Linear non-viral DNA (deoxyribonucleic acid) vector with closed ITR (internal transcriptase) terminal as well as preparation method and application thereof

Abstract

The invention discloses a linear non-viral DNA (deoxyribonucleic acid) vector closed by an ITR (internal transcriptase) terminal as well as a preparation method and application of the linear non-viral DNA vector. The linear non-viral DNA vector comprises the following elements: an asymmetric reverse terminal repeat ITR sequence and an expression cassette; the asymmetric inverted terminal repeat ITR sequence comprises a first ITR sequence and a second ITR sequence, the first ITR sequence and the second ITR sequence are respectively positioned at two ends of an expression cassette sequence so as to enable an expression cassette to be closed, and the expression cassette comprises a cis-regulatory element; the structures of the first ITR sequence and the second ITR sequence are the same or different. The linear non-viral DNA vector is simple to synthesize and low in immunogenicity, can be expressed for a long time, can be used for stable and reliable expression of target genes in vivo and in vitro, and provides a better expression vector for gene therapy.

Description

Technical Field

[0001] This invention relates to the field of gene therapy, specifically to a linear nonviral DNA vector with ITR-terminated closure, its preparation method, and its application, wherein the ICL DNA vector achieves long-term expression in the retina and liver. Background Technology

[0002] Gene therapy refers to the introduction of exogenous normal genes into target cells or organs to correct or compensate for diseases caused by abnormal gene expression, thereby altering the clinical outcomes of patients with gene mutations or acquired diseases caused by aberrations in gene expression profiles. Gene therapy includes treating or preventing medical conditions caused by abnormal regulation, underexpression, or overexpression of defective genes. For example, diseases caused by defective genes can be treated, prevented, or improved by delivering corrective genetic material to patients, or gene expression can be silenced or reduced using silencing genetic material, resulting in therapeutic expression of the genetic material in the patient's body.

[0003] Gene therapy requires the delivery of a transcription cassette system capable of expressing a target gene. The target gene product can be positively regulated to compensate for symptoms caused by insufficient expression of functional proteins due to gene mutations, or negatively regulated to reduce the effect of target protein expression. Some human monogenic diseases can be addressed by delivering the normal gene to target cells or by correcting the mutated site through gene editing therapy. Delivery of the target gene into the patient's target cells can be performed using various methods, including the use of viral vectors (e.g., recombinant retroviruses, recombinant lentiviruses, recombinant adenoviruses, etc.). Among these, recombinant adeno-associated virus (rAAV) is increasingly favored as a versatile vector in gene therapy.

[0004] Adeno-associated virus (AAV) belongs to the Parvoviridae family and is currently the simplest structurally simple, non-enveloped, single-stranded DNA virus discovered. It consists of a protein capside and a 4.7 kb single-stranded DNA genome, with the capside measuring 20–25 nm in length. The AAV genome is flanked by inverted terminal repeats (ITRs), which are the origin of viral DNA replication and the signal that triggers viral packaging. AAV cannot replicate on its own and must rely on other viruses for replication, such as adenovirus, herpesvirus, and baculovirus. More than 80% of people carry AAV, and no disease has been found to be associated with AAV. AAV-derived vectors (i.e., rAVV or AAV vectors) are attractive for delivering genetic material because (i) they can infect (transduce) a wide variety of non-dividing and dividing cell types, including muscle cells and neurons; (ii) they lack viral structural genes, thereby reducing the host cell’s response to viral infection, such as interferon-mediated responses; (iii) wild-type viruses are considered non-pathogenic in humans; (iv) replication-deficient AAV vectors lack rep genes compared to wild-type AAVs that can integrate into the host cell genome and are usually preserved as episomes, thus limiting the risk of insertional mutagenesis or genotoxicity; and (v) AAV vectors are generally considered relatively weak immunogens compared to other vector systems and therefore do not trigger a significant immune response (see ii), thus gaining the potential for persistence of vector DNA and therapeutic transgenesis.

[0005] However, using adeno-associated virus (AAV) as a gene delivery vector has the following drawbacks: First, the viral packaging size is limited, with the sequence between the two ITRs being less than 4.5 kb (Dong et al., 1996; Athanasopoulos et al., 2004; Lai et al., 2010). Second, due to the prevalence of wild-type AAV infection in the population, it is necessary to screen rAAV gene therapy candidates and eliminate the presence of neutralizing antibodies against the vector from patients. A third drawback relates to the immunogenicity of the capsid, which prevents re-administration to patients not excluded from initial treatment. The patient's immune system can respond to the vector, which effectively acts as a "boost," stimulating the immune system to produce high titers of anti-AAV antibodies, thus preventing further treatment. Recent reports have highlighted concerns about immunogenicity at high doses. Another notable drawback is that the initiation of AAV-mediated gene expression is relatively slow, given that single-stranded AAV DNA must be converted to double-stranded DNA before heterologous gene expression.

[0006] Therefore, the use of adeno-associated virus (AAV) vectors in gene therapy is limited due to the single administration to patients (due to the patient's immune response), the extremely low viral packaging capacity (approximately 4.5 kb) which limits the range of transgenic genetic material suitable for delivery in AAV vectors, and the slow gene expression mediated by AAV.

[0007] Closed-end DNA vectors have been developed that can deliver one or more desired transgenes in vivo for therapeutic or other purposes, avoiding the aforementioned drawbacks of AAV and other viral vector systems (see, for example, patents CN111132699A and CN103764831B). However, methods for producing such ICL DNA vectors rely on conventional bacterial or insect cell production methods, or direct enzymatic digestion of plasmid-derived expression cassettes. Such methods can lead to contaminants (e.g., nucleic acid contaminants) from the cells used to produce the vector, or the ICL DNA being methylated. These contaminants are inconvenient or costly to remove and may have adverse side effects if included in ICL DNA therapeutic formulations. Therefore, there is a need in the art for a technique that allows for the production of recombinant vectors with minimal off-target effects for controlling gene expression, such off-target effects being introduced, for example, by the contaminants or other artificial products of the purification methods. Summary of the Invention

[0008] Conventional methods for generating viruses and viral-derived DNA typically use eukaryotic cells, such as mammalian or insect cells. However, these cells not only contain enzymes and other proteins that may have harmful effects on the DNA to be replicated, but the process of purifying the desired DNA from cell lysates may introduce host-derived DNA, making the purification of the desired DNA product more difficult. Furthermore, ICL DNA templates generated by enzymatic digestion are generally derived from plasmids, which are often methylated and contain toxoid contaminants or toxins, potentially causing a range of harmful and / or adverse effects in subjects receiving the injected DNA product. Additionally, traditional cell-based methods for generating DNA vector products may have quantitative limitations. Therefore, this invention provides a linear, non-viral DNA vector closed at ITR ends, its preparation method, and its applications.

[0009] The present invention solves the above-mentioned technical problems through the following technical solutions:

[0010] A first aspect of the present invention provides a linear nonviral DNA vector closed at the ITR ends, the linear nonviral DNA vector comprising the following elements: an asymmetric inverted terminal repeat ITR sequence and an expression cassette; the asymmetric inverted terminal repeat ITR sequence includes a first ITR sequence and a second ITR sequence, the first ITR sequence and the second ITR sequence being located at opposite ends of the expression cassette sequence, the expression cassette including a cis-regulatory element; the first ITR sequence and the second ITR sequence and / or have the same or different structures.

[0011] In some embodiments of the present invention, the first ITR sequence and the second ITR sequence and / or structure are different.

[0012] In some embodiments of the present invention, the linear nonviral DNA vector comprises one or two of the following:

[0013] (1) The ITR sequence is derived from the Parvoviridae family, such as canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19, adeno-associated virus, preferably derived from adeno-associated virus, more preferably derived from AAV2 serotype; preferably, the ITR sequence is a wild-type ITR sequence or a mutant ITR sequence derived from AAV serotype; further preferably, the hairpin ends of the ITR sequence oligonucleotides have sticky ends complementary to the sense strand and antisense strand of the double-stranded polynucleotide of the expression cassette, and the ITR sequence preferably includes nucleotide sequences as shown in SEQ ID NO:1, 2, 3 or 4; more preferably, the first ITR sequence is as shown in SEQ ID NO:1, and / or, the second ITR sequence is as shown in SEQ ID NO:2;

[0014] (2) The cis-regulatory element includes a promoter and a poly(A) tail; preferably, the cis-regulatory element further includes one or more of a riboswitch, an insulator, a miR-regulatory element, a post-transcriptional regulatory element, a Kozak sequence, a tissue and cell type-specific promoter, and an enhancer; more preferably, the cis-regulatory element includes an enhancer, a promoter, a Kozak sequence, a post-transcriptional regulatory element, and a poly(A) tail; more preferably, from the 5' end to the 3' end, the expression cassette includes an enhancer, a promoter, a Kozak sequence, a target gene sequence insertion site, a post-transcriptional regulatory element, and a poly(A) tail connected in sequence.

