Application of brassica napus BnaUGE2 gene in regulation and control of flowering period of brassica napus

By identifying and regulating the BnaUGE2 gene in Brassica napus, and using homologous recombination and CRISPR/Cas9 technology, the shortcomings in the regulation of rapeseed flowering time were solved, and precise regulation of flowering time was achieved, providing important resources and theoretical basis for the genetic improvement of rapeseed.

CN121294516APending Publication Date: 2026-01-09HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511782699.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-30
Publication Date
2026-01-09

AI Technical Summary

Technical Problem

In the current technology, the research on genes regulating flowering time in rapeseed is not comprehensive. Most studies are limited to the known flowering time modules in Arabidopsis thaliana, lacking in-depth understanding of rapeseed-specific genes, which affects the effect of genetic improvement.

Method used

By identifying and utilizing the BnaUGE2 gene in Brassica napus, homologous recombination, CRISPR/Cas9 gene editing, and antisense RNA technology were employed to regulate the expression level of the BnaUGE2 gene, thereby advancing or delaying the flowering period, including overexpressing or knocking out the gene to alter the flowering period of rapeseed.

Benefits of technology

This study achieved effective regulation of the flowering period of Brassica napus, provided important genetic improvement gene resources, and promoted precise regulation of the flowering period of rapeseed, which has scientific significance and practical application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the technical field of oilseed rape genetic improvement and genetic engineering, and discloses application of a brassica napus BnaUGE2 gene in regulating and controlling the flowering period of oilseed rape. The BnaUGE2 gene has four homologous copies, and the four homologous copies are respectively as shown in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5 and SEQ ID NO. 7. Experiments prove that the BnaUGE2 gene is over-expressed under the background of brassica napus B409, so that a plant can flower in advance, and the pod character is not influenced; on the contrary, the activity of the gene is inhibited through a gene knockout technology, so that flowering delay, pod length increase and grain number reduction of each pod can be caused. On the basis, through expression regulation of the BnaUGE2 gene, fine regulation of the flowering period of the rape can be realized, and new germplasm and gene resources are provided for breeding of a new variety of early-maturing rape.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of rapeseed genetic improvement and gene engineering technology, specifically involving the application of the BnaUGE2 gene in regulating the flowering period of rapeseed. Background Technology

[0002] Flowering is a key marker of the transition from vegetative to reproductive growth in plants, a process that directly determines plant reproduction and final yield. In the model plant Arabidopsis thaliana, flowering time is controlled by a complex regulatory network that integrates multiple signaling pathways, including photoperiod, vernalization, autonomy, hormones, age, and ambient temperature (Boss et al 2004). These pathways interact and influence flowering by jointly regulating core genes such as FT and SOC1 (Simpson and Dean 2002; Turck et al 2008). FLC, as a key repressor, is inhibited by upstream signals (such as vernalization and autonomy pathways), thereby relieving the repression of the flowering integrinators FT and SOC1 (Helliwell et al 2006; Searle et al 2006); the expression of FT and SOC1 is subsequently promoted, further activating the expression of floral meristem characteristic genes such as LFY and AP1, ultimately completing the transition from vegetative to reproductive growth (Goslin et al 2017; Lee and Lee 2010). Brassica napus and Arabidopsis thaliana both belong to the Brassicaceae family, and their flowering pathway regulation is highly conserved. In recent years, the biological functions of several flowering-related genes in Brassica napus have been clarified. For example, there are nine copies of BnaFLC in Brassica napus, with BnaFLC.A2, BnaFLC.A3b, and BnaFLC.A10 primarily responding to vernalization. Simultaneous mutations of BnaFLC.A10 and BnaFLC.A2 in winter Brassica napus result in flowering periods similar to those in spring Brassica napus (Westar). Transferring the highly functional BnaFLC.A10 and BnaFLC.A2 from winter Brassica napus into Westar significantly delays flowering; mutations in BnaFLC.A2 in spring Brassica napus (Westar) also significantly delay flowering (Yin et al. 2025). There are four copies of BnaFT in rapeseed. BnaFT.A2 has the greatest impact on flowering time, followed by BnaFT.C6 and BnaFT.A7, while BnaFT.C2 has no effect on flowering (Wan et al. 2024). Sriboon et al. (2020) reported that BnaC03.TFL1, as a member of the PEBP family, is a key negative regulator of flowering and flower bud differentiation, and its loss of function can lead to earlier flowering and changes in plant architecture (Sriboon et al. 2020). Guo et al. (2022) confirmed that BnaCOL9 delays flowering by negatively regulating the expression of integrinogen genes such as FT and CO, and its mutants show earlier flowering. Although some flowering genes have been identified in Brassica napus, they are mostly limited to the known flowering period modules in Arabidopsis thaliana. Compared with the more than 1,300 flowering genes that may exist in rapeseed, there are still many unknown genes to be revealed.

