Application of GmMETTL1 and / or GmWDR4 in regulating drought resistance of plants

Abstract

This invention belongs to the field of plant stress resistance molecular biology and genetic engineering technology, specifically relating to a... GmMETTL1 and / or GmWDR4 Its application in regulating plant drought resistance, the aforementioned GmMETTL1 The base sequence is shown in SEQ ID NO.1. GmWDR4 The base sequence is shown in SEQ ID NO.2. This invention discloses... GmMETTL1 and GmWDR4 This study has been applied to promote the collaborative water retention and stomatal regulation of soybean leaves under drought conditions. For the first time, a protein-protein interaction relationship between GmMETTL1 and GmWDR4 was discovered in soybean, filling the gap in the molecular mechanism by which GmMETTL1 methyltransferase and its interacting protein GmWDR4 synergistically regulate the response of soybean to drought stress. This study is of great significance for the genetic engineering research and germplasm resource creation and utilization of drought-resistant soybeans.

Description

Technical Field

[0001] This invention belongs to the field of plant stress resistance molecular biology and genetic engineering technology, specifically relating to a... GmMETTL1 and / or GmWDR4 Application in regulating plant drought resistance. Background Technology

[0002] Soybeans Glycine max Soybean (L.) Merr. is an annual herbaceous plant belonging to the genus *Glycine* in the legume family. It is the world's fourth most important crop, a significant source of vegetable oil and protein in common foods and animal feed. Soybeans are a valuable food and oilseed crop, but their yield is severely affected by drought.

[0003] Different plant species, or even different age stages of the same plant, exhibit varying mechanisms of drought resistance. For instance, plants adapt to drought by closing stomata or accumulating osmotic regulators such as proline. To cope with oxidative stress caused by drought, plants immediately activate their antioxidant systems to maintain reactive oxygen species within appropriate ranges. For example, the physiological responses of soybeans to drought include changes in antioxidant activity, osmotic regulation, photosynthetic efficiency, stomatal conductance, and root development. Furthermore, various regulatory networks at the molecular level, such as those involved in signal transduction, can significantly enhance the physiological responses of soybeans to drought stress. Moreover, numerous studies have shown that lignin biosynthesis increases significantly under drought stress. Lignin can slow down the osmotic flow and transpiration of water from plant cell walls, helping plants maintain osmotic balance and protect cell membrane integrity. In complex environments, different plants respond differently at different levels to the effects of drought stress.

[0004] Drought is a major environmental factor among abiotic stresses. Plants grown in water-scarce environments inevitably experience a significant decline in both quality and yield. Therefore, identifying drought-responsive genes in soybeans and verifying their functions can provide candidate gene resources for breeding drought-resistant soybean varieties. Summary of the Invention

[0005] The purpose of this invention is to provide a GmMETTL1 and / or GmWDR4 Its application in plant drought resistance solves the problems existing in the current technology.

[0006] The technical solution adopted in this invention is:

[0007] This invention provides GmMETTL1 and / or GmWDR4 Its application in regulating plant drought resistance, the aforementioned GmMETTL1 The base sequence is shown in SEQ ID NO.1. GmWDR4The base sequence is shown in SEQ ID NO.2.

[0008] Preferably, the regulation refers to any one of the following:

[0009] 1) Overexpression in plants GmMETTL1 and / or GmWDR4 Prepare overexpression plants to improve the drought resistance of plants;

[0010] 2) Silence in plants GmMETTL1 and / or [[ID=!2]]GmWDR4 Silent plants were prepared to reduce the drought resistance of plants.

[0011] Preferably, the method for preparing the overexpression plant is as follows:

[0012] S1, clone separately GmMETTL1 and GmWDR4 ;

[0013] S2, will GmMETTL1 and / or GmWDR4 The recombinant overexpression vector was inserted into a plant expression vector.

[0014] S3. Transform the recombinant overexpression vector into Agrobacterium rhizogenes to obtain recombinant Agrobacterium rhizogenes;

[0015] S4. The plant was infected with recombinant Agrobacterium rhizogenes and cultured to obtain the overexpressed plant.

[0016] Preferably, the plant expression vector is pCAMBIA3301-eGFP.

[0017] Preferably, the Agrobacterium rhizogenes is K599.

[0018] Preferably, for cloning GmMETTL1 The primer sequences are shown in SEQ ID NO.11 and SEQ ID NO.12;

[0019] Used for cloning GmWDR4 The primer sequences are shown in SEQ ID NO.13 and SEQ ID NO.14.

[0020] Preferably, the plant is soybean or Arabidopsis thaliana.

[0021] Preferably, the drought resistance includes at least one of leaf water retention and stomatal regulation.

[0022] Compared with the prior art, the beneficial effects of the present invention are:

[0023] This invention provides GmMETTL1 and / or GmWDR4Its application in regulating plant drought resistance, the aforementioned GmMETTL1 The base sequence is shown in SEQ ID NO.1. GmWDR4 The base sequence is shown in SEQ ID NO.2. This invention discloses... GmMETTL1 and GmWDR4 In the collaborative promotion of leaf water retention and stomatal regulation in soybeans under drought conditions, a protein-protein interaction between GmMETTL1 and GmWDR4 was discovered for the first time in soybean. Through transgenic engineering, overexpression of GmMETTL1 and GmWDR4 was successfully obtained. GmMETTL1 and GmWDR4 Transgenic hair roots; using silenced genes GmMETTL1 and GmWDR4 The VIGS gene technology yielded transiently silenced plants, filling the gap in understanding the molecular mechanism by which GmMETTL1 methyltransferase and its interacting protein GmWDR4 synergistically regulate the response of soybean to drought stress. This lays the foundation for further research on the molecular mechanisms of leaf water retention and stomatal regulation in soybean response to drought, and is of great significance for genetic engineering research and germplasm resource creation and utilization of drought-resistant soybeans.