[0015] In some embodiments of the present invention, the linear nonviral DNA vector comprises one or more of the following:

[0016] (1) The promoter is selected from one or more of constitutive promoters, inducible promoters, and tissue-specific promoters; the constitutive promoter is a CMV promoter, CAG promoter, EF1a promoter, SV40 promoter, CaMV promoter, or UBC promoter; the inducible promoter is a lac promoter, trp promoter, or tac promoter; and the tissue-specific promoter is an hSyn promoter, mecp2 promoter, TUBA1A promoter, c-fos promoter, hVGAT promoter, Slc6a3 promoter, or gfaABC1D promoter. The promoter may be selected from one or more constitutive promoters, such as Iba1 promoter, CNP promoter, cTNT promoter, mNkx2.5 promoter, SM22a promoter, MCK promoter, MYOG promoter, ACTA1 promoter, COL2A1 promoter, mRUNX2 promoter, SP-C promoter, TBG promoter, PDX1 promoter, FABP4 promoter, TIE promoter, K14 promoter, or rpe65; preferably, the promoter is selected from one or more constitutive promoters; more preferably, the promoter is a CMV promoter, and the CMV promoter preferably includes the nucleotide sequence shown in SEQ ID NO:8;

[0017] (2) The enhancer is selected from one of the CMV enhancer, RSV enhancer and SV40 late poly-A signal upstream enhancer sequence, preferably the CMV enhancer;

[0018] (3) The Kozak sequence is GCCACC or GCCACCATGGGC;

[0019] (4) The post-transcriptional regulatory element is derived from marmot hepatitis virus, and the sequence of the post-transcriptional regulatory element preferably includes the nucleotide sequence shown in SEQ ID NO:6.

[0020] A second aspect of the present invention provides a method for synthesizing a linear nonviral DNA vector as described in the first aspect of the present invention, wherein the expression cassette containing sticky ends and the ITR sequence are ligated to obtain the linear nonviral DNA vector.

[0021] In some embodiments of the present invention, the synthesis method includes the following steps:

[0022] Step 1: Synthesize the ITR sequence using chemical synthesis or single-stranded PCR technology;

[0023] Step 2: Amplify the double-stranded polynucleotide containing the expression cassette sequence and digest it with a restriction endonuclease; the amplification uses PCR primers, which contain restriction endonuclease sites and protective bases;

[0024] Step 3: Connect the ITR sequence to the expression cassette obtained after enzyme digestion in Step 2.

[0025] In some specific embodiments of the present invention, the synthesis method further includes: step four, purification to remove ITR sequences not attached to the expression cassette and expression cassettes with unclosed ends.

[0026] In some embodiments of the present invention, the synthesis method includes one or more of the following:

[0027] (1) The ITR sequence was synthesized using single-stranded PCR technology, preferably using primer sequences including the nucleotide sequences shown in SEQ ID NO:23, 24, 25 and 26;

[0028] (2) The enzyme digestion conditions are as follows: 10 μL of 10× buffer, 10 U of restriction enzyme I, 10 U of restriction enzyme II and 6 μg of expression cassette sequence are added to every 100 μL of the enzyme digestion reaction system; the reaction system is incubated at 37°C for 4–16 h; the restriction enzyme I and the restriction enzyme II may be the same or different, preferably BglII restriction enzyme or SalI restriction enzyme independently; the enzyme digestion reaction system is preferably incubated at 37°C for 16 h; the present invention optimizes the enzyme digestion conditions so that the amount of each raw material used in the reaction system is less than that of the conventional reaction system;

[0029] (3) In step three, the molar ratio of the ITR sequence to the expression cassette obtained after enzyme digestion is 3 to 96:1; preferably, the molar ratio is 24 to 96:1; more preferably, the molar ratio is 24:1 or 96:1.

[0030] (4) The ligation conditions in step three are as follows: In 200 μL of the ligation reaction system, add 20 μL of 10×T4 DNA ligase reaction buffer, 400 U of T4 DNA ligase, 8 μg of the expression cassette and ITR sequence obtained after enzyme digestion, and incubate the ligation reaction system at room temperature for 16 hours; The present invention has optimized the ligation conditions so that the amount of each raw material used in the reaction system is less than that in the conventional reaction system;

[0031] (5) In step four, DNA beads are used to remove the ITR sequence that is not attached to the expression cassette, and / or T7 DNA polymerase is used to remove the expression cassette with unclosed ends; preferably, the ratio of the expression cassette to the T7 DNA polymerase is 1 μg: 0.3-0.6 U, more preferably 1 μg: 0.5 U, and / or, after mixing the expression cassette and the T7 DNA polymerase, the reaction is carried out at 35-40°C for 0.6-1.2 h, more preferably at 37°C for 1.0 h.

[0032] A third aspect of the present invention provides a transformant comprising a linear nonviral DNA vector as described in the first aspect of the present invention.

[0033] A fourth aspect of the invention provides a pharmaceutical composition or pharmaceutical formulation comprising a linear nonviral DNA vector as described in the first aspect of the invention and optionally a delivery vector.

[0034] In some embodiments of the present invention, the delivery carrier is a biocompatible material for encapsulating the linear nonviral DNA carrier into a nanocapsule, preferably one of exosomes, lipid nanoparticles, polymers that can be conjugated to the linear nonviral DNA carrier, or folic acid molecules and liposomes.

[0035] In some specific embodiments of the present invention, the carrier is a lipid nanoparticle, and the lipid components of the lipid nanoparticle include ionizable lipid C3, cholesterol, DSPC and DMG-PEG. The molar ratio of the ionizable lipid C3, cholesterol, DSPC and DMG-PEG is preferably 50:19.25:5:0.75 or 30:54.5:0:2.

[0036] In a specific embodiment of the present invention, the ionizable lipid C3 is synthesized by the following steps:

[0037] Step 1: Synthesis of intermediates 1-2

[0038] To a mixture of citronellol and triethylamine in dichloromethane, p-nitrophenyl chloroformate dissolved in dichloromethane was slowly added dropwise. The reaction mixture was stirred at room temperature for 3 h, and the reaction was stopped. Water was added for extraction, and the combined organic layers were dried over MgSO4 and the solvent was removed under vacuum to give crude product 1-1. Hydroxyethyl acrylate, potassium carbonate, and N,N-dimethylformamide solvent were added to a 250 mL round-bottom flask containing crude product 1-1. The mixture was stirred at 80 °C for 3 h, and TLC showed complete disappearance of compound 1-1. After removing DMF under vacuum, the mixture was washed with brine, and the combined organic layers were dried over MgSO4 and the solvent was removed under vacuum to give crude product. The crude product was purified by column chromatography, and the purified product fraction was evaporated to give a pale yellow oily compound 1-2.

[0039] Step 2: Synthesis of compound C3

[0040] N,N-dimethylethylenediamine and compounds 1-2 were mixed and stirred at 70℃ for 48 h. The mixture was purified by column chromatography to obtain compound C3, which was a pale yellow oil.

[0041] In some embodiments of the present invention, the pharmaceutical formulation is a DNA-LNP complex encapsulating the linear nonviral DNA vector, the DNA-LNP complex being prepared by the following steps:

[0042] (1) The lipid components of lipid nanoparticles are mixed in anhydrous ethanol to form an organic phase;

[0043] (2) The linear nonviral DNA vector is dissolved in sodium acetate solution to form an aqueous phase;

[0044] (3) The organic phase and the aqueous phase are mixed by microfluidic technology and purified to remove unreacted lipids and organic solvents.

[0045] In some embodiments of the present invention, the mass ratio of the ionizable lipid C3 to the linear nonviral DNA vector is 5 to 30:1, preferably 10:1 or 30:1.

[0046] In some embodiments of the present invention, the concentration of the sodium acetate solution is 20-30 mM and the pH is 5.0-5.5; preferably, the concentration of the sodium acetate solution is 25 mM and the pH is 5.2.

[0047] In some embodiments of the present invention, the volume ratio of the organic phase to the aqueous phase is 1:1 to 5, preferably 1:3.

[0048] In some embodiments of the present invention, the purification is performed by desalting and buffer replacement via a dialysis bag, with a replacement time of 4 to 6 hours. The dialysis buffer is PBS buffer, DPBS buffer, HEPES buffer, or Tris buffer, preferably DPBS buffer.