[0003] UGE2 (UDP-D-glucose 4-epimerase) encodes a UDP-glucose-4-epimerase, a key enzyme in cell wall polysaccharide synthesis. The Arabidopsis genome contains five genes encoding UGE, namely UGE1-5. UGE1 and UGE3 possess UDP-D-xylose 4-epimerase activity, catalyzing the conversion of UDP-D-xylose to UDP-L-Ara; while UGE2, UGE4, and UGE5 primarily catalyze the interconversion between UDP-Glucose and UDP-Gal (Umezawa et al. 2024). Genetic studies have shown that UGE influences plant growth and development by regulating nucleotide sugar dynamics (Rösti et al. 2007; Zhang et al. 2021).

[0004] Although current research indicates that UGE mediates the metabolic composition of cell wall polysaccharides, studies on its role in plant flowering have not yet been reported. This invention identifies BnaUGE2 as regulating the growth, development, and flowering period of rapeseed. Altering the flowering period of rapeseed by deleting or overexpressing this gene is of significant importance for the genetic improvement of rapeseed flowering time. Summary of the Invention

[0005] This invention provides the application of the BnaUGE2 gene of Brassica napus in regulating the flowering period of Brassica napus. The BnaUGE2 gene has four homologous copies, and the four homologous genes encode the proteins shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO.8, respectively.

[0006] To achieve the above objectives, the present invention adopts the following technical measures:

[0007] The scope of protection of this invention includes:

[0008] Application of the BnaUGE2 gene in regulating the flowering period of Brassica napus, wherein the BnaUGE2 gene encodes the proteins shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 and / or SEQ ID NO.8.

[0009] The applications described above, specifically:

[0010] Application of increasing the expression level of the BnaUGE2 gene in Brassica napus to advance the flowering period of Brassica napus;

[0011] The above-described application involves introducing a substance that enhances the expression of the BnaUGE2 gene in Brassica napus into Brassica napus. The substance is an expression cassette containing a gene encoding at least one protein shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, or SEQ ID NO.8, a recombinant vector, or a recombinant microorganism.

[0012] Application of knocking out or inhibiting the expression level of the BnaUGE2 gene in Brassica napus in delaying the flowering period of Brassica napus;

[0013] The above-described application involves introducing a substance that reduces or inhibits the expression of the BnaUGE2 gene in Brassica napus into the plant. The substance is an expression cassette, recombinant vector, or recombinant microorganism that reduces or inhibits the expression of the BnaUGE2 gene. The BnaUGE2 gene encodes the protein shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, and SEQ ID NO.8.

[0014] The above-described applications involve knockout using homologous recombination or CRISPR gene editing methods. The knockout gene translates into a protein that has no original function or cannot be translated into a protein.

[0015] In the above-described applications, preferably, when using the CRISPR / Cas9 method for knockout, the selected sgRNAs are 5'-AGAAAATCTTCTCAAGCGCAGG-3' and 5'-TTTCCGGATGCCTTCTCAAAGG-3'.

