of pyrroloquinoline quinone involves inserting the pyrroloquinoline quinone encoding gene between the upstream homologous arm and the downstream homologous arm of the target gene in the vector, followed by transformation into denitrifying filamentous microbes for pyrroloquinoline quinone expression.

[0021] The beneficial effects of the above scheme are as follows: This invention utilizes the above method to introduce the coding gene of pyrroloquinoline quinone into denitrifying filamentous microbes, achieving overexpression of genes in the pyrroloquinoline quinone (PQQ) gene cluster and increasing PQQ yield. This invention provides strong support for studying the gene function of denitrifying filamentous microbes and the biosynthetic regulation of their metabolite PQQ. Attached Figure Description

[0022] Figure 1 This is a flowchart illustrating the method for improving the recombination efficiency of denitrified filamentous microorganisms in Example 1 of the present invention (wherein, the exonuclease-recombinase system is the RecET recombination system, the tetracycline concentration is 15 μg / mL, and the sucrose concentration is 10%). Figure 2 This is a schematic diagram of the knockout vector containing exonuclease-recombinase constructed in Example 1 of the present invention; Figure 3 The recombination efficiency of different exonucleases-recombinases on double-stranded DNA in denitrifying mycelial microbes in Example 1 of this invention (wherein, homologous arm length is 500) is... hdrA The left and right homologous arms of the gene are used to test recombination efficiency; each experiment is performed in triplicate. Figure 4 This invention illustrates the effect of homologous arms of different lengths on the homologous recombination efficiency of the exonuclease-recombinase RecET in Example 2 (wherein, the lengths are 400bp, 600bp, 800bp, 1000bp, and 1200bp, respectively). hdrA - hyp The left and right homologous arms of the gene were used to test the effect on RecET homologous recombination efficiency; each experiment was performed in triplicate. Figure 5The effect of different electroporation conditions on the recombination efficiency of denitrified mycelial microbes in Example 3 of this invention (optimization of electroporation voltage, number of electroporations, heat shock, and incubation time parameters under the condition that the target gene homologous arm is 800bp, with three parallel groups for each group of experiments). Figure 6 The plasmid pK18mobsacB-Tc-RecET-Δ, transformed by the denitrifying silk-producing microorganism DSM1869 under optimal transformation conditions in Example 3 of this invention. hdrA Later hdrA Gene knockout process and verification (where A is a picture of the transformant; B is the verification of whether the tetracycline resistance gene is integrated into the genome after the first single crossover; C is the result after the second single crossover induced by sucrose). hdrA Does the coding region of the gene exist? Figure 7 The denitrifying silk-producing microorganisms in Example 4 of this invention hdrA Insert PQQ gene cluster at gene coding frame position ( pqqA-E The recombinant plasmid map of ). Detailed Implementation

[0023] Elucidating the mechanisms of metabolite synthesis and regulation at the molecular level using synthetic biology techniques can lay a solid foundation for increasing the yield of natural microbial metabolites. Therefore, modifying denitrifying filamentous microbes using synthetic biology techniques is one of the feasible pathways to increase the yield of pyrroloquinoline quinone (PQQ). However, the plasmids and transformation methods currently used for gene modification of denitrifying filamentous microbes are still immature, with problems such as low integration efficiency and long transformation cycles.

[0024] Extensive preliminary research revealed that in certain strains, homologous recombination of exogenous DNA can be achieved through the strain's own recombination system, thereby knocking out target genes. However, in denitrifying mycelia, due to limitations of the self-recombination system, the probability of homologous recombination is low in the absence of integrase-promoting enzymes. Therefore, this invention provides a method to improve the recombination efficiency of denitrifying mycelia. This invention utilizes exonuclease-recombinase to assist in the recombination of exogenous DNA, providing an effective method for the modification of denitrifying mycelia.