[0049] A fifth aspect of the present invention provides a diagnostic kit comprising a linear nonviral DNA vector as described in the first aspect of the present invention, a transformant as described in the third aspect of the present invention, or a pharmaceutical composition or pharmaceutical preparation as described in the fourth aspect of the present invention.

[0050] The sixth aspect of the present invention provides the use of a linear nonviral DNA vector as described in the first aspect of the present invention, a transformant as described in the third aspect of the present invention, or a pharmaceutical composition or pharmaceutical preparation as described in the fourth aspect of the present invention in the expression of a target gene, said use being for non-diagnostic or therapeutic purposes.

[0051] The seventh aspect of the present invention provides the use of a linear nonviral DNA vector as described in the first aspect of the present invention, a transformant as described in the third aspect of the present invention, or a pharmaceutical composition or pharmaceutical preparation as described in the fourth aspect of the present invention in the preparation of a therapeutic agent or a diagnostic kit.

[0052] In some embodiments of the present invention, the therapeutic agent is used to treat eye diseases.

[0053] The eighth aspect of the present invention provides a method for preventing, treating, improving, monitoring or diagnosing a disease in a subject, the method comprising administering to the subject an effective dose of a linear nonviral DNA vector as described in the first aspect of the present invention, a transformant as described in the third aspect of the present invention, or a pharmaceutical composition or pharmaceutical preparation as described in the fourth aspect of the present invention, to cause the subject to express the target gene in the subject's body.

[0054] In some embodiments of the present invention, the target gene includes an agonist or antagonist of an endogenous protein or pathway associated with the disease.

[0055] In some embodiments of the present invention, the disease is an eye disease or a liver disease.

[0056] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0057] The reagents and raw materials used in this invention are all commercially available.

[0058] The positive and progressive effects of this invention are as follows:

[0059] This invention discloses a cell-free, in vitro synthesis method for producing ITR-closed linear DNA vectors (ICL DNA) for gene expression. This method yields high-purity ICL DNA at low cost and high efficiency. The DNA vectors produced using this method are not produced through bacterial or insect cells, thus avoiding the introduction of methylation products or cellular contaminants. The synthesized ICL DNA vectors demonstrate reliable gene expression results both in vitro and in vivo, providing a DNA vector for gene therapy that is simple to synthesize, has low immunogenicity, and can be used for long-term expression. Attached Figure Description

[0060] Figure 1 This is a process flow diagram for preparing ICL DNA vectors.

[0061] Figure 2 This is a schematic diagram of an exemplary method for synthesizing and preparing an ICL DNA vector.

[0062] Figures 3A-3D These are schematic diagrams illustrating the predicted structures of wild-type ITRs from AAV2 (AAV2-WT ITR), modified ITRs from AAV2 (AAV2-mod ITR), ordinary ITR 1, and ordinary ITR 2, respectively.

[0063] Figure 4AThe image shows an agarose gel electrophoresis image of double-stranded DNA amplified by PCR using primers containing restriction endonuclease sites. The sequence includes the CMV enhancer, CMV promoter, polyadenylation signal, and the target gene luciferase. The target band is approximately 3000 bp in size, and a clear, single band was observed at a specified size position on the agarose gel, indicating successful amplification of the expression cassette for the luciferase reporter gene, which is a double-stranded DNA molecule open at both ends.

[0064] Figure 4B The images show the ICL DNA band (bottom) and the non-target band (top) formed by the ligation between the expression cassette and ITR using T4 DNA ligase on agarose gel. Increasing the molar ratio of ITR to expression cassette increases the likelihood of ITR contacting and ligating with the expression cassette, reducing the proportion of self-ligation between expression cassettes. Wells 2, 3, 4, 5, 6, and 7 show the agarose gel results after ligation of expression cassettes and ITR at molar ratios of 3:1, 6:1, 12:1, 24:1, 48:1, and 96:1, respectively. Self-ligation of the expression cassette occurs at ligation ratios of 3:1, 6:1, 12:1, 24:1, and 48:1. When the molar ratio is increased to 96:1, self-ligation is rare or nonexistent, and the target product is ICL DNA.

[0065] Figure 4C The agarose gel images before and after purification with DNA beads are shown. The arrows indicate the location of the ITR. The ITR disappeared in the purified product, proving that this method can completely remove short ITR fragments.

[0066] Figure 4D Agarose gel images of four different ICL DNA vectors before and after treatment with T7 DNA polymerase are shown. The four different ICL DNA vectors—ITR-R, ITR-LR, AAV-R, and AAV-LR—represent ICL DNA vectors with the same common ITR sequence at both ends, different common ITR sequences at both ends, the same ITR sequence from AAV2 at both ends, and different ITR sequences from AAV2 at both ends, respectively. The expression cassettes that were not fully ligated at both ends were successfully digested using the exonuclease activity of T7 DNA polymerase, thus preserving the intact ICL DNA molecules. In the four ICL DNA samples after T7 treatment, the band brightness decreased compared to before T7 treatment, indicating that the incompletely ligated ICL DNA was effectively degraded.

[0067] Figure 4E The purity of the synthesized ICL DNA was determined by capillary electrophoresis, and the result showed a single peak, proving that it was high-purity ICL DNA.

[0068] Figure 5 An exemplary structure of the final optimized ICL DNA vector containing an asymmetric ITR derived from AAV2 is shown. This ICL DNA vector element comprises an expression cassette containing a CMV enhancer, a CMV promoter, a Kozak sequence, and a WPRE sequence polyadenylation signal. An ORF sequence encoding a transgene, such as a luciferase transgene, is inserted between the Kozak sequence and the WPRE sequence signal. The expression cassette is flanked by two inverted terminal repeat sequences—a wild-type AAV2 ITR upstream and a modified ITR downstream—thus the two ITRs on either side of the expression cassette are asymmetric.

[0069] Figure 6A The expression of in vitro synthesized ICL DNA at the in vitro cellular level was shown, and its expression advantage compared to plasmid DNA was demonstrated.

[0070] Figure 6B The results show a comparison of the expression effects of target genes between DNA vectors with closed ends loaded with ITR sequences and DNA vectors with only closed ends and no ITR sequences.

[0071] Figure 6C The results show a comparison of the expression effects of target genes in expression cassettes containing ordinary ITRs and ITRs from the AAV2 virus (where ICL DNA1 represents an expression cassette with a normal ITR and a modified ITR from the AAV2 virus at each end, ICL DNA2 represents an expression cassette with two different ordinary ITRs at each end, and ICL DNA3 represents an expression cassette with a modified ITR from the AAV2 virus at each end).

[0072] Figure 6D The results showed that the expression of closed-end DNA vectors with added WPRE sequences (ICL DNA-WPRE) was better than that of the group without WPRE (ICL DNA), demonstrating that the expression effect of closed-end DNA vectors can be increased by adding WPRE sequences.

[0073] Figure 6E The results showed that, under different transfection doses, the addition of Kozak1 (ICL DNA-WPRE-K1) and Kozak3 (ICL DNA-WPRE-K3) sequences to ICL DNA significantly increased luciferase expression. However, the addition of Kozak2 (ICL DNA-WPRE-K2) to ICL DNA may have resulted in a frameshift mutation due to the addition of the Kozak2 sequence, causing the expression cassette to fail to express the correct protein. In conclusion, the addition of Kozak1 or Kozak3 sequences to the expression cassette can increase expression intensity.

[0074] Figure 6F-6HThe DNA vector was identified by agarose gel electrophoresis under natural and denaturing conditions. The digestion was performed by restriction endonuclease digestion with NdeI, followed by electrophoresis of the digestion products. The presence of characteristic bright bands migrating at twice the size on the denatured gel compared to the natural gel after restriction endonuclease lysis and gel electrophoresis analysis, as well as the presence of monomeric and dimer (2x) bright bands on the denatured gel of the unlysaturated material, are characteristic of ICL DNA vectors.

[0075] The structure of the isolated ICL DNA vector was further analyzed by digesting the purified DNA with a restriction endonuclease selected for the following conditions: a) only a single cleavage site exists within the ICL DNA vector; and b) the resulting fragment is large enough to be clearly seen (>800 bp) during fractionation on a 0.8% denaturing agarose gel. Figure 6F As shown, linear DNA vectors with discontinuous structures and ICL DNA vectors with linear and continuous structures can be distinguished by the size of their reaction products. For example, DNA vectors with discontinuous structures are expected to produce 750 bp and 2750 bp fragments, while ICL DNA vectors with continuous structures are expected to produce 1500 nt and 5500 nt fragments.