[0016] The above-described applications involve inhibition using antisense RNA technology or interfering RNA technology.

[0017] The interfering RNA technology described above utilizes VIGS technology.

[0018] Application of reagents for detecting the encoding genes of the proteins shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 and / or SEQ ID NO.8 in screening or breeding of flowering period traits in Brassica napus.

[0019] The method for determining the type of plant in the above-described application is as follows: plants with a significantly increased expression of the gene compared to normal plants are those with an earlier flowering period, while plants with no detected gene or a significantly decreased expression level of the gene compared to normal plants are those with a delayed flowering period.

[0020] The application of expression cassettes, recombinant vectors, or recombinant microorganisms to enhance the expression level of the BnaUGE2 gene in the creation of transgenic Brassica napus with an earlier flowering period, wherein the BnaUGE2 gene encodes the protein shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, or / and SEQ ID NO.8.

[0021] The beneficial results of this invention are as follows:

[0022] This invention discloses a novel function of the BnaUGE2 gene (with homologous copies shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, and SEQ ID NO.7) in regulating flowering in Brassica napus. Functional validation revealed that overexpression of any homologous copy of BnaUGE2 promotes earlier flowering in rapeseed, while complete loss of function of the BnaUGE2 gene delays flowering. This invention not only provides important genetic resources and theoretical basis for the genetic improvement of flowering time in Brassica napus, but also has significant scientific implications for understanding the intrinsic relationship between plant basal metabolism and flowering time regulation. Attached Figure Description

[0023] Figure 1 Evolution and expression pattern analysis of BnaUGE2 in Brassica napus.

[0024] Where a) is the phylogenetic tree of the UGE2 gene in Brassica plants (Arabidopsis thaliana, Chinese cabbage, Brassica napus and Brassica napus type); b) is the expression level of BnaUGE2 in different tissues of Brassica napus type.

[0025] Figure 2 Protein structure analysis for BnaUGE2.

[0026] Figure 3 This is a schematic diagram illustrating the construction of the BnaC01.UGE2 overexpression vector in Example 3 of the present invention.

[0027] Figure 4 This is a schematic diagram of the construction of the BnaUGE2 gene knockout vector in Example 4 of the present invention.

[0028] Figure 5 Identification of transgenic rapeseed overexpressing BnaC01.UGE2;

[0029] Wherein a) is the PCR identification electrophoresis diagram of transgenic positive plants, M is DNA Marker, + is positive control, and WT is wild-type control; b) is the relative expression level of BnaUGE2 in transgenic lines by qRT-PCR, and * and ** indicate the significance of the difference at the p=0.05 and p=0.01 levels after t'test, respectively.

[0030] Figure 6 Identification of BnaUGE2 loss-of-function mutants;

[0031] Where a) represents the editing type of the sgRNA target site; b) represents the size of the protein encoded by the loss of function of the four homologous copies of BnaUGE2. Both the insertion and deletion of bases lead to premature termination of protein translation.

[0032] Figure 7 Flowering time statistics for BnaC01.UGE2 overexpressing plants and BnaUGE2 loss-of-function mutants;

[0033] Wherein a) is the flowering phenotype diagram of the BnaUGE2 transgenic lines, from left to right: wild type (WT), gene loss mutant (crBnaUGE2-1 and crBnaUGE2-2), and BnaC01.UGE2 overexpression lines (OX-12 and OX-14); b) is the statistical data of flowering time, and different letters indicate the significance of differences at the p=0.05 level after one-way ANOVA and LSD test.

