Application of GhAGL19 gene in regulating and controlling flowering time of plant

By analyzing the expression pattern of the GhAGL19 gene and performing heterologous expression, the problem of the unclear function of the AGL19 gene in upland cotton was solved, enabling the regulation of flowering time in early-maturing cotton and improving crop yield and economic benefits.

CN121294533APending Publication Date: 2026-01-09INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511757989.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-27
Publication Date
2026-01-09

AI Technical Summary

Technical Problem

In the current technology, the function of the AGL19 gene in upland cotton is not yet clear, which affects the regulation of flowering time of early-maturing cotton and makes it difficult to manage the growth period under limited heat resources.

Method used

Analysis of the expression pattern of the GhAGL19 gene in the genetic standard line TM-1 of upland cotton revealed that it was most highly expressed in stamens and pistils, and even higher in the early-maturing cotton variety ZMS50. Further heterologous expression of GhAGL19 in Arabidopsis thaliana resulted in transgenic plants with earlier flowering time, indicating that the GhAGL19 gene may play a positive regulatory role in flowering time.

Benefits of technology

This study enabled early flowering in cotton and Arabidopsis thaliana through overexpression of the GhAGL19 gene, which promoted the breeding process of early-maturing cotton, increased the multiple cropping index and crop yield, and reduced cotton planting costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294533A_ABST
    Figure CN121294533A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, in particular to application of a GhAGL19 gene in regulation and control of flowering time of plants. The expression modes of the GhAGL19 gene in roots, stems, leaves, terminal buds, petals, stamens and pistils of an upland cotton genetic standard line TM-1 are analyzed, and the result shows that the expression level of the gene in the stamens and pistils is the highest, and the expression level of the gene in the stamens and pistils is the second expression level of the petals, which indicates that the gene is highly expressed in floral organs of cotton and is possibly related to flowering time regulation. Meanwhile, compared with the late-maturing upland cotton variety GX11, the expression level of the GhAGL19 in the early-maturing upland cotton variety ZMS50 is higher. In order to further research the influence of the GhAGL19 on the flowering time, the flowering time of a transgenic plant obtained by heterologous expression of the GhAGL19 in arabidopsis thaliana is earlier than that of a wild type plant, which indicates that the GhAGL19 gene possibly has a positive regulation effect on the flowering time of cotton.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to... GhAGL19 The application of genes in regulating plant flowering time. Background Technology

[0002] Early-maturing cotton possesses several significant characteristics. Compared to conventional cotton varieties, its entire growth period is typically much shorter. Furthermore, early-maturing cotton plants exhibit a short and compact morphology, exhibiting excellent lodging resistance. These characteristics allow early-maturing cotton to increase the multiple cropping index, boost crop yield and economic benefits, while also reducing planting costs and field management inputs. In areas with relatively limited heat resources, planting early-maturing cotton allows for the completion of cotton growth and development within a limited growing season, avoiding the adverse effects of prolonged growing seasons and autumn low temperatures, thus ensuring cotton yield and quality. Therefore, identifying cotton flowering-related genes, elucidating their regulatory mechanisms, and creating superior germplasm resources for early-maturing cotton are of great significance for the breeding and industrialization of early-maturing cotton varieties.

[0003] MADS-box is a family of transcription factors that play a crucial role in plant growth and development. Its name comes from the four genes initially discovered to contain this conserved domain: MCM1 , AGAMOUS , DEFICIENS and SRF The proteins encoded by the MADS-box gene family all contain a highly conserved MADS-box domain, which consists of approximately 56-60 amino acids and is primarily involved in DNA binding and protein-protein interactions. Currently, many genes in the MADS-box gene family have been found to be involved in the regulation of flowering time. SOC1 (Suppressor of Overexprection of Constances 1) can interact with other transcription factors to promote downstream flowering-related genes such as LFY The expression of (LEAFY) promotes flowering. AGL24 (AGAMOUS-LIKE 24) can be used in the process of regulating flowering time. SOC1 It forms heterodimers, enhancing the activation of downstream flowering genes. Furthermore, AGL19 Activable FT The expression of this protein advances the flowering time of Arabidopsis thaliana. The interaction between BjuAGL19 and BjuAGL24 proteins in mustard activates... BjuSOC1 The expression of this promotes flowering. However, AGL19 Homologous genes in upland cotton GhAGL19 Its functionality still needs further research. Summary of the Invention