[0024] To further verify GmMETTL1 and GmWDR4 To leverage the cross-species conserved function of genes, this invention constructed overexpression transgenic lines in the model plant Arabidopsis thaliana. Phenotypic analysis under drought stress revealed that overexpression... GmMETTL1 or GmWDR4 Arabidopsis plants exhibited significantly enhanced drought tolerance, and the trends in leaf water retention capacity and antioxidant indices were consistent with those of transgenic soybean hairy roots. This result confirms the functional conservation of the GmMETTL1-GmWDR4 complex in plant drought resistance, providing cross-species evidence for its application in stress resistance breeding across various crops. Attached Figure Description

[0025] Figure 1 Under drought stress GmMETTL1 and GmWDR4 Expression level analysis in soybean leaves. A: GmMETTL1 B: GmWDR4 .

[0026] Figure 2 for GmMETTL1 and GmWDR4 A schematic diagram of CDS sequence amplification. A: GmWDR4 B: GmMETTL1 .

[0027] Figure 3The results represent yeast two-hybrid assays. pGBKT7-p53+pGADT7-T served as the positive control, pGBKT7-lam+pGADT7-T as the negative control, pGBKT7-GmMETTL1+pGADT7-T as the self-activation detection control, pGBKT7-GmMETTL1+pGADT7-GmWDR4 as the experimental group, SD / -Leu-Trp as a double-deficient medium lacking leucine and tryptophan, and SD / -Leu-Trp-Ade-His+X-α-gal as a quadruple-deficient colorimetric medium lacking leucine, tryptophan, adenine, and histidine.

[0028] Figure 4 Results of the dual-luciferase reporter system. A: Schematic diagram of Agrobacterium tumefaciens bacterial suspension injection; B: Interaction verification of cLUC-GmMETTL1 and nLUC-GmWDR4.

[0029] Figure 5 This is the result of bimolecular fluorescence complementarity.

[0030] Figure 6 This diagram illustrates the process of cultivating soybean hairy roots. A: Injecting soybean; B: Water retention stage; C: Induction of hairy roots; D: Soil cultivation stage; E: Hydroponic stage; F: Obtaining soybean hairy root plants.

[0031] Figure 7 For overexpression GmMETTL1 Hair root positive detection image and overexpression GmWDR4 A diagram showing a positive result for hairline root detection. A: GmMETTL1 B: ​ .

[0032] ​ Overexpression under drought stress ​ and / or ​ Phenotypic analysis diagram of hairy-rooted plants.

[0033] ​ Overexpression under drought stress ​ DAB staining and NBT staining images of leaves from soybean hairy-rooted plants. A: NBT staining image; B: DAB staining image.

[0034] ​ Overexpression under drought stress ​ Physiological indicators analysis of soybean hairy-root plants. A: Catalase activity; B: Malondialdehyde content; C: Peroxidase activity; D: SOD activity; E: Lignin content; F: Proline content.

[0035] ​ Overexpression under drought stress ​DAB staining and NBT staining images of leaves from soybean hairy-rooted plants. A: NBT staining image; B: DAB staining image.

[0036] ​ Overexpression under drought stress ​ Physiological indicators analysis of soybean hairy-root plants. A: Catalase activity; B: Malondialdehyde content; C: Peroxidase activity; D: SOD activity; E: Lignin content; F: Proline content.

[0037] ​ Overexpression under drought stress ​ and / or ​ A comparative analysis of stomatal diameter and stomatal conductance in leaves of hairy-rooted plants. A: Stomatal diameter; B: Stomatal conductance. ​ For overexpression ​ plants, ​ For overexpression ​ plants, ​ For simultaneous overexpression ​ and ​ The plant.

[0038] ​ For soybeans ​ and ​ A schematic diagram of VIGS fragment sequence amplification. A: ​ VIGS fragment; B: ​ VIGS fragment.

[0039] ​ For soybean plants that are momentarily silenced under drought stress ​ and ​ Gene expression level analysis diagram. A: ​ Gene expression level; B: ​ Gene expression levels.

[0040] ​ Soybeans under drought stress ​ and ​ Phenotypic analysis of silent plants. A~C represent soybean plants with normal watering and empty vectors, respectively. ​ Silent plants and ​ Silent plants; D~F are soybean plants with empty vector after drought stress, in order. ​ Silent plants and ​ Silent plant.

[0041] ​ Soybeans under drought stress ​ and ​ Analysis of physiological indicators changes in silent plants. A: Catalase activity; B: Malondialdehyde content; C: Chlorophyll content; D: Relative water content; E: Dry weight; F: Fresh weight.

[0042] ​ For different drought stress ​ Phenotypic analysis diagram of Arabidopsis thaliana plants.

[0043] ​ For different drought stress ​ 1. Results of physiological index changes in Arabidopsis thaliana plants. A: CAT activity assay; B: SOD activity assay; C: POD activity assay; D: Malondialdehyde content assay; E: Proline content assay; F: Lignin content assay.

[0044] ​ For different drought stress ​ Phenotypic analysis diagram of Arabidopsis thaliana plants.

[0045] ​ For different drought stress ​ Analysis of physiological parameters of Arabidopsis thaliana plants. A: CAT enzyme activity assay; B: Lignin content assay; C: POD enzyme activity assay; D: SOD enzyme activity assay. Detailed Implementation

[0046] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.