[0034] Figure 8 Statistics on the silique traits of BnaC01.UGE2 overexpressing plants and BnaUGE2 loss-of-function mutants;

[0035] Where a) represents the statistics of silique length and b) represents the statistics of the number of siliques per silique. Different letters indicate the significance of the differences at the p=0.05 level after one-way ANOVA and LSD test. Detailed Implementation

[0036] To make the objectives and technical solutions of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be noted that the described embodiments are intended to facilitate understanding of the invention and should not be considered as limiting the scope of protection of the invention. Other embodiments obtained by those skilled in the art based on these embodiments without substantial inventiveness are all within the scope of protection of this invention. Unless otherwise specified, the experimental methods and materials / reagents involved in this invention are conventional choices in the art.

[0037] The invention will be further illustrated below with specific examples:

[0038] Example 1:

[0039] Copy number and evolutionary analysis of BnaUGE2

[0040] Through multi-omics analysis, it is predicted that the BnaUGE2 gene may play an important role in plant growth and development. Two-way alignment of the AtUGE2 protein sequence with those of rapeseed, Chinese cabbage, and cabbage revealed that the gene has four copies in rapeseed: BnaA01G0135100ZS, BnaA03G0476700ZS, BnaC01G0173700ZS, and BnaC07G0455000ZS (hereinafter referred to as BnaA01.UGE2, BnaA03.UGE2, BnaC01.UGE2, and BnaC07.UGE2, respectively). The CDS sequence of BnaC01.UGE2 is shown in SEQ ID NO.1, encoding the protein shown in SEQ ID NO.2; the CDS sequence of BnaA01.UGE2 is shown in SEQ ID NO.3, encoding the protein shown in SEQ ID NO.4; and the CDS sequence of BnaA03.UGE2 is shown in SEQ ID NO.5, encoding the protein shown in SEQ ID NO.4. The CDS sequence of the protein shown in NO.6, BnaC07.UGE2, is shown in SEQ ID NO.7, encoding the protein shown in SEQ ID NO.8.

[0041] Two copies exist in Chinese cabbage, namely BraA03g052910.4C and BraA01g014780.4C; similarly, two homologous genes exist in cabbage, namely BolC1t01842H and BolC7t45818H.

[0042] The protein sequence of BnaUGE2 from Brassica napus was compared with protein sequences from Arabidopsis thaliana, Chinese cabbage, and Brassica oleracea (sequences from TAIR (https: / / www.arabidopsis.org / ) and BnIR (https: / / yanglab.hzau.edu.cn / BnIR)) in MEGA-X using the maximum likelihood method for amino acid homology alignment and phylogenetic analysis. The results are as follows: Figure 1 As shown, BnaUGE2 exists in clusters with homologous proteins in Chinese cabbage and kale, and its A and C genomic copies cluster with Chinese cabbage and kale sequences, respectively.

[0043] The gene expression of BnaUGE2 in different tissues of Brassica napus was obtained from a public transcriptome database (https: / / yanglab.hzau.edu.cn / BnIR). BnaA01.UGE2 and BnaC01.UGE2 are constitutively expressed genes, with the highest expression in flower buds and petals, while BnaA03.UGE2 and BnaC07.UGE2 show petal-specific high expression. The results are as follows... Figure 1 show.

[0044] Example 2:

[0045] Protein sequence and conserved domain analysis of BnaUGE2

[0046] UGE2 encodes a UDP-glucose-4-epimerase involved in the metabolism and conversion of nucleoside sugars in plant cell walls. To predict the function of BnaUGE2, the protein sequences of BnaUGE2 and AtUGE2 were submitted to CD-search on the NCBI website for comparison and analysis of conserved domains (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / cdd.shtml). The protein sequences of Arabidopsis thaliana and Brassica napus are highly similar, mainly containing four domains: NAD binding site, active site, homodimerization interface, and substrate binding site. The results are as follows: Figure 2 As shown.

[0047] Example 3:

[0048] Construction of BnaUGE2 gene overexpression vector

[0049] To verify the function of BnaUGE2, the applicant constructed overexpression vectors of the BnaA01.UGE2, BnaA03.UGE2, BnaC01.UGE2 and BnaC07.UGE2 genes, respectively. In this embodiment, the construction process of the overexpression vector of the BnaC01.UGE2 gene is used as an example for illustration.