[0004] To address the above problems, the present invention provides GhAGL19 The application of genes in regulating plant flowering time, this invention... GhAGL19 The expression patterns of the gene in the roots, stems, leaves, terminal buds, petals, stamens, and pistils of the upland cotton genetic standard line TM-1 were analyzed. The results showed that the gene expression level was highest in the stamens and pistils, followed by the petals, indicating high expression of this gene in the floral organs of cotton, which may be related to the regulation of flowering time. Furthermore, compared with the late-maturing upland cotton variety GX11, GhAGL19 The expression level was higher in the early-maturing upland cotton variety ZMS50. Further research is needed. GhAGL19 The effect on flowering time: This invention uses heterologous expression in Arabidopsis thaliana. GhAGL19 The earlier flowering time of the transgenic plants compared to the wild type indicates that... GhAGL19 Genes may play a positive regulatory role in the flowering time of plants.

[0005] To achieve the above objectives, the present invention provides the following technical solution: This invention provides GhAGL19 The application of genes in regulating plant flowering time.

[0006] Preferred, overexpression GhAGL19 Genes positively regulate the flowering time of plants.

[0007] Preferably, the plant includes cotton and / or Arabidopsis thaliana.

[0008] Preferably, the GhAGL19 The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0009] Preferably, the GhAGL19 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 2.

[0010] Preferably, when the plant is cotton, the GhAGL19 The gene is highly expressed in the pistils, stamens, and petals of cotton.

[0011] This invention also provides a method for obtaining early-flowering transgenic plants, comprising the following steps: 1) GhAGL19 Genes are ligated with vectors to obtain ligation vectors; GhAGL19 The nucleotide sequence of the gene is shown in SEQ ID No. 1; 2) The ligation vector obtained in step 1) is transformed into Agrobacterium tumefaciens to obtain the transformed bacteria; 3) Infect plants with the transforming bacteria obtained in step 2) to obtain early-flowering transgenic plants.

[0012] Preferably, the vector in step 1) includes the PBI121 vector; The connected system includes: 5×CEⅡBuffer 2µl, Exnase Ⅱ 1µl, PBI121 carrier 25~100ng, GhAGL19 Gene 10-100ng, add ddH2O to 10µl; The connection conditions include: a temperature of 37°C and a time of 30 minutes; The PBI121 vector was ligated after double digestion with XbaI and SacI enzymes.

[0013] Preferably, step 2) involves Agrobacterium tumefaciens, which includes Agrobacterium tumefaciens GV3101; the linker is transformed into Agrobacterium tumefaciens using a freeze-thaw method.

[0014] Preferably, the plant in step 3) includes Arabidopsis thaliana and / or cotton.

[0015] The beneficial effects of this invention are: This invention relates to GhAGL19 The expression patterns of the gene in the roots, stems, leaves, terminal buds, petals, stamens, and pistils of the upland cotton genetic standard line TM-1 were analyzed. The results showed that the gene expression level was highest in the stamens and pistils, followed by the petals, indicating high expression of this gene in the floral organs of cotton, which may be related to the regulation of flowering time. Furthermore, compared with the late-maturing upland cotton variety GX11, GhAGL19 The expression level was higher in the early-maturing upland cotton variety ZMS50. Further research is needed. GhAGL19 The effect on flowering time: This invention uses heterologous expression in Arabidopsis thaliana. GhAGL19 The earlier flowering time of the transgenic plants compared to the wild type indicates that... GhAGL19 Genes may play a positive regulatory role in cotton flowering time. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0017] Figure 1 for GhAGL19 A diagram illustrating gene expression patterns, left side. GhAGL19 Gene expression patterns in different tissues of upland cotton variety TM-1; right side shows... GhAGL19 Gene expression patterns at different flower bud differentiation stages in early-maturing and late-maturing cotton varieties; Figure 2 for GhAGL19 Image showing that Arabidopsis thaliana with gene overexpression has an earlier flowering time. Detailed Implementation

[0018] This invention provides GhAGL19 The application of genes in regulating plant flowering time.

[0019] In this invention, the GhAGL19 The nucleotide sequence of the gene is shown in SEQ ID No. 1, as follows: .

