Recombinant vector construction system for tobacco eIf4e gene editing

Abstract

The invention relates to the field of plant genetic engineering, and particularly discloses a recombinant vector construction system for tobacco eIf4e gene editing. The system comprises a recombinant expression vector with pCAMBIA1300 as a basic skeleton, an nCas9-RT fusion protein expression unit driven by a Stubi promoter and a pegRNA expression unit driven by an NtU6-28 promoter are integrated in the recombinant expression vector, and the system further comprises a hygromycin resistance selection marker driven by a 35S promoter; the preparation method comprises the following steps: firstly, synthesizing a specific nucleotide sequence of each element, carrying out directional cloning through BstBI and BlpI restriction endonuclease sites, and sequentially connecting the two core expression units in series according to the direction from 5'to 3 'and assembling the two core expression units into a vector skeleton. The recombinant vector system can be used for specific multi-site precise editing of a VGAD region of the tobacco eIf4e gene, and has the advantages of dual-promoter coordinated regulation and editing element expression coordination.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant genetic engineering, more particularly, it relates to a recombinant vector construction system for tobacco eIf4e gene editing. BACKGROUND

[0002] In tobacco cultivation, viral disease is an important factor restricting yield and quality. The tobacco eIf4e gene, as a key translation initiation factor, is a key host factor for the invasion and replication of multiple viruses. By precisely editing this gene and destroying its binding ability with viral RNA, the spread of viruses can be fundamentally blocked, so the eIf4e gene has become an important target for tobacco disease-resistant breeding. The prime editing technology, which can achieve precise editing without DNA double-strand breaks and external templates, has become an ideal tool for improving the gene. The effectiveness of this technology depends on the effective assembly and synergistic work of nCas9-RT fusion protein and pegRNA in cells.

[0003] However, the existing editing system mostly uses promoters from non-tobacco sources, such as Arabidopsis AtU6 promoter or 35S promoter. These promoters lack sufficient specificity and compatibility in tobacco cells, leading to uncoordinated expression of editing elements and difficulty in forming stable functional complexes of proteins and RNA. This insufficient synergistic effect of editing elements seriously restricts the editing efficiency of the tobacco eIf4e gene and limits the practical application of this technology in disease-resistant breeding. SUMMARY

[0004] In order to solve the problem of insufficient synergistic effect of editing elements in tobacco cells leading to low efficiency of prime editing in the prior art, the present application provides a recombinant vector construction system for tobacco eIf4e gene editing.

[0005] The recombinant vector construction system for tobacco eIf4e gene editing comprises a recombinant expression vector, the vector comprises a nCas9-RT fusion protein expression unit driven by Stubi promoter and a pegRNA expression unit driven by NtU6-28 promoter; wherein the nCas9-RT fusion protein comprises a nCas9 nickase domain and a reverse transcriptase functional domain, the pegRNA targets the VGAD region of the tobacco eIf4e gene, and the two expression units are connected in series in the pCAMBIA1300 vector backbone through BstBI and BlpI restriction endonuclease sites.

[0006] By employing the above technical solution, an expression unit is constructed by directly linking the tobacco endogenous Stubi promoter with the coding sequence of the nCas9-RT fusion protein. Simultaneously, the NtU6-28 promoter, containing the U6 core element and a tobacco-specific regulatory region, drives pegRNA transcription, forming a dual-expression unit structure adapted to tobacco cells. These two expression units are tandemly linked via BstBI and BlpI restriction endonuclease sites, forming a stable spatial configuration within the pCAMBIA1300 vector backbone, enabling precise physical arrangement of different editing elements at the vector level. This design constructs a well-defined vector system through a specific combination of promoters and a defined restriction enzyme site linkage, providing a molecular basis for the coordinated expression of editing elements in tobacco cells. The construction process of the recombinant vector includes: first, double digestion of the pCAMBIA1300 basic vector with BstBI and BlpI restriction endonucleases to obtain a linearized backbone; then, using molecular cloning technology, inserting a pre-synthesized fragment containing the Stubi promoter and the nCas9-RT fusion protein encoding gene into the backbone to form an intermediate vector; finally, further cloning a fragment containing the NtU6-28 promoter and the pegRNA encoding sequence into the predetermined position of the intermediate vector to complete the assembly of the recombinant expression vector.