[0050] Using B409 gDNA as a template, primers for homologous recombination were developed using SnapGene software (the forward primer was supplemented with the homologous arm of KpnⅠ, and the reverse primer was supplemented with the homologous arm of BamHⅠ). The CDS sequence of BnaC01.UGE2 (BnaC01G0173700ZS, the amplified sequence containing the polynucleotide shown in SEQ ID NO.1) was amplified using a high-fidelity enzyme. The amplification primers were:

[0051] C01-flag-F:CCTGCAGGAGCTCGGTACCATGGTGAAGAACGTTCTG

[0052] C01-flag-R: CTCTAGAGGATCCAGAGGAGCCATTGGAGG.

[0053] The amplified target fragment was cloned into the pCAMBIA1305-flag vector via homologous recombination. This vector exhibits hygromycin resistance in plants. The construction diagram of the BnaC01.UGE2 gene overexpression vector is shown below. Figure 3 As shown.

[0054] Example 4: Construction of the BnaUGE2 gene knockout vector

[0055] As described in Example 1, the BnaUGE2 gene has four homologous copies in Brassica napus. To verify the function of the BnaUGE2 gene in the growth and development of Brassica napus, this invention designed two sgRNAs, sgRNA1 and sgRNA2, targeting the conserved domains of the four homologous copies of BnaUGE2 when designing the CRISPR / Cas9 vector. sgRNA1 is located in the second exon of the gene, and sgRNA2 is located in the seventh exon. Their sequences are: sgRNA1: 5'-AGAAAATCTTCTCAAGCGCAGG-3' and sgRNA2: 5'-TTTCCGGATGCCTTCTCAAAGG-3'. The expression vector is PKSE401, and the BnaUGE2 gene knockout vector is constructed as follows: Figure 4 As shown. For detailed instructions on constructing the knockout vector, refer to Professor Chen Qijun of China Agricultural University (Xing et al. 2014), the steps are as follows:

[0056] 1. Design sgRNAs using the online website: http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR. Select sgRNAs that target conserved domains and have a GC content greater than 40%.

[0057] 2. Select appropriate sgRNA primers to design: 5-DT1-BsF, 5-DT1-F0, 5-DT2-R0, and 5-DT2-BsR. Use PCBC-DT1DT2 as a template for PCR amplification, and the amplified fragment size is 626 bp.

[0058] 3. The product was purified and recovered. An enzyme digestion-ligation system was established with PCR fragment: 2 μL, PKSE401: 2 μL, T4 Ligase: 1 μL, Bsa I: 1 μL, T4 Buffer: 1.5 μL, 10*BSA: 1.5 μL and ddH2O: 6 μL. The reaction conditions were 37 ℃ for 5 hours, 50 ℃ for 5 min, and 80 ℃ for 10 min.

[0059] 4. The ligation product was transformed into *E. coli*. Colony PCR and sequencing were used to identify the correct vector for subsequent studies. The primers for vector construction and colony PCR are as follows:

[0060] 5-DT1-BsF: ATATATGGTCTCGATTGAGAAAATCTTCTCAAGCGCGTT

[0061] 5-DT1-F0:TGAGAAATCTTCTCAAGCGCGTTTTAGAGCTAGAAATAGC

[0062] 5-DT2-R0:AACTTGAGAAGGCATCCGGAAACAATCTCTTAGTCGACTCT AC

[0063] 5-DT2-BsR:ATTATTGGTCTCGAAACTTGAGAAGGCATCCGGAAACAA

[0064] U626-F: TGTCCCAGGATTAGAATGATTAGGC

[0065] U629-R: AGCCCTCTTTCTTTCGATCCATCAAC.