[0020] In this invention, the GhAGL19 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 2, as follows: MVRRRTQMKRIENAASRQVTFSKRRNGLLKKAFELSVLCDAEVALIIFSPRGKLYEFSSSSTNKTIERYQKRQKDIHGISSKGEDMQDDVKEDAHSLAKKIESLEDSKRKLLGHGLEPCSIDDLLLLEKQLERSLSRIRARKNQVFTEQIKKLKEEERRLGEENANLREECGMRPRESTSTRQSDDERNMEVETELCIGPPERRCKLKP.

[0021] In this invention, overexpression GhAGL19 Genes are preferred to positively regulate the flowering time of plants. In this invention, the plant preferably includes cotton and / or Arabidopsis thaliana. In this invention, when the plant is cotton, the... GhAGL19 Genes are preferred and highly expressed in the pistils, stamens, and petals of cotton.

[0022] This invention also provides a method for obtaining early-flowering transgenic plants, comprising the following steps: 1) GhAGL19 Genes are ligated with vectors to obtain ligation vectors; GhAGL19 The nucleotide sequence of the gene is shown in SEQ ID No. 1; 2) The ligation vector obtained in step 1) is transformed into Agrobacterium tumefaciens to obtain the transformed bacteria; 3) Infect plants with the transforming bacteria obtained in step 2) to obtain early-flowering transgenic plants.

[0023] This invention will GhAGL19 Genes are ligated with vectors to obtain ligation vectors; GhAGL19 The nucleotide sequence of the gene is shown in SEQ ID No. 1. In this invention, the vector preferably comprises the PBI121 vector. In this invention, the ligation system preferably comprises: 2 µl of 5×CEⅡBuffer, 1 µl of Exnase Ⅱ, and 25-100 ng of PBI121 vector. GhAGL19 Gene 10-100 ng, ddH2O added to 10 µl. In this invention, the preferred ligation conditions include: temperature 37°C, time 30 min. In this invention, the PBI121 vector is preferably ligated after double digestion with XbaI and SacI enzymes. This invention does not specifically limit the double digestion method; those skilled in the art can use conventional double digestion methods.

[0024] This invention transforms the obtained linker vector into *Agrobacterium tumefaciens* to obtain the transformed bacteria. In this invention, the *Agrobacterium tumefaciens* preferably includes *Agrobacterium tumefaciens* GV3101. This invention preferably uses a freeze-thaw method to transform the linker vector into *Agrobacterium tumefaciens*. This invention does not have specific limitations on the freeze-thaw method; conventional methods can be used by those skilled in the art.

[0025] This invention uses the transformed bacteria to infect plants, resulting in early-flowering transgenic plants. In this invention, the plants preferably include Arabidopsis thaliana and / or cotton. This invention does not specifically limit the method used for infecting plants with the transformed bacteria; conventional methods can be used by those skilled in the art.

[0026] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0027] Example 1 I. Experimental Materials 1.1 Cotton Material The cotton materials selected for this experiment were the upland cotton genetic standard line TM-1, the early-maturing material ZMS50, and the late-maturing material GX11, planted in the experimental field of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences (Baibi Town, Anyang City, Henan Province), and managed under normal field management practices. Sampling methods included roots, stems, leaves, terminal buds, petals, stamens, and pistils of the TM-1 variety, and shoot tip tissue from the first to fifth true leaf stage of the early-maturing material ZMS50 and the late-maturing material GX11. Immediately after sampling, the samples were placed in liquid nitrogen and stored at -80°C before RNA extraction.

[0028] 1.2 Reagents and Consumables Restriction endonucleases, modifying enzymes, PCR reaction system-related enzymes, homologous recombinases, gel extraction kits, cloning kits, and plasmid miniprep kits were purchased from Novizan Biotechnology Co., Ltd.; quantitative fluorescence kits were purchased from Kangwei Century Biotechnology Co., Ltd.; and RNA extraction kits were purchased from Beijing Tiangen Biotech Co., Ltd.

[0029] Other medicines: Agarose was purchased from BIOWEST, Spain; peptone, yeast extract, sodium chloride, etc. were purchased from Beijing Aoboxing Biotechnology Co., Ltd.; chloroform, isoamyl alcohol, ethanol, and isopropanol were purchased from Sinopharm Chemical Reagent Co., Ltd.; kanamycin and other antibiotics were purchased from Solarbio Biotechnology Co., Ltd.; and Escherichia coli competent cells DH5α and Agrobacterium competent cells were purchased from Qingke Biotechnology Co., Ltd.