[0076] Therefore, to qualitatively demonstrate that the isolated ICL DNA vector is covalently closed as required by definition, the sample is digested with a restriction endonuclease, preferably producing two cleavage products of unequal sizes (e.g., 750 bp and 2750 bp). After digestion and electrophoresis on a denaturing gel (which separates the two complementary DNA strands), linear, non-covalently closed DNA will disintegrate into 750 bp and 2750 bp fragments, while covalently closed DNA (i.e., the ICL DNA-WPRE-K1 vector) will disintegrate into twice the size fragments of 1500 nt and 5500 nt, because the two DNA strands are ligated and now extended and doubled in length (although still single-stranded). Furthermore, due to the end-to-end ligation of multimeric DNA vectors, digestion of monomeric, dimer, and n-merchant forms of DNA vectors will all result in fragments of the same size (see [link to original text]). Figure 6G , 6H ).

[0077] Figure 6I The study showed the expression of luciferase reporter genes in 293T cells after ICL DNA containing three different promoters (CMV, EF1α, and SV40). Relatively speaking, the CMV promoter was more effective in promoting the expression of the target gene.

[0078] Figure 7AThe encapsulation efficiency of the lipid nanoparticles for the ICL DNA vector was shown by agarose gel electrophoresis.

[0079] Figure 7B The expression of the target gene was shown as an example on days 15, 20, 30, 44, 82 and 98 after intravitreal injection of ICL DNA into Balb / c mice.

[0080] Figure 7C The image shows a statistical graph of the persistence of fluorescence in gene expression after intravitreal injection of ICL DNA into Balb / c mice.

[0081] Figure 7D The expression of the target gene was shown on day 1 and day 2 after Balb / c mice were intramuscularly injected with lipid nanoparticles (C3-ILCDNA) encapsulating an ILC DNA carrier.

[0082] Figure 7E The expression of the target gene in the liver of Balb / c mice was shown at 1, 3, 6, 8, and 10 days after the mice were injected via the tail vein with lipid nanoparticles (C3-ILCDNA) encapsulating an ILC DNA carrier.

[0083] Figure 8A The results of single-primer amplification of the ITR complementary strand are shown.

[0084] Figure 8B The results of single-primer amplification of the ITR sequence are shown. Detailed Implementation

[0085] The methods and compositions provided herein are based in part on the discovery of a synthetic production method for generating closed-end DNA vectors, including but not limited to ICL DNA vectors with fewer impurities and / or higher yields compared to DNA vectors generated in insect cell lines, and / or wherein the production process is simplified or made more efficient or cost-effective compared to conventional cell-based production methods. In one embodiment, the DNA vector is replicated without the use of cells, thus the production is cell-free. Therefore, this document provides a method for synthesizing closed-end DNA vectors without the use of cells. This document also provides efficient and simple purification methods involved in the synthesis of ICL DNA vectors, and the uses of such closed-end DNA vectors and ICL DNA vectors.

[0086] This invention relates to in vitro synthesis and purification methods for producing closed-end DNA vectors, the corresponding DNA vector products produced by the methods described herein and their uses, as well as oligonucleotides and kits that can be used in the methods of this invention.

[0087] The closed-end DNA vectors prepared by the methods described herein are superior to other vectors because they can be used more safely for transgene expression in cells, tissues, or subjects. In other words, generating linear vectors using this cell-free method can potentially minimize adverse side effects because the resulting vectors are free from bacterial or insect cell contaminants. The synthetic generation method also allows for higher purity of the desired vector. For this type of vector, the synthetic generation method may also be more efficient and / or more cost-effective than conventional cell-based generation methods.

[0088] The vectors synthesized as described herein can express any desired transgene, such as those for treating or curing a given disease. Those skilled in the art will readily recognize that any transgene used in conventional gene therapy methods utilizing conventional recombinant vectors is suitable for expression using ICL DNA vectors prepared, for example, by the synthetic methods described herein.

[0089] definition

[0090] Unless otherwise defined herein, scientific and technical terms used in connection with this application should have the meanings commonly understood by one of ordinary skill in the art to which this disclosure pertains. It should be understood that the invention is not limited to the specific methods, schemes, and reagents described herein, and therefore variations are possible. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention, which is defined solely by the claims.

[0091] As used herein, the terms “cell-free generation,” “synthetic closed-end DNA vector generation,” and “synthetic generation,” and their grammatically related equivalents, are used interchangeably and refer to the generation of one or more molecules without involving molecular replication or other reproduction using cells or within cells or using cell extracts. Synthetic generation avoids contamination of the generated molecules with cellular contaminants (e.g., cellular proteins or cellular nucleic acids) and further avoids unnecessary cell-specific modifications (e.g., methylation, glycosylation, or other post-translational modifications) during the generation process.

[0092] As used herein, the terms “target gene” and “transgenic” are used interchangeably and refer to the nucleic acid of interest (excluding nucleic acids encoding capsid polypeptides) incorporated into an ICL DNA vector as disclosed herein and which can be delivered and expressed therein.

[0093] As used herein, the terms “expression cassette,” “transcription cassette,” and “gene expression unit” are used interchangeably and refer to a linear nucleic acid segment comprising one or more promoters or other regulatory sequences sufficient to guide transgene transcription, operatively linking the transgene but excluding capsid coding sequences, other vector sequences, or inverted terminal repeat regions. An expression cassette may additionally contain one or more cis-acting sequences (e.g., promoters, enhancers, or repressors), one or more introns, and one or more post-transcriptional regulatory elements.

[0094] The terms “polynucleotide” and “nucleic acid”, used interchangeably herein, refer to polymeric forms of nucleotides, ribonucleotides, or deoxyribonucleotides of any length. Thus, this term includes single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. “Oligonucleotide” generally refers to a polynucleotide of about 5 to about 100 nucleotides in single-stranded or double-stranded DNA. However, for the purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides are also called “oligomers” or “oligonucleotides” and can be isolated from genes or chemically synthesized by methods known in the art. It should be understood that the terms “polynucleotide” and “nucleic acid” include single-stranded (e.g., sense or antisense) and double-stranded polynucleotides (if applicable in the described embodiments).

[0095] As used herein, the term "nucleic acid construct" refers to a single-stranded or double-stranded nucleic acid molecule that is isolated from a natural gene or modified in a manner that is otherwise present in nature or synthesized to contain nucleic acid segments. When a nucleic acid construct contains control sequences required to express the coding sequences disclosed herein, the term "nucleic acid construct" is synonymous with the term "expression cassette." An "expression cassette" comprises a DNA coding sequence operatively linked to a promoter.

[0096] The DNA sequence that “encodes” a specific RNA or protein gene product is the DNA nucleic acid sequence transcribed into that specific RNA and / or protein. DNA polynucleotides can encode RNA (mRNA) that is translated into protein, or DNA polynucleotides can encode RNA that is not translated into protein (e.g., tRNA, rRNA, or RNA that targets DNA; also known as “non-coding” RNA or “ncRNA”).

[0097] As used in this article, the term "gene delivery" refers to a method of transferring foreign DNA into host cells to administer gene therapy.

[0098] As used herein, the term "terminal repeat" or "TR" includes any viral terminal repeat or synthetic sequence containing at least one minimum required origin of replication and a region containing a palindromic hairpin structure. A Rep-binding sequence ("RBS") (also known as an RBE (Rep-binding element)) and a terminal unwinding site ("TRS") together constitute a "minimum required origin of replication," thus a TR contains at least one RBS and at least one TRS. TRs that are inversely complementary to each other within a given polynucleotide sequence are generally referred to individually as "terminal inverse repeats" or "ITRs." In the context of viruses, ITRs mediate replication, viral packaging, integration, and protovirus rescue. As unexpectedly discovered in this invention, TRs that are not inversely complementary to each other in full length can still perform the conventional functions of ITRs; therefore, the term ITR is used herein to refer to a TR in an ICL DNA vector capable of mediating ICL DNA vector replication. Those skilled in the art will appreciate that in complex ICL DNA vector configurations, more than two ITRs or asymmetric ITR pairs can exist. An ITR can be an AAV ITR or a non-AAV ITR, or can be derived from an AAV ITR or a non-AAV ITR. For example, the ITR can be derived from the Parvoviridae family, which encompasses parvoviruses and dependent viruses (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19), or the SV40 hairpin, which serves as the origin of SV40 replication, can be used as the ITR, and can be further modified by truncation, substitution, deletion, insertion, and / or addition. The Parvoviridae family of viruses consists of two subfamilies: the Parvovirinae subfamily, which infects vertebrates, and the Nucleotidovirinae subfamily, which infects invertebrates. Dependent viruses include the adeno-associated virus (AAV) family of viruses capable of replicating in vertebrate hosts, including but not limited to human, primate, bovine, canine, equine, and sheep species. In some embodiments, the hairpin of the 5' ITR oligonucleotide has a sticky end complementary to the 5' sense strand and 3' antisense strand of the expression cassette's double-stranded polynucleotide. In some embodiments, the hairpin ends of the 3'ITR oligonucleotide have sticky ends / dangling ends complementary to the 3' sense strand and 5' antisense strand of the double-stranded polynucleotide of the expression cassette. In some embodiments, the hairpin ends of the 5'ITR oligonucleotide and the 3'ITR oligonucleotide have different restriction endonuclease sticky ends, allowing for directional ligation to each end of the double-stranded polynucleotide. In some embodiments, one or both oligonucleotides of the ITR oligonucleotide do not have dangling ends, and such ITR oligonucleotides are ligated to the double-stranded polynucleotide of the expression cassette via blunt-end ligation.