[0066] Example 5:

[0067] Obtaining transgenic lines of Brassica napus

[0068] The overexpression vector prepared in Example 3 or the gene knockout vector prepared in Example 4, which had correct sequencing, were transformed into Agrobacterium GV3101 via freeze-thaw transformation, and then transformed into Brassica napus B409 using Agrobacterium-mediated hypocotyl genetic transformation.

[0069] 1. Identification of BnaUGE2 overexpression lines

[0070] In this embodiment, transgenic plants overexpressing the BnaC01.UGE2 gene were used as an example for screening and verification. Fifteen transgenic regenerated seedlings obtained from the T0 generation were positively identified. Total DNA was extracted from rapeseed leaves using the CTAB method, and PCR was performed using the pCAMBIA1305-flag universal primer (Flag-R) and the BnaUGE2 intermediate primer (C01UGE2-JF). The PCR amplification system consisted of: 1 μL template, 0.5 μL left and right primers, 5 μL 2x Taq Master Mix (Novitamin), and 3 μL ddH2O. The PCR reaction program was: 95 ℃ pre-denaturation for 5 min, 95 ℃ denaturation for 30 sec, 58 ℃ annealing for 30 sec, 72 ℃ extension for 30 sec, 35 cycles, followed by a final extension at 72 ℃ for 10 min, and the PCR product was removed at 25 ℃. A total of 15 positive seedlings were obtained by 1% agarose gel electrophoresis. Figure 5 (a) The primer sequences for identification are as follows:

[0071] C01UGE2-F:GAACGGGTAATGGAACATCAGTTC

[0072] Flag-R: GCTGGTGACCTCACTTATCGTCATC.

[0073] In the T1 generation, the overexpression effect of the obtained overexpression lines was detected. Total RNA was extracted from rapeseed using a polysaccharide-polyphenol RNA extraction kit (Tiangen). The concentration and purity of the RNA samples were determined using a NanoDrop 2000 / 2000C spectrophotometer (ThermoScientific, USA) (1.8 < 260 OD / 280 OD < 2.0). After the integrity of the extracted RNA was verified by gel electrophoresis, it was used for reverse transcription of the first strand of cDNA.

[0074] cDNA was synthesized using a reverse transcription kit (TronGold), and the overexpression effect of BnaC01.UGE2 in positive seedlings was detected by qRT-PCR. The rapeseed BnaACTIN7 gene was used as an internal control. The qRT-PCR reaction system consisted of 8.4 μL of cDNA template, 0.8 μL each of the left and right primers (10 μM), and SYBR Green. ® Green Real-time PCR Master Mix 10 μL. The qRT-PCR amplification program was as follows: 95 ℃ for 2 min (1 cycle); 95 ℃ for 10 sec, 60 ℃ for 10 sec, 72 ℃ for 30 sec (40 cycles); melting curves were plotted from 65 ℃ to 95 ℃ at a rate of 0.1 ℃ / sec. Quantitative results were obtained using 2...−ΔΔCt Analysis results (Livakand Schmittgen 2001). The expression was significantly increased in four lines: OX-8, OX-12, OX-14, and OX-16. Figure 5 As shown in b). The primer sequences used for qRT-PCR analysis of BnaC01.UGE2 and BnaACTIN7 are as follows:

[0075] qC01E2-F:TCCCGGCAAATCTCTTCGATG

[0076] qC01E2-R: CCTTTTGGAGGTTATGTCTCAGTT

[0077] BnaActin7-F:AAGTACTCTTCCAGCCGTCGC

[0078] BnaActin7-R: ATCTGTTGGAAAGTGCTGAGGG.

[0079] Using the above method, the expression of the corresponding genes BnaA01.UGE2, BnaA03.UGE2 and BnaC07.UGE2 in plants was also verified, and the expression of the corresponding genes in the plants was significantly enhanced.