[0025] Existing technologies utilizing exonuclease-recombinase to assist in the recombination of exogenous DNA require first constructing a recombinant target bacterium expressing the exonuclease-recombinase system, followed by expression of a homologous recombination expression cassette to achieve target gene editing. However, this requires multiple selection markers, and tetracycline is the only antibiotic with good inhibitory effects against *Denitrifying Mycorrhizae*, making it difficult to achieve gene knockout through two-step transformation using multiple antibiotic selection markers. This invention discovers that simultaneously expressing the exonuclease-recombinase system, the upstream homologous arm of the target gene, and the downstream homologous arm fusion fragment in a single vector, followed by transformation of this vector into *Denitrifying Mycorrhizae*, can significantly improve the recombination efficiency of *Denitrifying Mycorrhizae*, while also reducing operational steps and shortening the cycle. This invention utilizes a constructed knockout plasmid containing the exonuclease-recombinase to achieve target gene knockout in a single, traceless transformation process (i.e., a method to improve the recombination efficiency of *Denitrifying Mycorrhizae*). Figure 1 As shown (the core of this invention lies in the modification of the PK18mobsacB vector, and the basic steps of gene knockout using PK18mobsacB are routine operations in the field and will not be described in detail here).

[0026] Phage-encoded homologous recombination systems (i.e., exonuclease-recombinase recombination systems) are effective tools for bacterial genome editing, but they have strict species-specific characteristics. This invention, through extensive research and experiments, has discovered that the RecET (Accession Number NP_415866) recombination system found in Rac prophage, the Orf47+Orf48 recombination system derived from phage (Protein ID: NP_463512.1, NP_463513.1), or systems derived from... Legionella pneumophila The OrfB+OrfC recombination system of *Legionella pneumophila* (Protein ID: CAC33454.1, CAC33455.1), and the vector constructed together with the homologous arm of the target gene, when transformed into denitrifying mycelia, significantly increased the number of recombinant transformants compared to denitrifying mycelia without an exonuclease-recombinase recombination system. To further improve the recombination efficiency of denitrifying mycelia, more preferably, the exonuclease-recombinase system is the RecET recombination system.

[0027] The present invention found that the length of the homologous arm of the target gene has a significant impact on the recombination efficiency of denitrifying mycelial bacteria. Preferably, the length of the homologous arm is 600~1200bp; in order to improve the recombination efficiency of denitrifying mycelial bacteria, more preferably, the length of the homologous arm is 800~1000bp.

[0028] This invention discovers that the conditions of electroconversion affect the recombination efficiency of denitrifying filamentous microbes. Preferably, the electroconversion conditions are an electro-electrolysis voltage of 2~2.5KV, 2~3 electro-electrolysis cycles, and incubation at 30~32℃ for 6~12h after electro-electrolysis. To further improve the recombination efficiency of denitrifying filamentous microbes, the electroconversion conditions are even more preferably an electro-electrolysis voltage of 2.5KV, 2 electro-electrolysis cycles, and incubation at 30℃ for 12h after electro-electrolysis.

[0029] The present invention found that applying heat shock at 42-45°C for 2-2.5 minutes after electric shock can further improve the recombination efficiency of denitrifying filamentous microorganisms; more preferably, applying heat shock at 42°C for 2 minutes after electric shock.

[0030] The present invention will be further described in detail below with reference to specific embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and comparative examples are commercially available.

[0031] The culture medium used in this invention is as follows: The methanol culture medium consists of: 0.5% (v / v) methanol, (NH4)2SO4 1.00 g / L, MgSO4·7H2O 0.20 g / L, NaH2PO4·H2O 0.50 g / L, K2HPO4 1.55 g / L, and trace elements in 0.2 mL (g / L): Na2-EDTA 50.00, ZnSO4·7H2O 22.00, CaCl2·2H2O 5.54, MnCl2·4H2O 5.06, FeSO4·7H2O 5.00, (NH4)6Mo7O 24 ·4H2O 1.10, CuSO4·5H2O 1.57, CoCl2·6H2O 1.61. Solid culture medium is prepared by adding 2% agar powder.

[0032] Methylamine salt medium: Replace 0.5% methanol in the methanol medium with 3.40 g / L methylamine hydrochloride.

[0033] Sucrose induction medium: 10% sucrose is added to methanol medium.

[0034] The primers and their nucleotide sequences used in the following embodiments of the present invention are shown in Table 1, specifically corresponding to SEQ ID NO.6~SEQ ID NO.41.