[0099] In some implementations, the sequence of the ITR is as follows: SEQ ID NO:1 to SEQ ID NO:4.

[0100] "Wild-type ITR" or "WT-ITR" refers to the sequence of a naturally occurring ITR sequence in AAV or other dependent viruses that retains, for example, Rep binding activity and Rep cleavage ability. Due to the degeneracy or drift of the genetic code, the nucleotide sequence of WT-ITR from any AAV serotype may differ slightly from the canonical naturally occurring sequence. Therefore, the WT-ITR sequences used herein include those resulting from naturally occurring variations that occur during generation (e.g., replication errors).

[0101] As used herein, the terms "substantially symmetrical WT-ITR" or "substantially symmetrical WT-ITR pair" refer to a pair of WT-ITRs within a single ICL DNA vector that are both wild-type ITRs with inversely complementary sequences throughout their length. For example, an ITR can be considered wild-type even if it contains one or more nucleotides that deviate from the canonical sequence, as long as the variation does not affect the properties of the ITR and the overall three-dimensional structure of the sequence. In some respects, the deviated nucleotides represent conserved sequence variations. As a non-limiting example, a sequence has at least 95%, 96%, 97%, 98%, or 99% sequence identity with the canonical sequence (e.g., measured using BLAST at default settings) and also has a symmetrical three-dimensional spatial organization with another WT-ITR such that their 3D structures have the same shape in geometric space. Substantially symmetrical WT-ITRs have identical A, C-C', and B-B' loops in 3D space. By identifying an operable Rep binding site (RBE or RBE') and a terminal unwinding site (trs) that pair with a suitable Rep protein, a substantially symmetrical WT-ITR can be functionally confirmed as WT. Other functions can be optionally tested, including transgenic / target gene expression under permissible conditions.

[0102] As used herein, the phrases “modified ITR” or “mod-ITR” or “mutated ITR” are used interchangeably and refer to an ITR that has a mutation in at least one or more nucleotides compared to a WT-ITR from the same serotype. The mutation may result in changes to one or more of the A, C, C'B, and B' regions of the ITR and may result in changes to the three-dimensional spatial organization (i.e., its 3D structure in geometric space) compared to the 3D spatial organization of a WT-ITR from the same serotype.

[0103] As used herein, the term "asymmetric ITR," also known as "asymmetric ITR pair," refers to a pair of ITRs in a single ICL DNA vector that are not internally reverse complementary along their full length. As a non-limiting example, an asymmetric ITR does not have a symmetrical three-dimensional spatial organization with its homologous ITR, such that its 3D structure has a different shape in geometric space. In other words, an asymmetric ITR pair has a different overall geometry, i.e., they have different A, C-C', and B-B' loop organization in 3D space (e.g., one ITR may have a shorter CC' arm and / or a shorter BB' arm compared to its homologous ITR). Sequence differences between the two ITRs may be due to one or more nucleotide additions, deletions, truncations, or point mutations. In one embodiment, one ITR in an asymmetric ITR pair may be a wild-type AAV ITR sequence, and the other ITR is a modified ITR as defined herein (e.g., a non-wild-type or synthetic ITR sequence). In another embodiment, neither ITR in the asymmetric ITR pair is a wild-type AAV sequence, and the two ITRs are modified ITRs with different shapes in geometric space (i.e., different overall geometries). In some implementations, one mod-ITR of an asymmetric ITR pair may have a short C-C' arm, while the other ITR may have different modifications (e.g., a single arm or a short BB' arm, etc.) such that they have different three-dimensional spatial organization compared to homologous asymmetric mod-ITRs.

[0104] As used herein, the term "symmetric ITR" refers to a pair of ITRs within a single ICL DNA vector that are mutated or modified relative to the wild-type dependent viral ITR sequence and are reverse complementary along their full length. Neither of these ITRs is a wild-type AAV2 ITR sequence (i.e., they are modified ITRs, also known as mutant ITRs), and they differ sequentially from the wild-type ITR due to nucleotide additions, deletions, substitutions, truncations, or point mutations. For convenience, the ITR located at the 5' (upstream) of the expression cassette in the ICL DNA vector is referred to as the "5' ITR" or "left ITR," and the ITR located at the 3' (downstream) of the expression cassette in the ICL DNA vector is referred to as the "3' ITR" or "right ITR."

[0105] As used herein, the terms “substantially symmetrical modified ITR” or “substantially symmetrical mod-ITR pair” refer to a pair of modified ITRs in a single ICL DNA vector that have inverse complementary sequences along their full length.

[0106] As used herein, the term "hangover" refers to the single-stranded DNA extension that forms at the cleavage site of a double-stranded DNA molecule after it has been cleaved by a restriction endonuclease. These single-stranded extensions extend beyond the main body of the double-stranded DNA and are therefore called "hangovers" or "protrusions," or, more specifically, single-stranded protrusions that form after annealing of the single-stranded DNA beyond the main body of the double-stranded DNA. In the art, hangovers are also referred to as sticky ends.

[0107] The term "flanking" refers to the relative position of one nucleic acid sequence with respect to another. Typically, in a sequence ABC, B is flanked by A and C. The same applies to an A×B×C arrangement. Therefore, flanking sequences precede or follow the sequence being lateralized, but do not necessarily need to be adjacent to or immediately next to the lateralized sequence. In one embodiment, the term "flanking" refers to the terminal repeat sequence at each end of a linear double-stranded ICL DNA vector.

[0108] As used herein, the terms “Rep binding site,” “Rep binding element,” “RBE,” and “RBS” are used interchangeably and refer to a binding site of a Rep protein (e.g., AAV Rep 78 or AAV Rep 68) that, upon binding, allows the Rep protein to exert its site-specific endonuclease activity on a sequence incorporating the RBS. The RBS sequence and its reverse complementary sequence together form a single RBS. RBS sequences are known in the art and include, for example, 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 5), an RBS sequence identified in AAV2. Any known RBS sequence can be used in embodiments of the invention, including other known AAV RBS sequences and other naturally known or synthetic RBS sequences. Without being bound by theory, it is assumed that the nuclease domain of the Rep protein binds to the double-stranded nucleotide sequence GCTC, thus the two known AAV Rep proteins directly bind and stably assemble onto the double-stranded oligonucleotide 5'-(GCGC)(GCTC)(GCTC)(GCTC)-3'. Additionally, soluble aggregated conformational isomers (i.e., an undetermined number of mutually associated Rep proteins) dissociate and bind to oligonucleotides containing Rep binding sites. Each Rep protein interacts with both the nitrogenous base and the phosphodiester backbone on each chain. Interactions with the nitrogenous base provide sequence specificity, while interactions with the phosphodiester backbone are non-sequence specific or less so and stabilize the protein-DNA complex.

[0109] As used herein, the term "ICL DNA-plasmid" refers to a plasmid containing an ICL DNA vector that is an intermolecular double strand.

[0110] As used herein, the term "closed-end DNA vector" refers to a capless DNA vector having at least one covalently closed end and at least a portion of the vector having an intramolecular double-stranded structure.

[0111] As used herein, the terms "ICL DNA vector" and "ICL DNA" are used interchangeably and refer to a closed-end DNA vector containing at least one end palindrome. In some embodiments, ICL DNA contains two covalently closed ends.

[0112] As defined herein, a “reporter molecule” is a protein that can be used to provide a detectable readout. Reporter molecules typically produce a measurable signal, such as fluorescence, color, or luminescence. Reporter protein coding sequences encode proteins whose presence in cells or organisms is easily observable. For example, fluorescent proteins cause cells to fluoresce when excited by light of a specific wavelength, luciferases induce a cellular reaction that catalyzes the production of light, and enzymes such as β-galactosidase convert substrates into colored products.