[0047] The inventive concept of this invention is as follows:

[0048] The methyltransferase family, or METTLs, are a class of key enzymes that play an important role in drought stress, responding to plant abiotic stress through tRNA modification. They have been identified in multiple species, but their function and molecular mechanism in soybean remain unclear. The WDR family, another member of the METTL-WDR interaction system, is also widely present in plant life cycles, mainly involved in signal transduction, gene expression regulation, and antioxidant systems. WDR proteins can form the MBW complex with MYB and bHLH transcription factors, regulating the synthesis of flavonoids and osmotic regulators. Studies suggest they may play a role in plant immunity and stress responses, but the specific homologs and functions of WDR4 in plants require further investigation. WDR4 acts as a scaffold protein, stabilizing METTL1 and promoting its catalytic activity in animals. This invention, through various experiments, confirms that the soybean homolog GmMETTL1 and GmWDR4 have a direct and specific interaction, forming a functional complex. Research on the interaction regulation of METTL1 and WDR4 in plants is still in the preliminary exploratory stage. With the increasing research on plant RNA modification, this complex is expected to become a new target for crop stress resistance breeding, filling a key gap in the "RNA epigenetics-translational regulation-environmental adaptation" network.

[0049] However, the specific functional mechanisms, synergistic effects, and molecular pathways of GmMETTL1 and its interacting protein GmWDR4 in soybean in plant resistance to abiotic stress have not been systematically studied. Current reports on the METTL-WDR complex mainly focus on animal models or tumor progression, while research on similar family members in plants largely focuses on other stress-response genes. No literature has revealed the function of this specific complex, METTL1-WDR4, in crop stress resistance, and there is a lack of evidence regarding its mechanism of enhancing drought tolerance through synergistic regulation of the antioxidant system and lignin synthesis pathway, while simultaneously promoting leaf water retention and stomatal regulation.

[0050] It is worth noting that this invention is the first to employ a cross-species homologous gene mining strategy: through human... ​ Gene sequence and ​ Gene sequence alignment of the soybean genome successfully identified soybean homologous genes. ​ and ​ This fills a species-specific gap in the study of the gene function of this complex in soybean.

[0051] ​ The base sequence is shown in SEQ ID NO.1. ​ The base sequence is shown in SEQ ID NO.2.

[0052] SEQ ID NO.1:

[0053] 。

[0054] SEQ ID NO.2:

[0055]

[0056] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.

[0057] This invention analyzed and investigated the expression pattern of soybean methyltransferase GmMETTL1 and its interacting protein GmWDR4 in response to drought stress. This invention successfully cloned... ​ and ​ Genes, and using genetic engineering techniques, were transiently transformed to obtain overexpression. ​ and / or ​ Transgenic soybean hairy roots; simultaneously, using virus-induced gene silencing technology VIGS to construct... ​ and / or ​ The transiently silent plant. Through the above functional verification system, the study efficiently and accurately explored... ​ and ​ Molecular mechanisms of synergistic regulation of water retention and stomatal regulation in soybean leaves and their application potential in enhancing soybean drought resistance.

[0058] Example 1

[0059] ​ and / or ​ Its application in regulating soybean drought resistance is as follows:

[0060] 1. ​ and ​ The determination.

[0061] Due to the existing technology regarding ​ and ​ The research mainly focuses on humans, in order to explore... ​ and ​ This invention investigates homologous genes and their characteristics in soybeans. First, it constructs a BLAST library from soybean genomic data. Then, it uses human... ​ Genes and ​ Gene homology screening is performed using the following command parameters: blastn-queryref.fa-db Glycine_max.db-outfmat 6-out mapping_result.txt-task megablast-evalue 1e-50-word_size 32-dust yes-num_threads 10.

[0062] Candidate genes obtained from BLAST screening were further analyzed for conserved domains using the PFAM and NCBI CDD databases. Candidate genes containing conserved methyltransferase domains and WD40 repeat motifs were identified, respectively. After quantitative verification, these genes were finally anchored in soybeans. ​ The homologous gene is Glyma.03G15590; ​ The homologous gene is Glyma.04G07870.

[0063] Specifically, it includes:

[0064] (1) Obtain the soybean reference genome Glycine max Wm82.a6.v1 file. ​ The gene sequence was obtained. To investigate the evolutionary relationship between the soybean METTL methyltransferase family and other species, the PFAM database in the uniprot database was used, selecting common soybean. ​ Wild soybean, a close relative of common soybean ​ ​ Asian cultivated rice ​ subsp. ​ Wild rice ​ ​ var. ​ and the model plant Arabidopsis thaliana ​ and tobacco ​ ​ Genes from six species that also possess this conserved domain were subjected to phylogenetic analysis.

[0065] (2) Protein interaction analysis specifically involves downloading the target gene via NCBI. ​ After obtaining the protein sequences, the online website String was used to predict possible interacting proteins of the candidate genes based on the sequence information. It was found that GmWDR4 and GmMETTL1 may have a protein-protein interaction relationship. String online website: https: / / cn.string-db.org

[0066] 2. ​ and ​ Applications in the synergistic regulation of soybean drought resistance include the following:

[0067] 2.1 ​ and / or ​ The effect of overexpression on drought resistance in soybeans.

[0068] (1) Using the soybean reference genome file, obtain ​ Gene sequence, ​ Family evolutionary analysis, the methyltransferase ​ The nucleotide sequence is shown in SEQ ID NO.1.