[0030] Culture media: LB liquid medium: Tryptone 10 g / L, Yeast extract 5 g / L, Sodium chloride (NaCl) 10 g / L; LB solid medium: Tryptone 10 g / L, Yeast extract 5 g / L, Sodium chloride (NaCl) 10 g / L, Agar powder 15 g / L, bring to a final volume of 1 L; LB selective medium: Before plating LB, add the appropriate concentration of antibiotics after autoclaving and cooling to 55 degrees Celsius, shake well, and then plate; 1 / 2 MS solid medium: 1 / 2 MS 22 g / L, Agar powder 8 g / L, Sucrose 30 g / L.

[0031] Main instruments: PCR amplification instrument (BIO-RAD), high-speed centrifuge (Hettich MIKRO 200R), electrophoresis equipment (BIO-RAD), gel imaging system (BIO-RAD), real-time PCR instrument (ABI7500), electric thermostatic incubator (Shanghai Senxin), thermostatic incubator shaker (Shanghai Zhicheng), artificial climate test chamber (Saifu), artificial climate chamber.

[0032] II. Experimental Methods and Results 2.1 Gene cloning and sequence analysis Obtained from the COTTONOMICS website (http: / / cotton.zju.edu.cn / index.htm / ). GhAGL19 The CDS sequence and encoded amino acid sequence of the gene (gene ID GH_D12G2456) are as follows: the CDS sequence is 630 bp and encodes 209 amino acids. This gene is named... GhAGL19 And its functions are studied.

[0033] GhAGL19 The CDS sequence is (SEQ ID No. 1): ATGGTGAGACGGAGAACCCAGATGAAGAGAATAGAAAATGCAGCAAGCAGGCAAGTAACCTTCTCAAAACGAAGAAATGGGTTGCTTAAAAAGGCCTTTGAGTTATCAGTTCTCTGCGATGCTGAAGTTGCACTCATCATCTTCTCTCCCAGAGGGAAGTTATATGAGTTTTCTAGTTCTAGTACGAACAAAACAATAGAACGGTATCAGAAGAGACAGAAGGATATTCATGGAATCAGCAGCAAAGGGGAAGATATGCAGGATGATGTAAAGGAAGACGCTCACAGCCTGGCGAAGAAGATCGAATCTCTCGAAGATTCTAAAAGAAAACTCCTGGGACATGGATTAGAACCATGTTCTATTGACGATCTGCTACTGTTAGAAAAGCAGTTGGAACGAAGCTTAAGCCGAATTAGGGCAAGAAAGAATCAGGTATTCACGGAGCAAATCAAGAAGCTAAAAGAAGAGGAGAGACGCCTTGGGGAAGAAAATGCAAATCTGCGTGAAGAGTGTGGGATGCGACCACGAGAATCAACGTCAACAAGGCAATCGGATGATGAGCGGAACATGGAGGTGGAGACGGAATTGTGTATAGGCCCACCGGAGAGAAGATGTAAACTAAAACCCTAG。

[0034] GhAGL19 The encoded amino acid sequence is (SEQ ID No.2): MVRRRTQMKRIENAASRQVTFSKRRNGLLKKAFELSVLCDAEVALIIFSPRGKLYEFSSSSTNKTIERYQKRQKDIHGISSKGEDMQDDVKEDAHSLAKKIESLEDSKRKLLGHGLEPCSIDDLLLLEKQLERSLSRIRARKNQVFTEQIKKLKEEERRLGEENANLREECGMRPRESTSTRQSDDERNMEVETELCIGPPERRCKLKP。

[0035] 2.2 Pattern analysis To further investigate the expression pattern of this gene in cotton tissues, this example selected TM-1 and extracted RNA from roots, stems, leaves, flower buds, petals, stamens, pistils, and fibers. qRT-PCR technology was used to analyze the expression of this gene. GhAGL19 An analysis of organizational expression patterns was conducted.

[0036] 2.2.1 Sampling and Grinding Select TM-1, and place the roots, stems, leaves, flower buds, petals, stamens, pistils and fibers in liquid nitrogen. Grind them into powder using a mortar and pestle, and take about 1g of the sample into a 1.5ML centrifuge tube.