[0007] Preferably, the nucleotide sequence of the Stubi promoter is shown in SEQ ID NO:1, and the Stubi promoter is directly linked upstream of the translation start site of the nCas9-RT fusion protein coding sequence.

[0008] By employing the above-described technical solution, the Stubi promoter utilizes the specific nucleotide sequence shown in SEQ ID NO:1, and its 3' end is directly attached upstream of the translation start codon of the nCas9-RT fusion protein coding sequence, constructing a complete transcription unit. This design ensures that there are no additional spacer sequences between the promoter and the coding region, allowing RNA polymerase to initiate transcription from a precise transcription start site while maintaining the integrity of regulatory elements in the promoter's natural sequence. By using this specific sequence and maintaining its direct connection to the coding region, a transcriptional regulatory module with a well-defined sequence characteristic is provided for the expression of the nCas9-RT fusion protein in tobacco cells.

[0009] Preferably, the nucleotide sequence of the NtU6-28 promoter is shown in SEQ ID NO:2, and the NtU6-28 promoter contains the U6 promoter core element and the tobacco-specific transcriptional regulatory region.

[0010] By employing the above-described technical solution, the NtU6-28 promoter was constructed using the specific nucleotide sequence shown in SEQ ID NO:2. This sequence simultaneously contains the conserved U6 promoter core element and a specific transcriptional regulatory region derived from the tobacco genome. This sequence design allows the promoter to retain the basic functional modules necessary for RNA polymerase III recognition and binding while incorporating regulatory features adapted to the transcriptional environment of tobacco cells. Integrating these two functional regions with well-defined sequence characteristics into the same promoter structure provides a regulatory basis for pegRNA transcription in tobacco cells that is both universal and species-specific.

[0011] Preferably, the nucleotide sequence of the gene encoding the nCas9-RT fusion protein is shown in SEQ ID NO:3, wherein nCas9 contains R221K, N394K and H840A mutations, and the reverse transcriptase functional domain is an M-MLV reverse transcriptase with the RNaseH domain removed.

[0012] By employing the above-described technical solution, an nCas9-RT fusion protein encoding gene was constructed using the specific nucleotide sequence shown in SEQ ID NO:3. This sequence incorporates amino acid substitutions at three specific sites—R221K, N394K, and H840A—in the nCas9 region, while simultaneously defining the reverse transcriptase domain as an M-MLV reverse transcriptase modified by removing the RNaseH domain. This specific sequence-level design endows nCas9 with specific enzymatic cleavage characteristics and separates reverse transcription function from RNA hydrolysis activity. By fusing the nuclease domain with well-defined sequence characteristics to the modified reverse transcriptase domain, a structurally defined protein component is provided for the editing system.

[0013] Preferably, the nucleotide sequence of the tobacco eIf4e gene targeted by the pegRNA is shown in SEQ ID NO:4, and the target site is located at bases 2828, 2829 and 2835 of the sequence.

[0014] By employing the above technical solution, the spacer sequence of the pegRNA is designed to be precisely complementary to the base regions at positions 2828, 2829, and 2835 in the tobacco eIf4e gene sequence shown in SEQ ID NO:4. This spacer sequence can specifically recognize and bind to these three consecutively distributed target sites within the VGAD region of the gene. This multi-target design allows a single pegRNA to simultaneously cover three adjacent editing sites, and through its spacer sequence, it forms specific base-pairing interactions with the genomic target region, providing precise localization guidance for subsequent editing processes.

[0015] Preferably, the vector backbone further includes a hygromycin resistance gene expression cassette driven by a 35S promoter.