[0080] 2. Identification of BnaUGE2 loss-of-function mutants

[0081] Editing detection was performed on transgenic regenerated seedlings obtained in the T0 generation. A total of 35 positive seedlings were obtained, and high-throughput sequencing technology (Hi-TOM) (Liu et al. 2019) was used to detect editing at the target sites. First, target-specific primers were designed to amplify the four homologous genes of BnaUGE2 by PCR. Then, using the first-round PCR products as templates, a second round of amplification was performed using universal barcoding primers. The second-round PCR products were mixed in equal amounts and used for next-generation sequencing. Finally, the sequencing results were analyzed using the HI-TOM online website (http: / / www.hi-tom.net / hi-tom / ) to determine the mutation type at each target site in the positive seedlings. Seeds from the T0 generation edited seedlings were harvested, and homozygous loss-of-function mutants, crBnaUGE2-1 and crBnaUGE2-2, were isolated in the T1 and T2 generations, respectively. In the crBnaUGE2-1 strain, four copies of BnaUGE2 terminated prematurely due to a single-base insertion at sgRNA1, reducing the number of encoded amino acids from 384 to 70. In the crBnaUGE2-2 strain, BnaA01.UGE2, BnaC01.UGE2, and BnaC07.UGE2 terminated prematurely due to a single-base insertion at sgRNA1, reducing the number of encoded amino acids from 384 to 70. BnaA03.UGE2, however, lost 6 bases at sgRNA1 and 8 bases at sgRNA2, leading to premature protein termination and reducing the number of encoded amino acids to 296. The results are as follows: Figure 6 As shown. The primers used to detect the genotype of the target site are as follows:

[0082] E5A01T2-F:ggagtgagtacggtgtgcACCGTTCTTTGGAACTGACTATAAC

[0083] E5A01T2-R:gagttggatgctggatggAAACAAACCAGATCAATGTTTGTT

[0084] E5A01T1-F:ggagtgagtacggtgtgcGCTTCAACTTCTCAACGGTGGA

[0085] E5A01T1-R:gagttggatgctggatggGCTTTCAATCATACTTAGTTTCAGAG

[0086] E5C01T1-F:ggagtgagtacggtgtgcTTGCCTGCAGGTGGATCTCA

[0087] E5C01T1-R:gagttggatgctggatggCCAAAAGGATAACAGTGCCAAAAAG

[0088] E5C01T2-F:ggagtgagtacggtgtgcACGGGTAATGGAACATCAGTT

[0089] E5C01T2-R:gagttggatgctggatggGTCGTCCAGCCAACACCAAA

[0090] E5A03T1-F:ggagtgagtacggtgtgcAGGTGGATCTCCGAGACAGA

[0091] E5A03T1-R:gagttggatgctggatggTAGACAGTAGCTGAGGATGAAAT

[0092] E5A03T2-F:ggagtgagtacggtgtgcAACAAGTTGCGGTTGGTCGG

[0093] E5A03T2-R:gagttggatgctggatggAACAAACCAATCAATGGTTTACC

[0094] E5C07T1-F:ggagtgagtacggtgtgcATGAAGGTGGATCTCCGAGACA

[0095] E5C07T1-R:gagttggatgctggatggCAGCCATAGACTGTAGCCGAC

[0096] E5C07T2-F:ggagtgagtacggtgtgcGGGTAATGGAACATCGGTCCTA

[0097] E5C07T2-R:gagttggatgctggatggGCCATTGGAGGAGGTTGTAGCCA.

[0098] Example 6:

[0099] Statistical observation of flowering time of BnaUGE2 transgenic rapeseed lines

[0100] The Brassica napus lines (WT, crBnaUGE2-1, crBnaUGE2-2, OX-12, and OX-14) obtained in Examples 4 and 5 were planted in a greenhouse at Huazhong Agricultural University (photoperiod 16h / 8h). Eight to twelve plants were planted for each line, and after vernalization, the initial flowering time was recorded. The phenotypes of plant growth and flowering are shown below. Figure 7 Compared to the wild type, OX-12 and OX-14 flowered 4.8 days earlier; conversely, the loss-of-function mutants crBnaUGE2-1 and crBnaUGE2-2 flowered 7 days and 6 days later, respectively, indicating that BnaUGE2 positively regulates flowering in Brassica napus. Figure 7 As shown, WT represents Brassica napus B409.