[0113] Transcription regulators are transcription activators and repressors that activate or repress transcription of a gene of interest. A promoter is a nucleic acid region that initiates transcription of a specific gene. Transcription activators typically bind to the transcription promoter nearby and recruit RNA polymerase to directly initiate transcription. Repressors bind to the transcription promoter and spatially prevent RNA polymerase from initiating transcription. Other transcription regulators may act as activators or repressors depending on their binding site and cellular and environmental conditions. Non-limiting examples of transcription regulator classes include, but are not limited to, homology domain proteins, zinc finger proteins, winged helical (forkhead) proteins, and leucine zipper proteins.

[0114] As used herein, “carrier” includes any and all solvents, dispersion media, agents, coatings, diluents, antimicrobial and antifungal agents, isotonic and absorption-retarding agents, buffers, carrier solutions, suspensions, colloids, etc. The use of such media and agents for pharmaceutically active substances is well known in the art. Additional active ingredients may also be incorporated into the composition. The phrase “pharmaceuticalally acceptable” refers to molecular entities and compositions that, when administered to a host, will not produce toxic, anaphylactic, or similar adverse reactions.

[0115] The term "in vivo" refers to a assay or process performed within an organism (e.g., in a multicellular animal or inside a single-celled organism). In some aspects described herein, when using single-celled organisms such as bacteria, it can be said that the method or use occurs "in vivo." The term "ex vivo" refers to methods and uses using living cells with intact membranes, outside of a multicellular animal or plant, such as explants, cultured cells including primary cells and cell lines, transformed cell lines, and extracted tissues or cells, including blood cells, etc. The term "in vitro" refers to assays and methods that do not require the presence of cells with intact membranes, such as cell extracts, and can refer to the introduction of programmable synthetic biological circuits in non-cellular systems (e.g., media that do not contain cells or cell systems, or cell extracts).

[0116] As used herein, an enhancer is a cis-regulating sequence (e.g., 50–1,500 base pairs) that binds to one or more proteins (e.g., activators or transcription factors) to increase transcriptional activation of a nucleic acid sequence. Enhancers can be located up to 1,000,000 base pairs upstream or downstream of the gene start site they regulate. Enhancers can be located within intronic regions or exon regions of unrelated genes.

[0117] A promoter can be described as driving the expression of the nucleic acid sequence it regulates or driving its transcription. The phrases “operationally linked,” “operationally positioned,” “operationally linked,” “under control,” and “under transcriptional control” indicate that the promoter is in the correct functional position and / or orientation relative to the nucleic acid sequence it regulates to control the transcriptional initiation and / or expression of that sequence. As used herein, a “reverse promoter” refers to a promoter in which the nucleic acid sequence is in the opposite orientation, such that the coding strand is now the non-coding strand, and the non-coding strand is the coding strand. Reverse promoter sequences can be used in various embodiments to regulate the state of a switch. Additionally, in various embodiments, promoters can be used in conjunction with enhancers.

[0118] A promoter can be a promoter naturally associated with a gene or sequence, which can be obtained by isolating a 5' non-coding sequence located upstream of the coding region and / or exon of a given gene or sequence. Such a promoter can be referred to as "endogenous". Similarly, in some embodiments, an enhancer can be an enhancer naturally associated with a nucleic acid sequence, located downstream or upstream of that sequence.

[0119] In some implementations, the coding nucleic acid segment is located under the control of a "recombinant promoter" or a "heterologous promoter," both of which refer to promoters that are not normally associated with their operatively linked coding nucleic acid sequences in the natural environment. A recombinant or heterologous enhancer is an enhancer that is not normally associated with a given nucleic acid sequence in the natural environment. Such promoters or enhancers can include promoters or enhancers of other genes; promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cells; and synthetic promoters or enhancers that are not naturally occurring.

[0120] As described herein, an "inducible promoter" is a promoter characterized by initiating or enhancing transcriptional activity in the presence, influence of, or contact with an inducer or inducer. An "inducer" or "inducer" as defined herein can be endogenous or typically exogenous compounds or proteins administered in a manner capable of inducing transcriptional activity from an inducible promoter. In some embodiments, the inducer or inducer, i.e., a chemical substance, compound, or protein, may itself be the result of transcription or expression of a nucleic acid sequence (i.e., the inducer may be an inducer protein expressed by another component or module), and the transcription or expression itself may be under the control of the inducible promoter. In some embodiments, such as in the case of repressor proteins, it is induced. Examples of inducible promoters include, but are not limited to: tetracyclines, metallothioneins, ecdysone, mammalian viruses (e.g., adenovirus late promoters; and mouse mammary tumor virus long terminal repeat sequences (MMTV-LTR)) and other steroid-responsive promoters, rapamycin-responsive promoters, etc.

[0121] As described in this article, "tissue-specific promoters" refer to DNA sequences that play a crucial role in gene expression regulation, initiating gene transcription in specific cell types or tissues. These promoters exhibit high selectivity, ensuring that gene expression is limited to specific cells or tissues, thus playing a vital role in maintaining cellular function and the overall physiological homeostasis of the organism. For example, the β-actin promoter is a highly active promoter in muscle cells, particularly in cardiac and skeletal muscle cells. It is widely used to express muscle-specific proteins or to study muscle cell function in disease models such as myocardial infarction and muscle atrophy. The insulin promoter is highly expressed in pancreatic β-cells and controls the expression of the insulin gene. The tyrosine hydroxylase promoter is specifically expressed in dopaminergic neurons and regulates the expression of the tyrosine hydroxylase gene, a key enzyme in dopamine biosynthesis. This promoter has significant applications in the research and treatment of neurodegenerative diseases such as Parkinson's disease.

[0122] The terms “DNA regulatory sequence,” “control element,” and “regulatory element,” which may be used interchangeably in this article, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, etc., which provide and / or regulate the transcription of non-coding sequences (e.g., RNA targeting DNA) or coding sequences (e.g., site-modified peptides or Cas9 / Csnl peptides) and / or regulate the translation of encoded peptides.

[0123] In this paper, an "expression cassette" comprises a heterologous DNA sequence operatively linked to a promoter or other regulatory sequence sufficient to guide the transcription of the transgene in an ICL DNA vector. Suitable promoters include, for example, tissue-specific promoters. Promoters may also be of AAV origin.

[0124] As used herein, the term "host cell" includes any cell type that is readily transformed, transfected, transduced, etc., by the nucleic acid constructs or ICL DNA expression vectors of this disclosure. As a non-limiting example, a host cell can be any of isolated primary cells, pluripotent stem cells, CD34* cells, induced pluripotent stem cells, or many immortalized cell lines (e.g., HepG2 cells). Alternatively, a host cell can be an in situ or in vivo cell in a tissue, organ, or organism.

[0125] The term "exogenous" refers to a substance present in cells other than of a natural origin. When used herein, the term "exogenous" can refer to nucleic acids (e.g., nucleic acids encoding polypeptides) or polypeptides that have been introduced into a biological system, such as a cell or organism, through a process involving human intervention, where the nucleic acid or polypeptide is not typically found in said cell or organism, and it is desirable to introduce the nucleic acid or polypeptide into such a cell or organism. Alternatively, exogenous nucleic acids or polypeptides may be introduced into a biological system, such as a cell or organism, where the amount of nucleic acid or polypeptide found in said cell or organism is relatively low, and it is desirable to increase the amount of nucleic acid or polypeptide in said cell or organism, for example, to produce ectopic expression or levels. In contrast, the term "endogenous" refers to a substance native to said biological system or cell.

[0126] A "vector" or "expression vector" is a replicon, such as a plasmid, rod, bacteriophage, virus, virion, or granule, that connects to another DNA segment, or "insertion," to enable replication of the connected segment within the cell. Vectors can be nucleic acid constructs designed for delivery to host cells or for transfer between different host cells. As used herein, "vector" refers to an ICLDNA vector.

[0127] "Recombinant vector" means a vector comprising a heterologous nucleic acid sequence or "transgenic" capable of being expressed in vivo. It should be understood that, in some embodiments, the vectors described herein can be combined with other suitable compositions and therapies. In some embodiments, the vector is free-form. The use of a suitable free-form vector provides a way to maintain the nucleotides of interest in the subject with high copy numbers of extrachromosomal DNA, thereby eliminating the potential effects of chromosomal integration.

[0128] As used in this article, "hereditary disease" refers to a disease caused, in part or in whole, directly or indirectly, by one or more abnormalities in the genome, especially symptoms present from birth. Abnormalities can be mutations, insertions, or deletions. Abnormalities may affect the coding sequence of a gene or its regulatory sequences.