[0016] By employing the above technical solution, a complete expression cassette is constructed by linking the 35S promoter with the coding sequence of the hygromycin resistance gene. This cassette is then integrated into a specific location on the vector backbone, forming an independent selection marker unit. This expression cassette, along with the editing element expression unit, resides within the vector backbone, creating a dual structure containing both functional gene units and selection marker units. By setting such selection markers with clearly defined components in the vector system, an operable identification basis is provided for the subsequent recognition and isolation of transformed cells.

[0017] Preferably, the Stubi promoter expression unit and the NtU6-28 promoter expression unit are arranged sequentially in a 5' to 3' direction.

[0018] By employing the above technical solution, the Stubi promoter expression unit and the NtU6-28 promoter expression unit are sequentially arranged in the vector backbone along a transcriptional direction from 5' to 3', resulting in a linear arrangement of the two expression units with a defined orientation on the vector. Specifically, in the linear nucleotide sequence of the recombinant vector, the Stubi promoter expression unit is positioned at the 5' end of the NtU6-28 promoter expression unit. This directional arrangement ensures that the promoter, coding region, and termination signal within each expression unit maintain the correct transcriptional direction, while simultaneously establishing an ordered spatial relationship between the two independent expression units at the vector level. This directional unit arrangement design creates a structural basis for the coordinated expression of different editing elements within the vector system.

[0019] Preferably, the 5' end of the coding sequence of the nCas9-RT fusion protein further includes a Kozak sequence, which is located upstream of the start codon.

[0020] By employing the above-described technical solution, a Kozak sequence is directly added upstream of the start codon ATG in the coding sequence of the fusion protein, making this conserved sequence adjacent to the translation initiation site. This sequence element located at a specific position is adapted to the recognition and binding process of the small ribosomal subunit, and its specific nucleotide composition forms a molecular-level correspondence with the eukaryotic translation initiation mechanism. By placing this sequence module at the 5' end of the coding region, a sequence environment that meets the requirements of the eukaryotic translation mechanism is provided for the translation initiation process of the fusion protein in tobacco cells.

[0021] Preferably, the pegRNA expression unit further includes an RNA polymerase III transcription termination signal, which is six consecutive thymine nucleotides.

[0022] By employing the above-described technical solution, a specific sequence module consisting of six consecutive thymine nucleotides is placed at the 3' end of the pegRNA coding sequence. This sequence matches the transcription termination recognition mechanism of RNA polymerase III. When transcription reaches this site, this specific sequence structure can interact with a specific subunit within the polymerase, causing the transcription complex to dissociate from the DNA template. By introducing a transcription termination signal with a clearly defined sequence at the end of this expression unit, a complete termination control element is provided for the precise transcription of pegRNA.

[0023] Preferably, the recombinant vector further comprises a 35S terminator and a Nos terminator, used for transcriptional termination of the nCas9-RT fusion protein expression unit and the selection marker gene expression unit, respectively.

[0024] By employing the above technical solution, placing the 35S terminator downstream of the nCas9-RT fusion protein coding sequence and simultaneously linking the Nos terminator to the end of the hygromycin resistance gene coding sequence, the two expression units are equipped with transcription termination signals with different sequence characteristics. This design allows the protein-coding expression unit and the selection marker expression unit to each possess termination regulatory elements adapted to their expression characteristics. By setting these two terminators with clearly defined sequence characteristics in the vector system, a complete termination control architecture is provided for the transcription process of different expression units.

[0025] In summary, this application has the following beneficial effects:

[0026] 1. This application employs the tobacco-endogenous Stubi promoter to drive the expression of the nCas9-RT fusion protein, while simultaneously utilizing the NtU6-28 promoter to drive pegRNA transcription. Both promoters exhibit high specificity and compatibility in tobacco cells. This dual-promoter combination is tandemly linked within the same vector backbone in a specific 5' to 3' orientation, resulting in more spatiotemporally coordinated expression of protein and RNA elements. This design promotes efficient assembly of the editing complex, providing a more stable and efficient molecular environment for the lead editing process in tobacco cells, thereby improving the synergistic effect of editing elements.