[0035] Table 1 Primers and their nucleotide sequences Primer Name Forward and Reverse Primers (5'→3') P-F AATCTGCCTGGCATCAAGCACGATGC P-R TTGTCTTTCCTTTCCCTGATAAAGAA pK18-Tc-F TTAAGGCAGTTATTGGTGCCCATGCGAGAGT pK18-Tc-R GGCACTGGCCGTCGTTTTACAACGT RecET-F TTTATCAGGGAAAGGAAAGACAAATGAGCACAAAACCACTCTTCCTG RecET-R CTAGCGAGGGCTTTACTAAGCTGAGCTCGGTACCCGGGGATCCT orfB+C-F TATCAGGGAAAGGAAAGACAAATGACAAAATTATGTTTTAGTG orfB+C-R TGGGCACCAATAACTGCCTTAATTATCCTGATTAGTTTCTTT orf47+48-F TTATCAGGGAAAGGAAAGACAAATGGCTATTGCAAAA orf47+48-R ATGGGCACCAATAACTGCCTTAATTAGATCATTGACCCTTGAACCT exo-bet-F TTATCAGGGAAAGGAAAGACAATAAGGAGGTAACGAATGAGTACTGCACTCGCAACGC exo-bet-R GGGCACCAATAACTGCCTTAATCATCGCCATTGCTCCCCAAATAC MDH-F CGATAATTCAGAGGAATAAACGCGCACCCCTTAAAGACCC MDH-R GCTGAGCTCGGTACCCGGGGATCCTCGCAGAAAATTCCATGCAAATA hdr500up-F TGTAAAACGACGGCCAGTGCCACCGGCGAAAGGTGGAATGTCG hdr500up-R TCGATGTTACGGCGCCGTAACGCTTGCAACCTCTTTCTCGATTTCGC hdr500do-F CGTTACGGCGCCGTAACATCGAA hdr500do-R CGTGCTTGATGCCAGGCAGATTAAGCTTGGTGTCGGAGACCTTCGGCAGAATT hdr1200up-F TTGTAAAACGACGGCCAGTGCCGGCGCGGGCATCATGCTGTTCAA hdr1200do-R GCTTGATGCCAGGCAGATTAAGCTTGATGATCCGCCGGAATGAGCGCCAG hdr1000up-F TTGTAAAACGACGGCCAGTGCCAAGATCAAACAGGATTTAACGCC hdr1000do-R GCTTGATGCCAGGCAGATTAAGCTTCGCATCGTGGCAGCATCCGAACCCG hdr800up-F TTGTAAAACGACGGCCAGTGCCCGAACAGGTTGATGATGTCGCGC hdr800do-R GCTTGATGCCAGGCAGATTAAGCTTGATCAACGATTGCGCCTGAGCTGAA hdr600up-F TTGTAAAACGACGGCCAGTGCCCGTCGACATCAGCATTTCGCCGCTCGATA hdr600do-R GCTTGATGCCAGGCAGATTAAGCTTGCTCGATCGGAGGAATGGATTGCAG hdr400up-F TTGTAAAACGACGGCCAGTGCCCCGTCATCGTTATGGGAACGAAATTGCCG hdr400do-R GCTTGATGCCAGGCAGATTAAGCTTACGAATGGAAGCCACGCGAGCCACG Tc-F TTTATCACAGTTAAATTGCTAACGC Tc-R CGCGGGCATCCCGATGCCGCCGGA hdr-JD-F TCCCGACCTCGCCATCACCCT hdr-JD-R TGCGGATTGATCGGGCACCAG pK18TcET-hdr800-F CTTGCAACCTCTTTCTCGATTTC pK18TcET-hdr800-R CGTTACGGCGCCGTAACATCG PQQ-F GAAATCGAGAAAGAGGTTGCAAGCTTGAGGTTCCTTCCCGTTTCG PQQ-R CGATGTTACGGCGCCGTAACGTGGCTTATGGTTGCCAGGAAGC I. Specific embodiments of the method for improving the recombination efficiency of denitrifying raw silk microorganisms according to the present invention: Example 1: Effect of different exonuclease-recombinase on recombination efficiency This example compares the effects of different exonucleases-recombinases on the recombination efficiency of denitrifying filamentous microbes. The specific implementation steps are as follows: 1. Acquisition of vector fragments (1) Promoter Primers were designed to amplify the glyceraldehyde-3-phosphate dehydrogenase promoter of *Methyltrophozoa diglucosidase* DSM6874 (*Methyltrophozoa diglucosidase* belongs to the genus *Methyltrophozoa*, and in the selection of promoters, closely related genera are preferred. *Methyltrophozoa diglucosidase* belongs to the genus *Methyltrophozoa* and can also be used to produce PQQ; therefore, this promoter was chosen to ensure efficient expression of the PQQ gene). Primer P was used to drive the expression of the recombinase. gpdA -F / R, using the genome of *Methylglucosidase* DSM6874 as a template to amplify the gene.