[0101] The remaining plants overexpressing the BnaA01.UGE2, BnaA03.UGE2, and BnaC07.UGE2 genes flowered earlier by 2 to 6 days. This indicates that overexpressing any homologous copy of the BnaUGE2 gene can yield transgenic rapeseed with earlier flowering.

[0102] Example 7:

[0103] Investigation of silique traits in BnaUGE2 transgenic rapeseed lines

[0104] Analysis of the silique traits of the Brassica napus lines (WT, crBnaUGE2-1, crBnaUGE2-2, OX-12, and OX-14) obtained in Examples 4 and 5 revealed that the silique length of the mutants crBnaUGE2-1 and crBnaUGE2-2 was significantly increased compared to the wild type (4.98±0.22 cm), reaching 5.60±0.17 cm and 5.58±0.17 cm, respectively, while the number of seeds per silique was significantly decreased compared to the wild type (18.44±1.67), reaching 15.29±0.95 and 13.8±1.64, respectively. In contrast, the overexpression lines OX-12 and OX-14 showed no significant differences in silique length and number of seeds per silique compared to the wild type. Figure 8 ).

Claims

1. Brassica napus BnaUGE2 The application of genes in regulating the flowering period of Brassica napus, as described above BnaUGE2 The gene encodes the protein shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 and / or SEQ ID NO.

8.

2. The application according to claim 1, characterized in that: Improve the quality of rapeseed BnaUGE2 Application of gene expression levels in advancing the flowering period of Brassica napus.

3. The application according to claim 2, characterized in that: Its application process involves improving the quality of rapeseed. BnaUGE2 The substance for gene expression is introduced into Brassica napus, wherein the substance is an expression cassette containing a gene encoding a protein shown in at least one of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8, a recombinant vector or a recombinant microorganism.

4. The application according to claim 1, characterized in that: Knockout or inhibition of Brassica napus BnaUGE2 Application of gene expression levels in delaying the flowering period of Brassica napus.

5. The application according to claim 4, characterized in that: Its application process involves reducing the yield of rapeseed of the Brassica oleracea type. BnaUGE2 The introduction of a substance into a plant that reduces or inhibits gene expression, wherein the substance is a substance that lowers or inhibits gene expression. BnaUGE2 Gene expression cassettes, recombinant vectors, or recombinant microorganisms, as described BnaUGE2 The gene encodes the proteins shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO.

8.

6. The application according to claim 5, characterized in that: The knockout method used is homologous recombination or CRISPR gene editing. The protein translated from the knocked-out gene has no original function or cannot be translated into a protein.

7. The application according to claim 6, characterized in that: When using the CRISPR / Cas9 method for knockout, the selected sgRNAs are 5'-AGAAAATCTTCTCAAGCGCAGG-3' and 5'-TTTCCGGATGCCTTCTCAAAGG-3'.

8. Application of reagents for detecting the coding genes of the proteins shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 and / or SEQ ID NO.8 in screening or breeding of flowering period traits in Brassica napus.

9. The application according to claim 8, characterized in that: The method used in its application is as follows: plants with a significantly increased expression of the gene compared to normal plants are those with an earlier flowering period, while plants with no detected gene or a significantly reduced expression level of the gene compared to normal plants are those with a delayed flowering period.

10. Improve BnaUGE2 The application of gene expression cassettes, recombinant vectors, or recombinant microorganisms in the creation of transgenic Brassica napus with early flowering time. BnaUGE2 The gene encodes the protein shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, or / and SEQ ID NO.8.