[0129] The techniques described herein are further illustrated by the following examples, which should not be construed as further limitations. It should be understood that the invention is not limited to the specific methods, schemes, and reagents described herein, and therefore variations are possible. The terminology used herein is merely for describing particular embodiments and is not intended to limit the scope of the invention, which is defined solely by the claims.

[0130] 1. Universal ICL DNA Vector

[0131] In some embodiments, the closed-end DNA vector produced using the synthetic methods described herein is an ICL DNA vector, including ICL DNA vectors capable of expressing transgenes. The ICL DNA vectors described herein are not limited by size, thus allowing, for example, the expression of all components required to express transgenes from a single vector. ICL DNA vectors are preferably double-stranded, for example, self-complementary at least a portion of the molecule, such as expression cassettes (e.g., ICL DNA is not a double-stranded circular molecule). ICL DNA vectors have covalently closed ends, and are therefore resistant to exonuclease digestion (e.g., exonuclease I or exonuclease III), for example, at 37°C for more than one hour.

[0132] Typically, the ICL DNA vector produced using the synthesis method described herein comprises, in the 5' to 3' direction: a first adeno-associated virus (AAV) inverted terminal repeat (ITR), a sequence including a target nucleotide sequence (e.g., an expression cassette as described herein), and a second AAV ITR. The ITR sequence is selected from any of the following: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat (mod-ITR) (e.g., an asymmetric modified ITR); (ii) two modified ITRs, wherein the mod-ITR pair has a different three-dimensional spatial organization from each other (e.g., an asymmetric modified ITR); (iii) a symmetrical or substantially symmetrical WT-WT ITR pair, wherein each WT-ITR has the same three-dimensional spatial organization; or (iv) a symmetrical or substantially symmetrical modified ITR pair, wherein each mod-ITR has the same three-dimensional spatial organization.

[0133] This document covers methods and compositions comprising an ICL DNA vector produced using the synthetic methods described herein, which may further include a delivery system, such as, but not limited to, a liposome nanoparticle delivery system. This document discloses non-limiting exemplary liposome nanoparticle systems used. In some aspects, this disclosure provides a formulation comprising ICL DNA and ionizable lipid nanoparticles. Lipid nanoparticle formulations prepared and loaded using an ICL DNA vector obtained by the methods described are disclosed.

[0134] The ICL DNA vectors produced using the synthetic methods described herein do not have the packaging limitations imposed by the confining space within the viral capsid. This allows for the insertion of control elements, such as the regulating switches, large transgenes, multiple transgenes, etc., disclosed herein.

[0135] Figure 5 A schematic diagram of the corresponding sequence of a non-limiting exemplary ICL DNA vector is shown. The ICL DNA vector is capless and can be obtained from a plasmid encoded in the following order: a first ITR, an expression cassette containing the transgene, and a second ITR. The expression cassette may include one or more regulatory sequences that allow and / or control the expression of the transgene, for example, wherein the expression cassette may contain one or more of the following in order: an enhancer / promoter, an ORF reporter molecule (transgene), a post-transcriptional regulatory element (e.g., WPRE), and polyadenylation and termination signals (e.g., BGH polyA).

[0136] In some embodiments, the expression cassette may contain a transgene in the range of 500 to 50,000 nucleotides in length. In some embodiments, the expression cassette may contain a transgene in the range of 500 to 75,000 nucleotides in length. In some embodiments, the expression cassette may contain a transgene in the range of 500 to 10,000 nucleotides in length. In some embodiments, the expression cassette may contain a transgene in the range of 1,000 to 10,000 nucleotides in length. In some embodiments, the expression cassette may contain a transgene in the range of 500 to 5,000 nucleotides in length. ICL DNA vectors do not have the size limitations of capsidated AAV vectors, thus enabling the delivery of large-sized expression cassettes to provide efficient transgene expression. In some embodiments, ICL DNA vectors lack prokaryotic-specific methylation.

[0137] ICL DNA expression cassettes may include, for example, expressible exogenous sequences (e.g., open reading frames) or transgenes encoding proteins that are absent, inactive, or poorly active in the recipient subject, or genes encoding proteins having the desired biological or therapeutic effect. Transgenes may encode gene products that function to correct the expression of defective genes or transcripts. In principle, expression cassettes may include any gene encoding a protein, peptide, or RNA that is reduced or absent due to mutation, or that, within the scope of this disclosure, is considered to exhibit therapeutic benefit when overexpressed.

[0138] The expression cassette may contain any transgene that can be used to treat or diagnose a disease or condition in a subject, including but not limited to receptors, antibodies, toxins, hormones, enzymes, or cell surface proteins. ICL DNA vectors produced using the synthetic methods described herein can be used to deliver and express any gene of interest in a subject, including but not limited to nucleic acids encoding polypeptides, or non-coding nucleic acids (e.g., RNAi, miRNA, etc.), as well as exogenous genes and nucleotide sequences, including viral sequences in the subject's genome, such as HIV sequences. Preferably, the ICL DNA vectors disclosed herein are for therapeutic purposes (e.g., for medical, diagnostic, or veterinary use) or for immunogenic polypeptides. In some embodiments, the ICL DNA vector can be used to express any gene of interest in a subject, including one or more polypeptides, peptides, ribozymes, peptide nucleic acids, siRNA, RNAi, antisense oligonucleotides, antisense polynucleotides, or RNA (coding or non-coding; e.g., siRNA, shRNA, microRNA and its antisense counterparts (e.g., antagoMiR)), antibodies, antigen-binding fragments, or any combination thereof.

[0139] The expression cassette may include a foreign sequence encoding a reporter protein for experimental or diagnostic purposes, such as β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and other reporter proteins well known in the art.

[0140] In some embodiments, the transgene expressed by the ICL DNA vector is a therapeutic gene. In some embodiments, the therapeutic gene is an antibody or an antibody fragment or antigen-binding fragment thereof, such as a neutralizing antibody or antibody fragment.

[0141] ICL DNA vectors have many structural features that differ from plasmid-based expression vectors. ICL DNA vectors synthesized using the methods described herein may possess one or more of the following characteristics: lack of original (i.e., no inserted) bacterial DNA; lack of prokaryotic origin of replication; self-sufficiency, meaning they do not require any sequences other than the two ITRs, including Rep binding sites and terminal unwinding sites (RBS and TRS) and exogenous sequences between ITRs; the presence of hairpin-forming ITR sequences; and the absence of bacterial DNA methylation or even any other methylation associated with production in a given cell type and considered abnormal by the mammalian host. Generally, the vectors of the present invention preferably do not contain any prokaryotic DNA, but some prokaryotic DNA is contemplated as an exogenous sequence insertion, as a non-limiting example, in the promoter or enhancer region. Another important feature distinguishing ICL DNA vectors from plasmid expression vectors is that ICL DNA vectors are linear DNA with closed ends, while plasmids are always double-stranded circular DNA.

[0142] Linear and continuous structures are more stable under attack by cellular endonucleases and are less likely to recombine and induce mutagenesis. Therefore, linear and continuous ICL DNA vectors are a preferred embodiment. Linear and continuous linear double-stranded ICL DNA vectors may have covalently bound ends without sequences encoding AAV capsid proteins. These ICL DNA vectors are structurally distinct from plasmids (including the ICL DNA plasmids described herein), which are bacterial-derived circular double-stranded nucleic acid molecules. While the complementary strand of a plasmid can separate upon denaturation, resulting in two nucleic acid molecules, in contrast, an ICL DNA vector, although possessing a complementary strand, is a single DNA molecule and therefore remains a single molecule even after denaturation. In some embodiments, unlike plasmids, the generation of ICL DNA vectors as described herein may not involve prokaryotic DNA base methylation. Therefore, ICL DNA vectors and ICL DNA plasmids are different in terms of structure (especially linear versus circular) and also in terms of the methods used to produce and purify these different objects (see below), and also in terms of their DNA methylation, i.e., ICL DNA-plasmids are prokaryotic while ICL DNA vectors are eukaryotic.

[0143] Using ICL DNA vectors as described herein offers several advantages over plasmid-based expression vectors, including but not limited to: 1) Plasmids contain bacterial DNA sequences with prokaryotic-specific methylation, such as 6-methyladenosine and 5-methylcytosine methylation, while the uncoated AAV vector sequences are eukaryotic and do not undergo prokaryotic-specific methylation; therefore, uncoated AAV vectors are less likely to induce inflammatory and immune responses compared to plasmids; 2) Plasmids require the presence of resistance genes during their production process, while ICL DNA vectors do not; 3) Circular plasmids, after introduction into cells, are not delivered to the nucleus and require overloading to bypass cellular nuclease degradation, while ICL DNA vectors contain viral cis-elements, i.e., ITRs, which confer resistance to nucleases and can be designed to target and deliver to the nucleus. Assuming the minimum essential elements for ITR function are the Rep binding site and the terminal unwinding site (TRS); the 5'-AGTTGG-3 of AAV2 plus a variable palindromic sequence that allows for hairpin formation; and 4) the absence of CpG dinucleotide over-representation, often found in prokaryotic plasmids, which is reported to bind to Toll-like receptor family members and elicit T cell-mediated immune responses, in the ICL DNA vector. In contrast, transduction using the capsid-free AAV vector disclosed herein can effectively target cell and tissue types that are difficult to transduce with conventional AAV virions using various delivery reagents.