[0037] 2.2.2 Extraction RNA extraction was performed using the FastPure Universal Plant Total RNA Isolation Kit (Novozymes, Nanjing, China). The specific steps are as follows: (1) The experiment was carried out at room temperature. 600 μl of Buffer PSL (polyphenol polysaccharide plant) was immediately added to the centrifuge tube containing plant tissue. The sample was vortexed vigorously for 30 seconds to ensure that the sample and lysis buffer were thoroughly mixed. The sample was centrifuged at 12,000 rpm (134,00×g) for 5 min and then the subsequent operations were carried out immediately.

[0038] (2) Take about 500 μl of the supernatant into FastPure gDNA-Filter Columns III (FastPure gDNA-Filter Columns III) (Already placed in the collection tube), centrifuge at 12,000 rpm (13,400 × g) for 30 sec, discard the FastPuregDNA-Filter Columns III, and collect the filtrate.

[0039] (3) Add 0.5 times the volume of the filtrate to the collection tube, and vortex to mix for 15 seconds. Transfer the mixture to FastPure RNA Columns V (FastPure RNA Columns V is already in the collection tube), centrifuge at 12,000 rpm (13,400 × g) for 30 seconds, and discard the filtrate.

[0040] (4) Add 700 μl of Buffer RWA to FastPure RNA Columns V, centrifuge at 12,000 rpm (13,400× g) for 30 sec, and discard the filtrate.

[0041] (5) Add 500 μl of Buffer RWB to FastPure RNA Columns V (please check before use whether 48 ml of anhydrous ethanol has been added, centrifuge at 12,000 rpm (13,400 × g) for 30 sec, and discard the filtrate).

[0042] (6) Repeat step 5.

[0043] (7) Put FastPure RNA Columns V back into the collection tube and centrifuge at 12,000 rpm (13,400 × g) for 2 min.

[0044] (8) Transfer FastPure RNA Columns V to a new RNase-free Collection Tubes 1.5ml centrifuge tube, add 30-100 μl of RNase-free ddH2O to the center of the adsorption column membrane, and centrifuge at 12,000 rpm (13,400 × g) for 1 min.

[0045] ▲The recommended elution volume is no less than 30 μl; too small a volume will affect the nucleic acid recovery efficiency.

[0046] ▲The following steps can help increase the concentration of RNA products: Add RNase-free ddH2O and let stand at room temperature for 5 minutes; Add the first elution buffer back to the adsorption column for elution.

[0047] (9) The extracted RNA can be used directly for downstream experiments or stored at -85 ~ -65℃.

[0048] 2.2.3 Synthesis of Reverse Transcription cDNA The synthesis of reverse-transcribed cDNA was performed using the HiScript® II Q RT SuperMix for qPCR (+gDNAwiper) kit (Novozymes, Nanjing, China). The reaction consisted of two parts: removal of genomic gDNA and reverse transcription of RNA. The reaction was carried out on ice, and the steps are as follows: (1) Removal of genomic gDNA Table 1 Reaction system configuration reagents Dosage RNase-free ddH2O to 16 µl 4 × gDNA wiper Mix 4 µl template RNA 1 pg - 1 µg Mix gently by pipetting. Incubate at 42°C for 2 minutes.

[0049] (2) Preparation of reverse transcription reaction system Table 2 Reverse Transcription Reaction System reagents Dosage The reaction solution in the first step 16μl 5 × HiScript II qRT SuperMix II 4.0 μl Gently mix the mixture using a pipette, and incubate 20 μl of the mixture in a PCR instrument at 50°C for 15 min, followed by 85°C for 5 sec. The product can be used immediately for qPCR reactions, or stored at -20°C and used within six months.

[0050] 2.2.4 Quantitative Real-Time PCR (1) GhAGL19 The gene-specific primers are shown in the table below. (Using cotton...) GhUBQ7 The gene is an internal reference gene.