[0027] 2. The nCas9-RT fusion protein coding sequence in this application contains an nCas9 domain with a specific point mutation and a modified reverse transcriptase functional domain. A Kozak sequence is introduced at the 5' end of the coding region to optimize translation initiation. The pegRNA expression unit is equipped with an RNA polymerase III-specific transcription termination signal, which, together with the 35S and Nos terminators, constitutes a complete transcriptional control framework. This multi-level regulatory design ensures accurate expression and functional integrity of the editing element at each stage from transcription to translation, enhancing the system's operational stability in tobacco cells.

[0028] 3. The pegRNA in this application precisely targets three adjacent base sites in the VGAD region of the tobacco eIf4e gene, achieving simultaneous editing at multiple sites. The hygromycin resistance gene expression cassette integrated into the system is located within the T-DNA region along with the editing element, facilitating efficient screening after transformation. This design enables the vector system to maintain editing precision while possessing good screening and identification feasibility, providing a practical technical tool for tobacco gene function research and trait improvement. Attached Figure Description

[0029] Figure 1 This is a schematic diagram of the structure of the recombinant vector pCAMBIA1300-Stubi-PE provided in this application. Detailed Implementation

[0030] The present application will be further described in detail below with reference to embodiments and comparative examples.

[0031] Technical concept:

[0032] When using lead-editing systems to target and modify the tobacco eIf4e gene, related technologies face the core problem of unsatisfactory editing efficiency. The root cause of this problem lies in the fact that existing systems generally use non-tobacco-derived universal promoters to drive the expression of editing elements. These promoters have compatibility differences with the transcriptional regulatory mechanisms of tobacco cells, leading to an imbalance in the expression levels and spatiotemporal mismatch of the nCas9-RT fusion protein and pegRNA within the cell. This makes it difficult to form a sufficient number of functional editing complexes, thus limiting the overall efficiency of the editing system.

[0033] This technical solution addresses the aforementioned problems by constructing a vector system adapted to the characteristics of tobacco cells. Specifically, the system employs the tobacco-endogenous Stubi promoter to precisely drive the expression of the nCas9-RT fusion protein, while simultaneously using the NtU6-28 promoter, which contains tobacco-specific elements, to regulate the transcription of pegRNA. These two core expression units are directionally assembled into the same vector backbone through specific restriction enzyme sites, forming a structurally defined expression framework. This design ensures the coordinated expression of different editing elements in the tobacco cell environment at the transcriptional regulation level, providing the necessary molecular basis for the efficient assembly of the editing complex.

[0034] Preparation Example 1

[0035] The preparation method of the Stubi promoter is as follows:

[0036] Genomic DNA was extracted from young leaves of the tobacco cultivar K326. Specific primers were designed based on the known promoter region sequence of the tobacco Stubi gene, and a promoter fragment of approximately 800 bp was obtained by high-fidelity PCR. The PCR product was cloned into the pMD19-T simple vector for sequencing verification. After sequence alignment confirmed complete identity with SEQ ID NO:1, the complete Stubi promoter fragment was excised from the recombinant plasmid using BstBI and BlpI restriction endonucleases. High-purity promoter elements were obtained by gel extraction for subsequent vector construction.

[0037] Preparation Example 2

[0038] The preparation method of the NtU6-28 promoter is as follows:

[0039] Degenerate primers were designed based on the sequence characteristics of the tobacco U6 promoter family. PCR amplification was performed using tobacco genomic DNA as a template to obtain multiple candidate U6 promoter fragments. Each fragment was ligated into a test vector containing a reporter gene. The promoter variant with the highest transcriptional activity was screened using Agrobacterium-mediated transient transformation of tobacco. Sequencing confirmed the NtU6-28 promoter with the sequence shown in SEQ ID NO:2. This promoter was cloned into an intermediate vector, preserved, and purified by enzyme digestion to obtain the purified promoter fragment.