[0069] (2) Interaction analysis of the GmMETTL1 protein was performed using the String website, revealing a possible protein-protein interaction between GmWDR4 and GmMETTL1. ​ The nucleotide sequence is shown in SEQ ID NO.2.

[0070] (3) Cultivate soybean seedlings to the first three-leaf stage, i.e., V1 stage, apply drought stress, and use quantitative PCR to determine and analyze the effects of drought stress. ​ Genes and ​ Gene expression levels.

[0071] (4) Obtained from soybeans by using gene cloning methods ​ and ​ Furthermore, various experimental methods were used to verify the interaction between the proteins encoded by the two.

[0072] (5) GmMETTL1 Genes and GmWDR4 Genes were inserted downstream of the 35S promoter of a plant expression binary vector to construct a plant overexpression vector.

[0073] (6) Take the product obtained in step (5) containing GmMETTL1 Plant overexpression vectors containing genes GmWDR4 The plant overexpression vector of the gene was transformed into Agrobacterium rhizogenes K599 to obtain recombinant Agrobacterium rhizogenes for soybean transformation.

[0074] (7) Recombinant Agrobacterium rhizogenes was transiently transformed into soybean tissue, and fluorescent labeling was used for visual screening to obtain overexpression samples verified by fluorescence imaging. GmMETTL1 and / or GmWDR4 Hairy roots.

[0075] (8) Phenotypic and physiological index analyses were performed on the overexpressing plants under drought stress to verify... GmMETTL1 and / or GmWDR4 Effects of overexpression on drought resistance of soybean hairy roots.

[0076] 2.2 GmMETTL1 and GmWDR4 The impact of silence on soybean drought resistance.

[0077] (1) Gene cloning was used to clone from soybeans a gene for constructing transiently silent plants. GmMETTL1 Special fragments and GmWDR4 Specific fragments.

[0078] Used to construct transiently silent plants GmMETTL1 The sequence of the specific fragment is shown in SEQ ID NO.3; used to construct transiently silent plants.GmWDR4 The sequence of the specific fragment is shown in SEQ ID NO.4.

[0079] SEQ ID NO.3:

[0080] ATGTCTGAGACTGAGGTAAATCCAACTATCAGCAAGTCAACTGGATTGCCTCGAAAGCGCTTCTATCGAGCACGAGCACAGCAATCCACTGAGTGACTCTCACTTCCCAGTGCCAATTTCACCCAGCCATGTTGACTATTCTCTCCATTACCCTCAGTTATTTCCCTTGTCTGGTCAAGCTGATAGTTCCAAAAAGAT.

[0081] SEQ ID NO.4:

[0082] ATGGTTACAGGTGTCTCTGGTCTACCTGGTTTTAATTATCCCTCTTTGGCTTGTGTGCGAGTAATTTCCAGTATTGATGTTGAGAAAGAGCCAGTTGTTCTGGGAGATGATAACATTCCTGGGGGAGAAAAACTACTAGAAACGTTGCAA GGATCTGCATCCGTTGATGACAATGCTTTTCTAGCAGCAGCTGAAGCAGTCAAAACAGCAATGTGCAACCTATTGATAAAAAAACAATACCCTTCAGAGAATAGAGAATATAGGAAGAAAAGCAGAAATGATAGAAAACTCAAGGGTTAG.

[0083] (2) The obtained SEQ ID NO.3 and SEQ ID NO.4 were cloned into the plant VIGS silencing vector to construct the pTRV2-GmMETTL1 recombinant silencing vector and the pTRV2-GmWDR4 recombinant silencing vector, respectively.

[0084] (3) The two recombinant silencing vectors were transformed into Agrobacterium GV3101 to obtain an Agrobacterium engineered strain for transient gene silencing in soybean.

[0085] (4) Using the Agrobacterium engineered strain described in (3) to infect soybean leaves, to achieve GmMETTL1 and GmWDR4 The transient silencing was achieved, and the expression level of the target gene in the silenced plants was detected by qPCR to verify the silencing efficiency.

[0086] (5) Phenotypic and physiological index analysis were performed on silent plants under drought stress to evaluate GmMETTL1 and GmWDR4 The effect of transient silence on the drought resistance of soybeans.

[0087] 3. GmMETTL1 and [[ID= Expression patterns in drought stress response.

[0088] This invention measured ​ and ​ The expression level under drought stress was: ​ and ​ This lays the foundation for collaborative efforts to promote drought resistance in soybeans.

[0089] This invention utilizes 8% (w / v) PEG8000 to subject V1 stage soybean seedlings to drought stress treatment at different time gradients. Total RNA was extracted from soybean leaves at different stress times, and using this RNA as a template, reverse transcription was performed using the TransScript® Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR kit to harvest cDNA. ​ Genes were used as internal controls, and primers for them were synthesized; simultaneously, primers were designed. ​ and ​ Specific primers were used. Detection was performed using real-time quantitative PCR on an Mx3000P real-time quantitative PCR instrument. ​ and ​ Expression levels were determined through three biological replicates. In this invention, 2... ΔΔCT The algorithm calculates the relative expression level of the target gene. Table 1 shows the detection... ​ and ​ Primers for relative expression levels.