[0051] Table 3 GhAGL19 Gene-specific primers Gene name Forward primers (5' to 3') Reverse primers (5' to 3') SEQ ID No.3: GACGCCTGGGGGAAGAAAATGC SEQ ID No.:4:TCCATGTTCCGCTCATCATCCG SEQ ID No.5: AGAGGTCGAGTCTTCGGACA SEQ ID No.6: ACAGTGCCAGCAGAGTTTCCAG (2) Real-time PCR The procedure was performed using the Cwbio (China) UltraSYBR Mixture (Low ROX) kit and an AppliedBiosystems 7500 instrument. The specific steps are as follows: 1) Dilute the above-mentioned cDNA stock solution 5 times; 2) Preparation of the reaction system (operation on ice): Table 4 Reaction System reagents Dosage 2×UltraSYBR Mixture 10.0 μl PCR Forward Primer (10 μM) 0.4 μl PCR Reverse Primer (10 μM) 0.4 μl cDNA template (diluted working solution) 2.0 μl <![CDATA[dH2O (Sterile distilled water)]]> up to 20 μl Mix the prepared system thoroughly, centrifuge until no air bubbles remain, and then perform quantitative real-time PCR using Applied Biosystems 7500: Set up the PCR program according to the two-step method: pre-denaturation: 95℃ for 2 min; 95℃ for 5 s; 60℃ for 34 s (collect fluorescence signal in this step), set these two steps for 40 cycles; finally, perform melting curve analysis: 95℃ for 15 s; 60℃ for 20 s; 95℃ for 15 s.

[0052] 2.2.5 GhAGL19 Quantitative results analysis GhAGL19 The relative expression levels in the roots, stems, leaves, flower buds, petals, stamens, and pistils of TM-1 cotton were analyzed using 2 -ΔΔt Method calculation. By Figure 1 It can be seen that, GhAGL19 The gene was expressed at the highest level in the pistil, followed by the stamen and petals, and at a lower level in the stem and root, indicating that the gene is highly expressed in the floral organs of cotton, which may be related to the regulation of flowering time.

[0053] 2.3 GhAGL19 Gene cloning and PBI121- GhAGL19 Construction of plant expression vectors 2.3.1 GhAGL19 Gene cloning primer design Will GhAGL19 The full-length CDS sequence was ligated into the PBI121 vector to construct a 35S promoter vector. Primers containing suitable restriction enzyme sites were designed at the start and stop codons. The restriction enzyme sites used for the PBI121 vector were XbaI and SacI.

[0054] GhAGL19 The primer sequences for the restriction enzyme sites are as follows: Table 5 GhAGL19 Enzyme restriction site primer sequence Primer name Primer sequences (5' to 3') PBI121-GhAGL19-F SEQ ID No.7: CACGGGGGACTCTAGAATGGTGAGACGGAGAACCCAG PBI121-GhAGL19-R SEQ ID No.8: GATCGGGGAAATTCGAGCTCCTAGGGTTTTAGTTTACATCTTC 2.3.2 PCR Cloning GhAGL19 Gene (1) PCR reaction system According to the PrimeSTAR GXL DNA polymerase instructions, the PCR reaction system is as follows: Table 6 PCR Reaction System Reagent Name Reagent dosage 5×PrimeSTAR GXL Buffer 10 μl dNTP Mixture 4 μl Primer F (10 μM) 2 μl Primer R (10 μM) 2 μl TM-1 cDNA 2 μl <![CDATA[ddH2O]]> Up to 50 μl (2) PCR reaction procedure:

[0055] (3) Detection of PCR products Take 2 μl of PCR product, add 3 μl of 6×Loading Buffer, mix well, and spot onto a 1% agarose gel. Electrophoresis is used to check if the band size is around 873 bp.

[0056] (4) Purification of PCR products The following steps were taken using a product purification kit (Vazyme, DC301): 1) Under UV light, rapidly cut the gel containing the target DNA fragment, weigh the gel, and 100 mg of gel is equivalent to 100 μl volume, which is taken as one gel volume; 2) Add an equal volume of Buffer GDP. Incubate in a water bath at 50-55°C until the gel is completely dissolved; 3) Place the adsorption column in the collection tube, transfer ≤700 μl of sol solution into the adsorption column, and centrifuge at 12,000×g for 30-60 sec.

[0057] 4) Discard the filtrate and place the adsorption column in the collection tube. Add 300 μl of Buffer GDP to the adsorption column. Let stand for 1 min. Centrifuge at 12,000×g for 30–60 sec.

[0058] 5) Discard the filtrate and place the adsorption column in the collection tube. Add 700 μl of Buffer GW (with anhydrous ethanol added) to the adsorption column. Centrifuge at 12,000×g for 30–60 sec.

[0059] 6) Repeat step 5.

[0060] 7) Discard the filtrate and place the adsorption column in the collection tube. Centrifuge at 12,000 × g for 2 min.