[0036] (2) Carrier skeleton Primers pK18-Tc-F / R were designed to amplify the backbone sequence of the pK18mobsacB-Tc vector (wherein, the pK18mobsacB-Tc vector is derived from existing references, Li J, Koch J, Flegler W, Ruiz LG, Hager N, Ballas A, Tanabe TS, Dahl C. A metabolic puzzle: consumption of C1 compounds and thiosulfate in Hyphomicrobium denitrificans XT. Biochimica et BiophysicaActa (BBA)-Bioenergetics. 2023,1864(1):148932.https: / / doi.org / 10.1016 / j.bbabio.2022.148932).

[0037] (3) Exonuclease-recombinase RecET (template) was amplified using primers RecET-F / R. Enterobacteria phage The phiV10 genome (GenBank number: DQ126339.2) has a nucleotide sequence as shown in SEQ ID NO.1.

[0038] Orf47+Orf48 (template) was amplified using primers orf47+48-F / R. Listeria phage The A118 genome (GenBank number: NC_003216.1) has a nucleotide sequence as shown in SEQ ID NO.2.

[0039] OrfB+OrfC (template) was amplified using primers orfB+CF / R.Legionella pneumophila The genome (GenBank number: AJ277755.1) has the nucleotide sequence shown in SEQ ID NO.3.

[0040] The Exo / Bet fragment (template Addgene number: 104531;166978) was amplified using primers exo-bet-F / R.

[0041] (4) Amplification of methanol dehydrogenase terminator sequence The MDH terminator fragment (template) was amplified using primers MDH-F / R. Hyphomicrobium denitrificans The ATCC51888 genome (GenBank number: CP002083.1) has a nucleotide sequence shown in SEQ ID NO.5.

[0042] (5) Homologous arm The knockout gene targeted in this embodiment is hdrA (GeneBank number: WP_013215428.1). Primers hdr500up-F / R were designed to amplify the upstream of the target gene (500 bp) using the genome of the denitrifying mycorrhizal microbe DSM1869 as a template (GenBank number: NC_014313.1); primers hdr500do-F / R were designed to amplify the downstream of the target gene (500 bp); using hdr500up-F and hdr500do-R as primers and the left and right homologous arms as templates, the fused fragment of the left and right homologous arms was obtained by overlap extension PCR.

[0043] 2. Fragment connection Using the ClonExpress Ultra One Step Cloning Kit (purchased from Vazyme, item number C115-01), follow... Figure 2 In the following order, the gene fragments RecET, OrfB+OrfC, Orf47+Orf48, and exo / bet obtained in step 1 were respectively coupled with the pK18mobsacB-Tc backbone and promoter P gpdA And fragment connections of homologous arm fusion, respectively constructing pK18mobsacB-Tc-RecET-Δ hdrA pK18mobsacB-Tc-orfB+C-Δ hdrA pK18mobsacB-Tc-orf47+48-Δ hdrA pK18mobsacB-Tc-exo / bet-Δ hdrA Carrier.