[0090] Table 1 ​ and ​ Primers for detecting relative expression levels

[0091]

[0092] ​ This invention illustrates the following: ​ and ​ Response to drought stress ​ In the figure, the horizontal axis represents the treatment time with PEG8000, and the vertical axis represents the relative expression level. At 0 h of drought stress, [the following data was collected / distributed]. ​ The expression level was set to 1; drought stress lasted from 1 h to 12 h. ​ The expression level was slightly greater than 1; after 24 hours of drought stress, ​ The expression level was close to 10; after 48 hours of drought stress,​ The expression level decreased to approximately 2.3. Meanwhile, when drought stress was set to 0 h... ​ The expression level was 1; during drought stress from 1 h to 12 h. ​ Expression level slightly greater than 1; 24h under drought stress ​ The expression level was close to 3; after 48 hours of drought stress, ​ The expression level decreased to approximately 1.5. These results show... ​ and ​ In response to drought stress, the expression levels of both genes showed a significant upregulation, and the trends of change were consistent. ​ and ​ The expression levels showed a trend of first increasing and then decreasing after being subjected to drought stress, and reached the highest level at 24 hours.

[0093] ​ The concentration of PEG8000 in soybean seedling leaves under 8% (w / v) PEG8000 stress was [missing information]. ​ and ​ The expression analysis, among which ​ As an internal reference gene. ​ The results show ​ and ​ It is responsive to osmotic pressure stress generated under drought conditions simulated by PEG8000. Each set of data represents the mean ± SD of three repeated experiments.

[0094] 4. Verify the interaction between GmMETTL1 and GmWDR4.

[0095] cDNA was cloned from soybean seedlings using gene cloning methods. ​ and ​ .according to ​ and ​ Specific primers were designed based on the coding sequence, and their sequences are shown in Table 2. PCR amplification was performed using cDNA as a template based on these specific primers to obtain... ​ and ​ .

[0096] Specifically, PCR amplification was performed using cDNA from the soybean variety "Williams 82" as a template to obtain the target gene. The PCR program was: 98℃ for 1 min; 98℃ for 10 s, 58℃ for 5 s, 72℃ for 15 s, 30 cycles; 72℃ for 1 min. The PCR products were ligated into the pMD19-T cloning vector to obtain the GmMETTL1T and GmWDR4T recombinant plasmids. After sequencing, analysis, and splicing, the desired gene was obtained. ​ and ​ The full-length sequences of the two target genes in soybean were obtained through the above steps.

[0097] Table 2 PCR amplification primers

[0098]

[0099] ​ It shows ​ and ​ A schematic diagram of CDS sequence amplification, compared using DNAMAN software, shows that the obtained CDS sequence is consistent with the sequence obtained from the soybean reference genome file. ​ In the middle, M: DL2000 marker, ​ In A, lanes 1-6 represent the detection lanes. ​ Six biological replicates; ​ In B, lanes 1-6 represent the detection lanes. ​ Six biological replicates.

[0100] Get ​ and ​ After obtaining the gene sequence, in order to confirm the interaction between GmMETTL1 and GmWDR4, a combination of yeast two-hybrid assay, dual luciferase reporter system and bimolecular fluorescence complementation assay were used for verification.

[0101] The results of the yeast two-hybrid experiment are shown in ​ Preliminary verification of the interaction between GmMETTL1 and GmWDR4; results from the dual-luciferase reporter system are shown below. ​ The interaction strength between GmMETTL1 and GmWDR4 was quantitatively verified in tobacco leaf cells; the results of bimolecular fluorescence complementation are shown in […]. ​ The interaction and subcellular localization of GmMETTL1 and GmWDR4 were visualized in living tobacco leaf cells.

[0102] 5. The effect of drought stress on overexpression ​ and / or ​ The effect of soybean hairy roots.

[0103] 1) Using molecular cloning technology, to ​ and ​ The genes were inserted into plant expression vectors containing expression regulatory elements such as promoters to construct the pCAMBIA3301-eGFP-GmMETTL1 recombinant overexpression vector and the pCAMBIA3301-eGFP-GmWDR4 recombinant overexpression vector.

[0104] The construction process of the pCAMBIA3301-eGFP-GmMETTL1 recombinant overexpression vector is as follows:

[0105] Homologous recombination primers pCAMBIA3301eGFP-GmMETTL1-F and pCAMBIA3301eGFP-GmMETTL1-R were synthesized, and PCR amplification was performed using GmMETTL1T as a template. ​ Subsequently, after enzymatic digestion, cleaning and recovery, and ligation transformation of the vector, the... ​ The recombinant overexpression vector pCAMBIA3301-eGFP was obtained by forward insertion downstream of the CaMV35S promoter of the pCAMBIA3301-eGFP vector and complete sequencing.

[0106] The construction process of the pCAMBIA3301-eGFP-GmWDR4 recombinant overexpression vector is as follows:

[0107] Homologous recombination primers pCAMBIA3301eGFP-GmWDR4-F and pCAMBIA3301eGFP-GmWDR4-R were synthesized, and PCR amplification was performed using GmWDR4T recombinant plasmid as a template. ​ Subsequently, after enzymatic digestion, cleaning and recovery, and ligation transformation of the vector, the... ​ The recombinant overexpression vector pCAMBIA3301-eGFP was obtained by forward insertion downstream of the CaMV35S promoter of the pCAMBIA3301-eGFP vector and complete sequencing.

[0108] Table 3 lists the homologous recombination primers used in constructing the recombinant overexpression vector.