[0061] 8) Place the adsorption column in a 1.5 ml centrifuge tube, add 20-30 μl of sterile water to the center of the column, and let stand for 2 min. Centrifuge at 12,000×g for 1 min. Discard the adsorption column and store the DNA at -20℃.

[0062] 2.3.3 PBI121- GhAGL19 Construction of plant expression vectors (1) Double enzyme digestion and gel recovery of PBI121 plasmid The PBI121 plasmid was double-digested with XbaI and SacI, and the digested products were purified by agarose gel electrophoresis. The digestion reaction system is as follows: Table 7 Enzyme digestion reaction system Reagent Name Reagent dosage XbaI 1 μl SacI 1 μl Cut Smart 5 μl PBI121 plasmid 1 μg <![CDATA[ddH2O]]> Up to 50 μl (2) Ligation of PCR gel-recovered products and enzyme-digested PBI121 plasmid The ligation reaction was performed using the Vazyme homologous recombinase reagent ClonExpress® II One Step Cloning Kit: Table 8 Connection System Reagent Name Reagent dosage 5XCEⅡBuffer 2 μl Exnase II 1 μl PBI121 double enzyme digestion vector 25~100 ng PCR fragments 10~100 ng <![CDATA[ddH2O]]> Up to 10 μl After the system is completed, mix the components by blowing and stirring, and react at 37°C for 30 min.

[0063] (3) Transformation of ligation products into Escherichia coli 1) Add 100 μL of E. coli DH5α competent cells to the ligation reaction system and incubate on ice for 25 min. 2) 42℃ water bath heat shock for 45 s; 3) Ice bath for 2 min; add 700 μL of antibiotic-free LB liquid medium, incubate at 37°C and 200 rpm for 1 h; 4) Centrifuge at 5000 rpm for 1 min, keep about 100 μL of supernatant, mix well and spread on LB plates containing kanamycin resistance; 5) Incubate overnight at 37℃; (4) Detection and sequencing of positive clones 1) Pick single clones from the transformation plate and place them in liquid LB medium containing Kan, and incubate at 37°C in a shaker for 8 h; 2) Verify positive clones by colony PCR. Send the verified single clones to Shangya Biotechnology Co., Ltd. for sequencing, and sequence each sequence in 3 replicates.

[0064] (5) Preservation of positive bacterial culture Add glycerol to the bacterial culture that has been validated by PCR and correctly sequenced, until the final concentration is above 20%, and store at -80℃. Return the correctly sequenced plasmid for transformation of Agrobacterium.

[0065] (6) Transformation of Agrobacterium Transformation of Agrobacterium tumefaciens GV3101 competent cells using the freeze-thaw method: 1) Melt Agrobacterium at -80℃, then insert it into ice in a mixture of ice and water.

[0066] 2) Add 1 μg of plasmid DNA to 100 μl competent cells, mix by hand by tapping the bottom of the tube, and incubate on ice for 5 min, liquid nitrogen for 5 min, 37℃ for 5 min, and ice bath for 5 min in sequence.

[0067] 3) Add 700 μL of antibiotic-free LB liquid medium and incubate at 28°C with shaking for 2-3 hours. 4) Take 100-150 μL of bacterial culture onto an LB agar plate containing kanamycin and rifampin, and invert it to incubate at 28°C for 2-3 days.

[0068] 5) Select positive clones and incubate them at 28°C for 48 h on LB liquid medium with added antibiotics. After PCR verification of the bacterial culture with correct bands, add glycerol and store at -80°C for later use.

[0069] 2.3.4 Agrobacterium-mediated transformation in Arabidopsis thaliana (1) Arabidopsis thaliana culture Colombian wild-type Arabidopsis thaliana was grown in an artificial climate chamber and the pods that had formed were cut off when the plants reached full bloom.