[0040] Preparation Example 3

[0041] The method for preparing the nCas9-RT fusion protein encoding gene is as follows:

[0042] The nCas9-RT fusion gene was constructed stepwise using overlap PCR. First, using a plasmid containing nCas9 as a template, R221K, N394K, and H840A mutations were introduced through site-directed mutagenesis. Simultaneously, a functional fragment with the RNaseH domain removed was amplified from the M-MLV reverse transcriptase gene. The two fragments were ligated into a complete fusion gene via overlap extension PCR and cloned into a sequencing vector for sequence verification. After confirming that its sequence was identical to SEQ ID NO:3 and the reading frame was correct, the fusion gene was subcloned into an expression vector to provide standardized gene elements for subsequent experiments.

[0043] Example 1

[0044] First, the Stubi promoter sequence was synthesized, and its nucleotide sequence is shown in SEQ ID NO.1. Simultaneously, the nCas9-RT fusion protein encoding gene was synthesized, and its nucleotide sequence is shown in SEQ ID NO.3. This sequence contains a nuclear localization signal peptide coding region, an nCas9 nickase domain coding region, and a reverse transcriptase functional domain coding region. nCas9 contains three key mutations: R221K, N394K, and H840A, while the reverse transcriptase functional domain is an M-MLV reverse transcriptase with the RNaseH domain removed. A pegRNA was designed targeting the VGAD region of the tobacco eIf4e gene. The nucleotide sequence of this target gene is shown in SEQ ID NO.4. The spacer sequence of the pegRNA precisely targets bases 2828, 2829, and 2835 of this sequence. Using the plant binary expression vector pCAMBIA1300 as the backbone, the vector fragment was double-digested with BlpI and BstBI restriction endonucleases and recovered. The Stubi promoter was linked to the nCas9-RT fusion protein encoding gene using molecular cloning technology to construct a Stubi promoter-driven nCas9-RT fusion protein expression unit. This expression unit and a pegRNA expression unit driven by the NtU6-28 promoter were sequentially cloned into the T-DNA region of the pCAMBIA1300 vector. The nucleotide sequence of the NtU6-28 promoter is shown in SEQ ID NO.2 and includes the U6 promoter core element and a tobacco-specific transcriptional regulatory region. The two expression units were arranged sequentially in a 5' to 3' orientation. A hygromycin resistance gene driven by the 35S promoter was introduced into the vector backbone as a selection marker. The final complete recombinant expression vector was obtained and named pCAMBIA1300-Stubi-PE.

[0045] Example 2

[0046] Mature seeds of the tobacco cultivar K326 were surface-sterilized with 75% ethanol for 30 seconds, then sterilized with 2% sodium hypochlorite solution for 10 minutes, and finally rinsed 5-6 times with sterile water. The sterilized seeds were inoculated onto MS basal medium and cultured at 25°C under 16h light / 8h dark conditions for 4-6 weeks to obtain sterile seedlings. The 3rd-5th true leaves of healthy seedlings were selected and cut into 0.5×0.5cm pieces as explants. The recombinant expression vector pCAMBIA1300-Stubi-PE constructed in Example 1 was introduced into Agrobacterium EHA105 competent cells using a freeze-thaw method. Positive clones were screened on LB agar plates containing 50 mg / L kanamycin and inoculated into LB liquid medium containing the same antibiotic, and cultured overnight at 28°C with shaking. The activated bacterial culture was transferred at a ratio of 1:50 to YEB medium containing 100 μM acetylsyleugenol and cultured until the OD600 value reached 0.5-0.6. Tobacco leaf explants were immersed in the above Agrobacterium culture for 10 min, and after blotting the surface bacterial culture with sterile filter paper, they were inoculated onto a co-culture medium and cultured in the dark at 25°C for 3 days. The co-culture medium was MS medium supplemented with 2.0 mg / L 6-BA and 0.1 mg / L NAA. After co-culture, the explants were transferred to a selection medium, which was the co-culture medium supplemented with 50 mg / L hygromycin and 200 mg / L cephalosporin. Selection culture was carried out at 25°C under 16 h light conditions, with the medium replaced with fresh medium every 2 weeks. When the resistant shoots reached 2-3 cm in length, they were cut off and transferred to a rooting medium, which was 1 / 2 MS medium supplemented with 0.1 mg / L 6-BA. Complete regenerated plantlets were obtained after 2-3 weeks of culture.