[0109] Table 3 ​ and ​ Homologous recombination primers for recombinant overexpression vectors

[0110]

[0111] 2) Transform pCAMBIA3301-eGFP-GmMETTL1 and / or pCAMBIA3301-eGFP-GmWDR4 into Agrobacterium rhizogenes to obtain recombinant Agrobacterium rhizogenes for soybean transformation, as detailed below:

[0112] The correctly sequenced pCAMBIA3301-eGFP-GmMETTL1, pCAMBIA3301-eGFP-GmWDR4, and pCAMBIA3301-eGFP empty vector were transformed into Agrobacterium rhizogenes K599 competent cells using the freeze-thaw method. After colony PCR identification, recombinant Agrobacterium rhizogenes containing pCAMBIA3301-eGFP-GmMETTL1, recombinant Agrobacterium rhizogenes containing pCAMBIA3301-eGFP-GmWDR4, and recombinant Agrobacterium rhizogenes containing the empty pCAMBIA3301-eGFP vector were obtained.

[0113] ​ This diagram illustrates the soybean hairy root cultivation process in an embodiment of the invention. From cultivating soybean seedlings and injecting recombinant Agrobacterium hairy rooting to inducing hairy roots, approximately 42 days are required. When soybeans reach one week of age, the recombinant Agrobacterium hairy rooting bacterial solution is injected. The solution is injected in a cross pattern 2 cm from the hypocotyl of the cotyledonary node, and the injection site is then covered with the solution. Sufficient Hoagland nutrient solution is poured into the tray to provide nutrients for the injected soybean plants. To maintain a high humidity environment at the injection wound and the covered recombinant Agrobacterium hairy rooting to induce hairy root formation, the plants are sealed and wrapped to retain moisture. After one week of moisture retention, the plastic film is removed. At this point, the soybean wound begins to swell and hairy roots grow. The area where hairy roots are induced is then buried in vermiculite, and soil is added to continue inducing hairy root growth. Two weeks later, the plants were removed from the vermiculite, the roots were cleaned and the main root of the soybean was cut off. They were then transferred to Hoagland culture medium for hydroponic cultivation to allow the seedlings to recover. After two more weeks of cultivation, the soybean plants with hairy roots were obtained and then subjected to drought stress treatment.

[0114] The verification principle of soybean hairy root plants is as follows: After the pCAMBIA3301-eGFP vector, modified with an added eGFP tag, is transferred into soybean hairy roots, it emits green fluorescence at a specific wavelength. This invention utilizes fluorescent labeling for visual screening in a dark environment to obtain positive soybean hairy roots verified by fluorescence imaging. ​ Overexpression is shown in an embodiment of the present invention. ​ Hair root positive detection image and overexpression ​ A positive result for hair roots.

[0115] overexpression ​ The hairy-rooted plant was designated GmMETTL1-OE, and overexpression of... ​ The hairy-rooted plant was designated GmWDR4-OE, and it also overexpressed... ​ and ​ The hairy-rooted plant is designated as GmMETTL1 / GmWDR4-OE.

[0116] In this embodiment of the invention, after subjecting hairy-root plants to drought stress for 48 hours, phenotypic changes in the plants were observed, and the results are shown in the figure. ​ Under normal hydroponic conditions, all plants grew well with no significant differences. However, after 48 hours of drought stress treatment, the control group plants carrying the empty vector showed obvious stress symptoms, namely severe wilting and leaf yellowing; in contrast, the overexpressing... ​ and / or ​ The plants exhibited stronger drought tolerance, showing less wilting and more vibrant green, fully expanded leaves, indicating that overexpression of these two genes significantly enhanced the plants' drought resistance under hydroponic conditions. Furthermore, samples were taken to analyze changes in various physiological indicators.

[0117] ​ In this embodiment of the invention, analysis using DAB staining and NBT staining revealed that under drought stress, overexpression of [a specific substance] was observed. ​ The accumulation of hydrogen peroxide and superoxide anions in the leaves of the hairy-rooted plants was significantly lower than that in the empty vector group, indicating that... ​ Genes play an important role in regulating plant oxidative stress response.

[0118] In this embodiment of the invention, in ​ In China, overexpression under drought stress ​ The lignin content of the hairy-rooted plants of the gene was increased to 1.2 times that of the empty vector plants, CAT enzyme activity was about 20% higher, SOD enzyme activity was about 40% higher, malondialdehyde content decreased by 13%, and POD enzyme activity increased by 25%. ​ Overexpression of the gene increases lignin content, promotes cell wall remodeling under drought conditions, reduces water loss, and enhances the antioxidant capacity of plants under stress.

[0119] Based on the analysis of DAB and NBT staining results, this invention found that under drought stress conditions, overexpression ​ The accumulation of hydrogen peroxide and superoxide anions in the leaves of the hairy-rooted plants was significantly lower than that in the empty vector group, see ​ ,hint ​ Genes play an active role in regulating reactive oxygen species homeostasis and antioxidant responses in plants.

[0120] This invention ​ In China, under drought stress, overexpression ​ In the hairy-rooted plants of the gene, lignin content, CAT enzyme activity, and SOD enzyme activity were all significantly higher than those in the empty vector group; lignin content was upregulated to 1.6 times that of the empty vector plants, CAT enzyme activity was about 25% higher, SOD enzyme activity was 55% higher, proline content increased significantly by 2.9 times, while malondialdehyde content decreased by 14%. This indicates that... ​Overexpression of this substance can enhance lignin accumulation, which may help strengthen and remodel the cell wall, thereby reducing water loss; at the same time, it can increase the activity of antioxidant enzymes and enhance the plant's tolerance to drought stress.