[0070] (2) Arabidopsis inflorescence infection and transformation 1) Activation of bacterial culture: Take 20 μl of Agrobacterium culture stored at -80℃ and inoculate it into 1 ml of LB liquid medium (with the corresponding antibiotics: kanamycin and rifampin added), and incubate at 28℃ and 180 rpm for 14-18 h. 2) Propagation: Add 500 μl of the activated bacterial culture to 50 ml of LB broth containing the corresponding antibiotic, and incubate at 28°C and 180 rpm until the bacterial culture reaches OD500. 600 The pH value is approximately between 0.8 and 1.2 (approximately 18-20 h). Centrifuge at 5000 rpm for 10 min, discard the supernatant, and collect the bacterial cells. 3) Preparation of the infection and transformation medium: 1 / 2 MS (half the amount), 5% sucrose, 0.02% Silwet L-77, pH adjusted to 5.6-5.7 with NaOH, 0.1 mM AS (acetylsyleugenol). 4) Resuspend the bacterial cells in transformation medium and convert the OD... 600 Adjust to 0.6-0.8; 5) Inoculation: Arabidopsis inflorescences were placed in the transformation medium for 60 s, and then cultured under weak light or dark conditions for 24 h after inoculation. 6) The treated Arabidopsis thaliana was cultured under normal conditions, and a second infection was performed using the same method one week later; 7) After maturity, harvest the Arabidopsis seeds, which are the transgenic T0 generation seeds.

[0071] 2.3.5 Phenotypic identification of transgenic Arabidopsis plants (1) After disinfecting the harvested seeds, plant them on 1 / 2 MS containing kanamycin, then vernalize them at 4℃ for 2 days, and then transfer them to an artificial climate test chamber. After about 10 days, the positive plants grew normally, while the negative plants turned yellow and stopped growing.

[0072] (2) Positive Arabidopsis thaliana plants were transplanted into nutrient soil. After one month of growth, DNA was extracted, and the positive plants were tested by PCR. The primers used for the test were: Table 9 Primers used in the detection Primer name Primer sequences (5' to 3') 35S SEQ ID No.9: GACGCACAATCCCACTATCC -R SEQ ID No.10: CCTAGGGTTTTAGTTTACATCTTC (3) Propagate to the T3 generation to obtain homozygous transgenic 35S:: GhAGL19 Arabidopsis thaliana strains.

[0073] (4) T3 generation plants and wild-type plants (WT) were planted in nutrient soil. After about 10 days, when the Arabidopsis seedlings grew true leaves, they were transplanted into flower pots for growth. Under the same planting and cultivation conditions, qRT-PCR technology was used to find that GhAGL19 In transgenic plants GhAGL19 The relative expression level of the gene was significantly higher than that of the wild type, and phenotypic observation revealed... GhAGL19 Transgenic Arabidopsis thaliana flowers significantly earlier than the wild type. Figure 2 This result indicates that... GhAGL19 It may play a positive regulatory role in controlling flowering time.

[0074] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. GhAGL19 The application of genes in regulating plant flowering time.

2. The application according to claim 1, characterized in that, overexpression GhAGL19 Genes positively regulate the flowering time of plants.

3. The application according to claim 1, characterized in that, The plants include cotton and / or Arabidopsis thaliana.

4. The application according to claim 1, characterized in that, The GhAGL19 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

5. The application according to claim 1, characterized in that, The GhAGL19 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.

2.

6. The application according to claim 3, characterized in that, When the plant is cotton, the GhAGL19 The gene is highly expressed in the pistils, stamens, and petals of cotton.

7. A method for obtaining an early-flowering transgenic plant, characterized in that, Includes the following steps: 1) GhAGL19 Genes are ligated with vectors to obtain ligation vectors; GhAGL19 The nucleotide sequence of the gene is shown in SEQ ID No. 1; 2) The ligation vector obtained in step 1) is transformed into Agrobacterium tumefaciens to obtain the transformed bacteria; 3) Infect plants with the transforming bacteria obtained in step 2) to obtain early-flowering transgenic plants.

8. The acquisition method according to claim 7, characterized in that, The vector in step 1) includes the PBI121 vector; The connected system includes: 5×CEⅡBuffer 2µl, Exnase Ⅱ 1µl, PBI121 carrier 25~100ng, GhAGL19 Gene 10-100ng, add ddH2O to 10µl; The connection conditions include: a temperature of 37°C and a time of 30 minutes; The PBI121 vector was ligated after double digestion with XbaI and SacI enzymes.

9. The acquisition method according to claim 7, characterized in that, Step 2) Agrobacterium tumefaciens includes Agrobacterium tumefaciens GV3101; the linker is transformed into Agrobacterium tumefaciens using a freeze-thaw method.

10. The acquisition method according to claim 7, characterized in that, The plants in step 3) include Arabidopsis thaliana and / or cotton.