[0044] Note: Taking RecET as an example, the specific steps are as follows: First, amplify the upstream and downstream homologous arm fragments. Then, using hdr500up-F and hdr500do-R as primers and the upstream and downstream fragments as templates, amplify to obtain the fused upstream and downstream homologous arms. Next, amplify the gpdA promoter, RecET reading frame, and MDH terminator separately. Using PgpdA-F and RecET-R as primers and the above three fragments as templates, amplify to obtain the fused fragment. Then, using pK18-Tc-F / R as a template, amplify to obtain the plasmid backbone. Finally, using novizan recombinase, ligate the obtained fragments to construct pK18mobsacB-Tc-RecET-Δ. hdrA Carrier.

[0045] 3. Carrier transformation The preparation process of DSM1869 denitrifying filamentous microbes electroporation competent cells is as follows: (1) Single colonies that have been cultured in methanol solid medium for 5 days were inoculated into methanol liquid medium and cultured at 30℃ and 250rpm for 60 hours; (2) The bacterial culture was concentrated in methanol liquid medium (400mL) containing 0.1% Tween 80, with an initial OD600≈0.1, cultured at 30℃ and 250rpm until OD600≈0.3, and collected by centrifugation at 4℃ and 4000g for 10 minutes; (3) The bacterial cells were washed twice with ultrapure water, washed once with 10% glycerol, and then suspended and dispensed with 100μL of 10% glycerol for transformation.

[0046] The successfully constructed vector pK18mobsacB-Tc-RecET-Δ hdrA pK18mobsacB-Tc-orfB+C-Δ hdrA pK18mobsacB-Tc-orf47+48-Δ hdrA pK18mobsacB-Tc-exo / bet-Δ hdrA 500 ng of DNA was used to transform DSM1869 competent cells of denitrifying mycelium using a 1 mm electroporation cuvette (2.4 KV, one electroporation). The cells were then added to methanol liquid medium (0.5% methanol content) and incubated at 30°C for 6 h. The transformed cells were then plated on methylamine salt medium containing 15 μg / mL tetracycline and induced with sucrose medium. The DNA amount was controlled at 500 ng, and transformation was repeated three times. The average value was calculated. The number of recombinant transformants obtained is as follows: Figure 3 As shown.

[0047] As shown in the figure, under the same transformation and culture conditions, plasmids without recombinase yielded an average of approximately 12 recombinants after three replicate experiments. Plasmids containing the RecET, Orf47+Orf48, or OrfB+OrfC recombination systems significantly increased the number of recombinants after transformation (average increases to approximately 50, 30, and 21, respectively), with the RecET system showing the most significant improvement in the number of recombinants in denitrifying mycorrhizal bacteria. Plasmids containing the beta / exo recombination system did not show a significant difference in the number of recombinants after transformation compared to the control group (plasmids without recombinase). This indicates that different recombinases have a significant impact on the homologous integration efficiency in denitrifying mycorrhizal bacteria.

[0048] Example 2: Effect of different homologous arm lengths of the target gene on recombination efficiency This embodiment compares the effect of different homologous arm lengths of the target gene on the recombination efficiency of denitrifying mycelial microbes, using the results obtained in Example 1 as an example. Using the obtained vector pK18mobsacB-Tc-RecET as a template, homologous arm fragments of different lengths were ligated into the plasmid, and the plasmid was transformed into competent cells of the denitrifying filamentous microbe (DSM1869). The specific implementation steps are as follows: The plasmid backbone was amplified using primers PgpdA-F and pK18-Tc-R, and vector pK18mobsacB-Tc-RecET as templates.

[0049] Using primers hdr1200up-F and hdr500up-R, the genome of the denitrifying mycorrhizal microbe DSM1869 was used as a template to amplify the upstream of the homologous arm, which is 1200 bp in length. Primers hdr500do-F and hdr1200do-R were designed to amplify the downstream of the homologous arm, which is 1200 bp in length. The two were then connected by overlap extension PCR.

[0050] Primers hdr1000up-F and hdr500up-R were used to amplify the upstream of the homologous arm, which is 1000 bp in length; primers hdr500do-F and hdr1000do-R were designed to amplify the downstream of the homologous arm, which is 1000 bp in length, and the two were connected by overlap extension PCR.