[0121] Under normal moisture conditions, overexpression ​ and / or ​ The effect on stomatal parameters of plant leaves was minimal, showing no significant difference compared to plants grown from empty vectors. This indicates that... ​ and / or ​ Under non-stress conditions, stomata may be in a low-activity state, or their regulatory pathways may not be activated, and stomata remain open to maintain photosynthesis and transpiration. However, under drought stress, a plant defense response is triggered, and relevant drought resistance signaling pathways are activated, leading to stomatal closure to reduce water loss. (See below) ​ . ​ and ​ The two drought-resistance genes had similar effects. Single-gene overexpression further reduced the average stomatal diameter to around 6 μm and stomatal conductance to around 0.1, showing significant differences compared to the empty vector. With dual-gene overexpression, stomatal diameter and stomatal conductance decreased significantly by 66.7% and 60% respectively compared to the empty vector, and by 87.5% and 89.1% respectively compared to non-stress conditions. It is evident that dual-gene overexpression resulted in a synergistic effect in the plant's response to drought stress, more effectively regulating stomatal closure and thus enhancing water retention capacity.

[0122] In this embodiment of the invention, based on the phenotypic advantages of the double transgenic group and the functional data of single genes, a correlation analysis of physiological indicators was conducted. It was found that the significant drought resistance phenotype of the double transgenic group was consistent with the trends of increased SOD activity and lignin content in the single gene data, indicating synergistic effect. Furthermore, a molecular mechanism correlation was conducted: the GmMETTL1-GmWDR4 complex may achieve a "1+1>2" effect in plant water retention capacity by simultaneously regulating antioxidant response and cell wall reinforcement.

[0123] 6. The effects of drought stress on soybeans ​ and ​ The effect of VIGS-silenced plants.

[0124] The gene was cloned from a stable gene template, namely the GmMETTL1T recombinant plasmid, using gene cloning methods. ​ The gene-specific fragment GmMETTL1_CDS_200bp was cloned from the GmWDR4T recombinant plasmid. ​ Gene-specific fragment GmWDR4_CDS_300bp. According to ​ and ​ Based on the gene's CDS sequence, combined with its protein domain characteristics and gene exon distribution, specific primers for amplifying the TRV silencing fragment were designed. The primer sequences are shown in Table 4.

[0125] Amplification using specific primers yielded GmMETTL1_CDS_200bp and GmWDR4_CDS_300bp. The nucleotide sequence of GmMETTL1_CDS_200bp is shown in SEQ ID NO.3; the nucleotide sequence of GmWDR4_CDS_300bp is shown in SEQ ID NO.4.

[0126] Specifically, PCR amplification was performed using GmMETTL1T and GmWDR4T recombinant plasmids as templates to obtain specific fragments. The PCR program was 98℃ for 1 min; 98℃ for 10 s, 58℃ for 5 s, 72℃ for 5 s, 30 cycles; 72℃ for 1 min. The PCR gel purification products were sequenced, and the fragment sequences of GmMETTL1_CDS_200bp and GmWDR4_CDS_300bp were obtained after analysis and comparison.

[0127] Table 4. Specific primers used for amplifying TRV silencing fragments

[0128]

[0129] PCR amplification was performed using GmMETTL1T and GmWDR4T recombinant plasmids as templates to obtain GmMETTL1_CDS_200bp and GmWDR4_CDS_300bp. ​ The diagram illustrates the amplification of the TRV silencing fragments, namely GmMETTL1_CDS_200bp and GmWDR4_CDS_300bp sequences, in an embodiment of the present invention. The short fragment sequences obtained were completely consistent with the selected specific fragment sequences when compared using DNAMAN software.

[0130] ​ In A, lanes 1 through 4 represent the detection lanes. ​ Four biological repeats of a short sequence; ​ In B, lanes 1 through 5 represent the detection lanes. ​ Five biological repeats of the short sequence.

[0131] The obtained GmMETTL1_CDS_200bp and GmWDR4_CDS_300bp were cloned into the plant VIGS silencing vector, respectively, to construct the recombinant silencing vectors pTRV2-GmMETTL1 and pTRV2-GmWDR4. The construction of the pTRV2-GmMETTL1 and pTRV2-GmWDR4 recombinant silencing vectors included:

[0132] Design homologous recombination primers, as detailed in Table 5.

[0133] Construction of pTRV2-GmMETTL1: Using GmMETTL1_CDS_200bp as a template and pTRV2-GmMETTL1-F and pTRV2-GmMETTL1-R as primers, the homologous arm sequence of GmMETTL1_CDS_200bp was amplified by PCR. After vector digestion, cleaning and recovery, and ligation transformation, GmMETTL1_CDS_200bp was inserted forward into the downstream of the CaMV35S promoter of the pTRV2 vector. After sequencing confirmed to be correct, the recombinant silencing vector pTRV2-GmMETTL1 was obtained.

[0134] Construction of pTRV2-GmWDR4: Using GmWDR4_CDS_300bp as a template and pTRV2-GmWDR4-F and pTRV2-GmWDR4-R as primers, the homologous arm sequence of GmWDR4_CDS_300bp was amplified by PCR. After vector digestion, cleaning and recovery, and ligation transformation, GmWDR4_CDS_300bp was inserted forward into the downstream of the CaMV35S promoter of the pTRV2 vector. After sequencing confirmed to be correct, the recombinant silencing vector pTRV2-GmWDR4 was obtained.