[0047] Example 3

[0048] Genomic DNA was extracted from the leaves of the regenerated plants obtained in Example 2. Specific primers targeting the VGAD region were designed for PCR amplification. The forward primer sequence was 5'-GAGTCCGCGCAACTTAGGAT-3', and the reverse primer sequence was 5'-ATCCCCCTTATTTCGGACGC-3'. The PCR reaction program was 95℃ pre-denaturation for 5 min, followed by 35 cycles of 95℃ for 30 s, 62℃ for 30 s, 72℃ for 30 s, and a final extension at 72℃ for 10 min. The PCR amplification products were detected by agarose gel electrophoresis, and the target band was recovered. The purified PCR products were sent to a professional sequencing company for Sanger sequencing. The editing status of the target site was analyzed by comparing the sequencing data with the wild-type sequence. Statistical results show that the Stubi promoter and NtU6-28 promoter combination system constructed using this invention successfully achieved the expected editing at positions 2828, 2829, and 2835 of the tobacco eIf4e gene, with a lead editing efficiency of 42.5%.

[0049] Comparative Example 1

[0050] As a comparative example, an expression vector containing only the conventional 35S promoter-driven nCas9-RT fusion protein and the Arabidopsis thaliana AtU6 promoter-driven pegRNA was constructed. The vector construction method, Agrobacterium-mediated transformation method, and tobacco genetic transformation procedure were exactly the same as in Examples 1 and 2. The leader editing efficiency was statistically analyzed by performing PCR amplification and sequencing analysis on the regenerated plants using the same method.

[0051] Comparative Example 2

[0052] Another proportional vector was constructed, in which the Stubi promoter was retained to drive the nCas9-RT fusion protein, but the pegRNA was still driven by the conventional AtU6 promoter. Other vector elements and experimental procedures remained consistent with the previous examples. Editing efficiency tests showed that the system's editing efficiency was 28.7%, which, while higher than the conventional promoter system, was still significantly lower than the dual-promoter co-optimized system of this invention.

[0053] The comparison results of the lead editing efficiency of different promoter combination systems are shown in Table 1.

[0054] Table 1:

[0055]

[0056] The results of the detailed analysis of the target site editing are shown in Table 2.

[0057] Table 2:

[0058]

[0059] The results of screening and editing positive rates of regenerated plants are shown in Table 3.

[0060] Table 3:

[0061]

[0062] The comparison results of the carrier construction and transformation characteristics of different systems are shown in Table 4.

[0063] Table 4:

[0064]

[0065] As can be seen from Examples 1-3 and Comparative Example 1, and in conjunction with Tables 1 and 2, when the traditional 35S promoter drives the nCas9-RT fusion protein and is combined with the Arabidopsis-derived AtU6 promoter to drive the pegRNA, the overall editing system exhibits significantly insufficient operational efficiency. This phenomenon indicates that non-tobacco endogenous promoter combinations are difficult to achieve effective synergistic work in tobacco cells, and there is an adaptation gap between their transcriptional regulatory mechanisms and the internal environment of tobacco cells, resulting in the inability of each editing element to achieve an ideal working state.

[0066] As can be seen from Examples 1-3 and Comparative Example 2, and in conjunction with Tables 1 and 3, although using the Stubi promoter to drive the nCas9-RT fusion protein can partially improve system performance, the overall coordination of the system is still limited when the pegRNA is still driven by the traditional AtU6 promoter. This indicates that optimizing only the protein expression unit without simultaneously optimizing the RNA expression unit limits the effective coordination of various components, preventing sufficient synergistic effects between different components within the system and thus failing to fully realize its potential efficiency.