[0051] Primers hdr800up-F and hdr500up-R were used to amplify the upstream of the homologous arm, which is 800 bp in length; primers hdr500do-F and hdr800do-R were designed to amplify the downstream of the homologous arm, which is 800 bp in length, and the two were connected by overlap extension PCR.

[0052] Primers hdr600up-F and hdr500up-R were used to amplify the upstream of the homologous arm, which is 600 bp in length; primers hdr500do-F and hdr600do-R were designed to amplify the downstream of the homologous arm, which is 600 bp in length, and the two were connected by overlap extension PCR.

[0053] Primers hdr400up-F and hdr500up-R were used to amplify the upstream of the homologous arm, which is 400 bp in length; primers hdr500do-F and hdr400do-R were designed to amplify the downstream of the homologous arm, which is 400 bp in length, and the two were connected by overlap extension PCR.

[0054] The obtained plasmid backbone pK18mobsacB-Tc-RecET and fusion fragments of different lengths of left and right homologous arms obtained through overlapping extension were processed using the ClonExpress Ultra One Step Cloning Kit (purchased from Vazyme, catalog number C115-01) according to... Figure 2 The connection is shown.

[0055] The plasmids containing homologous arms of different lengths were electroporated into competent cells of denitrifying filamentous bacteria. The number of transformants was counted as follows: Figure 4 As shown in the figure, the length of the homologous arm has a significant impact on recombination efficiency, with the highest recombination efficiency observed when the length is 800 bp.

[0056] Example 3: Effect of different electroconversion conditions on recombination efficiency This embodiment compares the effects of different electroconversion conditions on the recombination efficiency of denitrified raw silk microbes. The specific implementation steps are as follows: The carrier used in this embodiment is pK18mobsacB-Tc-RecET-Δ hdrA The length of the left and right homologous arms is 800 bp, and the amount of plasmid used is 500 ng.

[0057] The optimization factors for the electroporation procedure are as follows: A 1mm electroporation cup was used, and the following conditions were optimized: electroporation voltage of 1.8KV, 2.0KV, and 2.5KV; number of electroporations of 1, 2, and 3; no heat shock or heat shock at 45℃ for 2 min after electroporation; incubation time of 6h and 12h, with each experiment repeated 3 times. The electroporator used was a MicroPulser Electroporator (Bio-Rad). Specific results are as follows... Figure 5 As shown in the figure, the optimal conversion conditions are an electric shock voltage of 2.5 kV, two electric shocks, a heat shock temperature and time of 45°C for 2 minutes, and overnight incubation.

[0058] The vector pK18mobsacB-Tc-RecET-Δ was converted under the optimal conversion conditions (specifically: 1 mm electrocup, 2.5 kV voltage for 2 consecutive electrocutions, 45°C heat shock for 2 minutes, and 30°C incubation for 12 hours; homologous arm length of 800 bp). hdrA Transformation of competent cells of denitrifying mycelium, and single colonies obtained from the transformants after the first single crossover are shown in the figure. Figure 6 As shown in Figure A; design primers Tc-F / R to... Figure 6 Using the genome of the transformant shown in Figure B as a template, amplification was performed, demonstrating that the tetracycline resistance gene had been integrated; primers hdr-JD-F / R were designed for amplification. hdrA The CDS region of the gene was used to identify single colonies after sucrose induction, and the results were as follows: Figure 6 As shown in Figure C, the target gene has been successfully knocked out compared to the control. Specifically, Figure 6 The A in the diagram indicates that the plate contains a converter; Figure 6 The result of B indicates that the recombinant plasmid has been integrated into the genome and has resistance, but the target gene is still present, indicating that the plasmid has been integrated into the genome. Figure 6 After sucrose induction, the target gene in the transformant could no longer be amplified, indicating that the second recombination was completed and the target gene was knocked out.

[0059] II. Specific embodiments of the application of the method of the present invention for improving the recombination efficiency of denitrifying raw silk microorganisms in increasing the yield of pyrroloquinoline quinone: Example 4 This embodiment will synthesize the PQQ gene cluster ( pqqA-E Integration into the genome of denitrifying silk microbe DSM1869 hdrA To increase PQQ yield at the gene's reading frame, the specific implementation steps are as follows: With plasmid pK18mobsacB-Tc-RecET-Δ hdrA Using pK18TcET-hdr800-F / R as a template, the plasmid backbone was amplified.