[0135] Table 5. Primers for homologous recombination of pTRV2-GmMETTL1 and pTRV2-GmWDR4

[0136]

[0137] Specifically, the obtained recombinant silencing vectors pTRV2-GmMETTL1 and pTRV2-GmWDR4, the empty vector pTRV2, and the empty vector pTRV1 were transformed into Agrobacterium GV3101 to obtain an engineered Agrobacterium strain for transient gene silencing in soybeans, namely:

[0138] The correctly sequenced pTRV2-GmMETTL1, pTRV2-GmWDR4, pTRV2 empty vector, and pTRV1 empty vector were transformed into Agrobacterium GV3101 competent cells using the freeze-thaw method. Colony PCR identification yielded pTRV2-GmMETTL1 recombinant positive bacteria, pTRV2-GmWDR4 recombinant positive bacteria, pTRV2 empty vector positive bacteria, and pTRV1 empty vector positive bacteria.

[0139] Soybeans can be injected with VIGS infection solution when they reach the second three-leaf stage. 36 hours after injection, the leaves of the injected plants are examined. ​ and ​ Expression level detection ​ and ​ The primers for expression level detection are shown in Table 1. Therefore, pTRV:: ​ and pTRV:: ​Transiently silenced plants and soybean plants transfected with pTRV::00 empty vector. After drought stress treatment, the leaves of the injected plants were then... ​ and ​ Expression level detection results are shown in [link to results]. ​ .

[0140] In this embodiment of the invention, silent plants were subjected to drought stress for 8 days, and the phenotypic changes of the plants were observed. ​ As shown, the plants in each group grew well and uniformly under normal watering conditions. However, after 8 days of drought stress treatment, pTRV2:: ​ and pTRV2:: ​ The plants were severely wilted, indicating significant stress compared to pTRV::00. Further analysis was conducted to examine changes in various physiological indicators.

[0141] In this embodiment of the invention, silence ​ and ​ Following gene silencing, transiently silenced plants exhibited a drought-sensitive phenotype. ​ middle, ​ and ​ Compared with plants transgenic empty vector, transiently gene-silenced plants showed a 50% increase in H2O2 accumulation, a 1.9-fold significant upregulation of MDA content in leaves, and a 20% decrease in chlorophyll content. ​ Gene-silenced plants exhibited a 25% decrease in the relative water content of their leaves. ​ Gene-silenced plants exhibited a 42% decrease in relative leaf water content. (Note: This likely refers to a specific genetically engineered plant.) ​ and ​ Transient gene silencing may weaken the plant's reactive oxygen species scavenging capacity, leading to damage to the antioxidant system and negatively impacting the photosynthetic system. Hairy root and VIGS experiments indicate that GmMETTL1 and GmWDR4 may participate in the molecular mechanisms of leaf water retention and stomatal regulation in soybean response to drought stress by forming a protein complex that synergistically regulates lignin synthesis and the accumulation of osmotic regulatory substances.

[0142] This invention proposes ​ and ​ Collaborative efforts have facilitated the functional application of drought-resistant genes in soybeans, and through transgenic engineering technology, soybeans overexpressing these genes have been successfully obtained. ​ and ​ Transgenic hair-like root system; using gene silencing ​ and ​The VIGS gene technology yielded transiently silenced soybean VIGS plants, filling the gap in understanding the molecular mechanism by which the METTL1 methyltransferase and its interacting protein WDR4 synergistically regulate the response of soybean to drought stress. This lays the foundation for further research on the molecular mechanisms of leaf water retention and stomatal regulation in soybean response to drought, and is of great significance for the genetic engineering research and germplasm resource creation and utilization of drought-resistant soybeans.

[0143] Furthermore, this invention has successfully constructed [a specific organism] in Arabidopsis thaliana. ​ Overexpression transgenic lines OE13 and OE18 and ​ Silent strains ​ , ​ Overexpression transgenic lines OE6 and OE7 and GmWDR4 Silent strains wdr4 Subsequently, changes in the phenotypic and physiological parameters of Arabidopsis thaliana under drought stress were examined, and the results are shown in […]. Figures 18-21 The results were consistent with those in soybeans. This confirms the functional conservation of the GmMETTL1-GmWDR4 complex in plant drought resistance, providing strong evidence for its application in stress-resistance breeding in various crops.

[0144] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0145] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. GmMETTL1 and GmWDR4 Use in the regulation of drought resistance in plants, characterized in that, The GmMETTL1 The base sequence is shown in SEQ ID NO.

1. GmWDR4 The base sequence is shown in SEQ ID NO.2; The plant is soybean or Arabidopsis thaliana. The modulation refers to overexpression in plants GmMETTL1 and GmWDR4 Overexpression plants are prepared to improve the drought resistance of plants.

2. Use according to claim 1, wherein The preparation method of the overexpression plant is as follows: respectively cloned GmMETTL1 and GmWDR4 ; Will GmMETTL1 and GmWDR4 The recombinant overexpression vector was inserted into a plant expression vector. The recombinant Agrobacterium rhizogenes is obtained by transforming the recombinant overexpression vector into Agrobacterium rhizogenes. The plant is infected by using the recombinant Agrobacterium rhizogenes, and is cultured, so that the overexpression plant is obtained.

3. Use according to claim 2, wherein the compound is ###0002### The plant expression vector is pCAMBIA3301-eGFP.

4. The use according to claim 2, wherein The Agrobacterium rhizogenes is K599.

5. The use according to claim 2, wherein the compound is ###0002### For cloning GmMETTL1 The primer sequences for cloning are shown as SEQ ID NO. 11 and SEQ ID NO. 12; For cloning GmWDR4 The primer sequences for cloning are shown as SEQ ID NO. 13 and SEQ ID NO.

14.

6. The use according to claim 1, wherein The improved drought resistance of the plant refers to any one of the following: 1) promoting stomata closure of plant leaves; 2) improving water retention capacity of plant leaves.

Images