[0067] The results from the three examples and two comparative examples demonstrate that the specific combination of the Stubi promoter and the NtU6-28 promoter provides a more suitable transcriptional regulatory environment for the expression of the editing element in tobacco cells. This pairing of tobacco endogenous promoters creates a coordinated working platform, enabling the nCas9-RT fusion protein and pegRNA to achieve better complementarity in both expression level and function, thus establishing a more robust molecular basis for the assembly and function of the editing complex.

[0068] SEQ ID NO:1

[0069]

[0070] SEQ ID NO:2

[0071] ATTGTCAAAGAAAATATATCCTGATTTATTGGTGTTATTGACCAATGTTGTTTTGTTTTGCTCTCCAAATCAAAGGAAAATAATATGCTTCCTTCAATTATATACACTTTTTAAACACATACAATGACATTAGATGCTGACCTTATATTGTTTTTTCTTTTTCTTTTTCAATCATTGACAATTTCTAAGCAATAATTTACAGAGTCACCAAGCTTGGATAAACACGCCACCTTGATACAAGAGAATGAAAAGCTATCTCTAAGATTCATTACTACTCTATTTTCCTATTAGTCTAGAAGA

[0072] SEQ ID NO:3

[0073]

[0074] SEQ ID NO:4

[0075]

[0076] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. A recombinant vector construction system for tobacco eIf4e gene editing, characterized in that: The invention includes a recombinant expression vector containing an nCas9-RT fusion protein expression unit driven by the Stubi promoter and a pegRNA expression unit driven by the NtU6-28 promoter; wherein the nCas9-RT fusion protein contains an nCas9 nickase domain and a reverse transcriptase domain, the pegRNA targets the VGAD region of the tobacco eIf4e gene, and the two expression units are tandemly linked to the pCAMBIA1300 vector backbone via BstBI and BlpI restriction endonuclease sites.

2. The recombinant vector construction system for tobacco eIf4e gene editing according to claim 1, characterized in that: The nucleotide sequence of the Stubi promoter is shown in SEQ ID NO:

1. The Stubi promoter is directly linked upstream of the translation start site of the nCas9-RT fusion protein coding sequence.

3. The recombinant vector construction system for tobacco eIf4e gene editing according to claim 1, characterized in that: The nucleotide sequence of the NtU6-28 promoter is shown in SEQ ID NO:

2. The NtU6-28 promoter contains the U6 promoter core element and the tobacco-specific transcriptional regulatory region.

4. The recombinant vector construction system for tobacco eIf4e gene editing according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the nCas9-RT fusion protein is shown in SEQ ID NO:3, wherein nCas9 contains R221K, N394K and H840A mutations, and the reverse transcriptase functional domain is an M-MLV reverse transcriptase with the RNaseH domain removed.

5. The recombinant vector construction system for tobacco eIf4e gene editing according to claim 1, characterized in that: The nucleotide sequence of the tobacco eIf4e gene targeted by the pegRNA is shown in SEQ ID NO:4, and the target site is located at bases 2828, 2829 and 2835 of the sequence.

6. The recombinant vector construction system for tobacco eIf4e gene editing according to claim 1, characterized in that: The vector backbone also contains a hygromycin resistance gene expression cassette driven by a 35S promoter.

7. The recombinant vector construction system for tobacco eIf4e gene editing according to claim 1, characterized in that: The Stubi promoter expression unit and the NtU6-28 promoter expression unit are arranged sequentially in the 5' to 3' direction.

8. The recombinant vector construction system for tobacco eIf4e gene editing according to claim 1, characterized in that: The 5' end of the coding sequence of the nCas9-RT fusion protein also contains a Kozak sequence, which is located upstream of the start codon.

9. The recombinant vector construction system for tobacco eIf4e gene editing according to claim 1, characterized in that: The pegRNA expression unit also includes an RNA polymerase III transcription termination signal, which is six consecutive thymine nucleotides.

10. The recombinant vector construction system for tobacco eIf4e gene editing according to claim 1, characterized in that: The recombinant vector also contains a 35S terminator and a Nos terminator, which are used to terminate the transcription of the nCas9-RT fusion protein expression unit and the selection marker gene expression unit, respectively.

Images