[0060] Using the DSM1869 genome as a template, amplification was performed using primers PQQ-F / R. pqqA-E The gene fragment, including the promoter and terminator, is 4122 bp.

[0061] The plasmid backbone and PQQ gene cluster were assembled using the ClonExpress Ultra One Step Cloning Kit (purchased from Vazyme, catalog number C115-01) according to... Figure 7 The connection is shown.

[0062] pK18mobSacB-Tc-RecET- pqqA-EPlasmid transformation of wild-type denitrifying mycelial microbe DSM1869 and fermentation of the successfully obtained homologous recombinant strain in methanol medium for 7-10 days resulted in an increase in PQQ yield from 0.08 g / L to 0.11 g / L compared to the starting strain.

[0063] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for improving the recombination efficiency of denitrifying raw silk microorganisms, characterized in that: The procedure includes the following steps: constructing a vector that simultaneously expresses a fusion fragment of an exonuclease-recombinase system, an upstream homologous arm of the target gene, and a downstream homologous arm of the target gene; transforming the vector into denitrifying mycelial microbes; and culturing and identifying the vector. The exonuclease-recombinase system is one of the RecET recombination system, the Orf47+Orf48 recombination system, or the OrfB+OrfC recombination system. The RecET recombination system includes the nucleotide sequence shown in SEQ ID NO.1; the Orf47+Orf48 recombination system includes the nucleotide sequence shown in SEQ ID NO.2; and the OrfB+OrfC recombination system includes the nucleotide sequence shown in SEQ ID NO.

3.

2. The method for improving the recombination efficiency of denitrifying raw silk microorganisms according to claim 1, characterized in that: The length of the homologous arm is 600~1200bp.

3. The method for improving the recombination efficiency of denitrifying raw silk microorganisms according to claim 2, characterized in that: The length of the homologous arm is 800~1000bp.

4. The method for improving the recombination efficiency of denitrifying raw silk microorganisms according to claim 1, characterized in that: The vector also includes a constitutive promoter and a terminator for driving the exonuclease-recombinase system.

5. The method for improving the recombination efficiency of denitrifying raw silk microorganisms according to claim 4, characterized in that: The constitutive promoter is the glyceraldehyde-3-phosphate dehydrogenase promoter of *Glucosamine methyl*, and its nucleotide sequence is shown in SEQ ID NO.4; the terminator is the terminator of the methanol dehydrogenase gene of *Denitrifying Mycorrhizal*, and its nucleotide sequence is shown in SEQ ID NO.

5.

6. The method for improving the recombination efficiency of denitrifying raw silk microorganisms according to claim 1, characterized in that: The target gene is a denitrifying microbe. hdrA Gene.

7. The method for improving the recombination efficiency of denitrifying raw silk microorganisms according to any one of claims 1 to 6, characterized in that: The starting vector for the vector is the Corynebacterium glutamicum gene knockout vector pK18mobsacB.

8. The method for improving the recombination efficiency of denitrifying raw silk microorganisms according to claim 7, characterized in that: The conversion is to electroconversion, and the electroconversion conditions are: an electric shock voltage of 2~2.5KV, 2~3 electric shocks, and incubation at 30~32℃ for 6~12h after the electric shock.

9. The method for improving the recombination efficiency of denitrifying raw silk microorganisms according to claim 8, characterized in that: The conditions for the electroconversion also include a heat shock at 42-45°C for 2-2.5 minutes after the electric shock.

10. The application of the method for improving the recombination efficiency of denitrifying filamentous microorganisms as described in any one of claims 1 to 9 in increasing the yield of pyrroloquinoline quinone, characterized in that: After the pyrroloquinoline quinone encoding gene was inserted between the upstream homologous arm and the downstream homologous arm of the target gene in the vector, it was transformed into denitrifying mycelial microbes to express pyrroloquinoline quinone.

Images