[0144] 2. ITR

[0145] As disclosed herein, ICL DNA vectors contain a transgenic or heterologous nucleic acid sequence located between two inverted terminal repeat (ITR) sequences, wherein the ITR sequences may be asymmetric ITR pairs or symmetric or substantially symmetric ITR pairs, as defined herein. ICL DNA vectors disclosed herein may contain ITR sequences selected from: (i) at least one WT-ITR and at least one modified AAV inverted terminal repeat sequence (mod-ITR) (e.g., an asymmetric modified ITR); (ii) two modified ITRs, wherein the mod-ITR pair has a different three-dimensional spatial organization from each other (e.g., an asymmetric modified ITR); or (iii) a symmetric or substantially symmetric WT-WT ITR pair, wherein each WT-ITR has the same three-dimensional spatial organization; or (iv) a symmetric or substantially symmetric modified ITR pair, wherein each mod-ITR has the same three-dimensional spatial organization.

[0146] In some implementations, the ITR sequence may originate from viruses of the Parvoviridae family, which comprises two subfamilies: the Parvovirinae subfamily, which infects vertebrates, and the Parvovirinae subfamily, which infects insects. The Parvovirinae subfamily (called parvoviruses) includes the genus *Dependent Viruses*, whose members, in most cases, require co-infection with helper viruses such as adenoviruses or herpesviruses to achieve proliferative infection. The *Dependent Viruses* genus includes adeno-associated viruses (AAVs) that typically infect humans (e.g., serotypes 2, 3A, 3B, 5, and 6) or primates (e.g., serotypes 1 and 4), as well as related viruses that infect other warm-blooded animals (e.g., adeno-associated viruses in cattle, dogs, horses, and sheep).

[0147] Although the ITR exemplified in the specification and the embodiments herein is AAV2 WT-ITR, those skilled in the art will know, as described above, that ITRs, chimeric ITRs, or ITRs from any known parvovirus, such as AAV-dependent viruses (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV5, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8 genomes (NCBI: NC 002077, NC 001401, NCO01729, NCO01829, NCO06152, NC 006260, NC 006261)) can be used.

[0148] 3. Exemplary ICL DNA Vector

[0149] As described above, this disclosure relates to synthetically produced recombinant ICL DNA expression vectors and ICL DNA vectors encoding transgenes, comprising any of the following: asymmetric ITR pairs, symmetrical ITR pairs, or substantially symmetrical ITR pairs as described above. In some embodiments, this disclosure relates to synthetically produced recombinant ICL DNA vectors having flanking ITR sequences and transgenes, wherein the ITR sequences are asymmetric, symmetrical, or substantially symmetrical to each other as defined herein, and the ICL DNA further comprises a nucleotide sequence of interest (e.g., an expression cassette containing the nucleic acid of the transgene) between the flanking ITRs, wherein the nucleic acid molecule does not have a viral capsid protein coding sequence.

[0150] The synthesized ICL DNA expression vector can be any ICL DNA vector that can be readily subjected to recombinant DNA procedures including the nucleotide sequences described herein, provided that at least one ITR is altered. The synthesized ICL DNA vector of this disclosure is compatible with the host cell to which the ICL DNA vector will be introduced. In some embodiments, the synthesized ICL DNA vector can be linear. In some embodiments, the synthesized ICL DNA vector can exist as an extrachromosomal entity. In some embodiments, the synthesized ICL DNA vector of this disclosure can contain elements that allow the donor sequence to integrate into the host cell genome.

[0151] In some implementations, the expressible transgenic cassette may include, as needed, an enhancer / promoter, one or more homologous arms, a donor sequence, a posttranscriptional regulatory element (e.g., WPRE, e.g., SEQ ID NO:6) and a polyadenylation and termination signal (e.g., BGH polyA, e.g., SEQ ID NO:7).

[0152] A. Adjustment element

[0153] ICL DNA vectors, as described herein and produced using synthetic methods as described herein, may contain asymmetric or symmetric ITR pairs as defined herein, and may also contain specific combinations of cis-regulatory elements. Cis-regulatory elements include, but are not limited to, promoters, riboswitches, insulators, miR-regulated elements, posttranscriptional regulatory elements, tissue and cell type-specific promoters, and enhancers. In some embodiments, the ITR may act as a promoter for the transgene. In some embodiments, the ICL DNA vector contains other components that regulate transgene expression, such as regulatory switches for transgene expression as described herein, or killer switches that can kill cells containing the ICL DNA vector.

[0154] (i) Promoter:

[0155] Those skilled in the art will understand that the promoters used in the synthesized ICL DNA vectors of this invention should be trimmed to suit the specific sequence they initiate. Proteins encoded by the ICL DNA vectors will benefit from the promoters, enabling efficient expression from the vector and optionally, expression in a tunable manner.

[0156] The expression cassettes of the present invention include promoters that can influence both overall expression levels and cell specificity. For transgene expression, they may include highly active viral-derived immediate early promoters. The expression cassettes may contain tissue-specific eukaryotic promoters to restrict transgene expression to specific cell types and reduce toxic effects and immune responses caused by dysregulated aberrant expression. In a preferred embodiment, the expression cassette may contain synthetic regulatory elements, such as the CAG promoter. The CAG promoter comprises (i) a cytomegalovirus (CMV) early enhancer element, (ii) a promoter, first exon, and first intron of the chicken β-actin gene, and (iii) a splice acceptor of the rabbit β-globulin gene. Alternatively, the expression cassette may contain an α1-antitrypsin (AAT) promoter, a liver-specific (LP1) promoter, or a human elongation factor-1α (EF1α) promoter (e.g., SEQ ID NO: 9). In some embodiments, the expression cassette includes one or more constitutive promoters, such as the Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer) or the cytomegalovirus (CMV) immediate early promoter (optionally with a CMV enhancer, e.g., SEQ ID NO:10). Alternatively, inducible promoters, transgenic natural promoters, tissue-specific promoters, or various promoters known in the art may be used.

[0157] Suitable promoters, including those described above, may be derived from viruses and thus may be called viral promoters, or they may be derived from any organism, including prokaryotes or eukaryotes. Suitable promoters can be used to drive expression via any RNA polymerase (e.g., pol I, pol II, pol III). Exemplary promoters include, but are not limited to: the SV40 early promoter (SEQ ID NO:11); the mouse mammary tumor virus long terminal repeat (LTR) promoter; the adenovirus major late promoter (Ad MLP); the herpes simplex virus (HSV) promoter; the cytomegalovirus (CMV) promoter (SEQ ID NO:8), such as the CMV immediate early promoter region (CMVIE); the Raoult sarcoma virus (RSV) promoter; the human U6 small nucleus promoter; enhanced U6 promoters, the human H1 promoter (H1), the CAG promoter, the human α1-antitrypsin (HAAT) promoter, and so on. In some embodiments, these promoters are modified at their downstream intron-containing ends to include one or more nuclease cleavage sites. In some implementations, the DNA containing the nuclease cleavage site is independent of the promoter DNA.

[0158] In one implementation, the promoter used is a natural promoter of a gene encoding a therapeutic protein. The promoters and other regulatory sequences of the corresponding genes encoding the therapeutic protein are known and have been characterized. The promoter region used may also include one or more additional regulatory sequences (e.g., natural ones), such as the CMV enhancer.

[0159] (ii) Polyadenylated sequence:

[0160] The synthesized ICL DNA vector may include a sequence encoding a polyadenylated sequence to stabilize the mRNA expressed by the ICL DNA vector and facilitate nuclear export and translation. In one embodiment, the synthesized ICL DNA vector does not include a polyadenylated sequence. In other embodiments, the vector includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 45, at least 50 or more adenine dinucleotides. In some embodiments, the polyadenylated sequence comprises about 43 nucleotides, about 40-50 nucleotides, about 40-55 nucleotides, about 45-50 nucleotides, about 35-50 nucleotides, or any range therebetween.

[0161] Expression cassettes may include polyadenylated sequences or variants thereof known in the art, such as naturally occurring sequences isolated from bovine BGHpA (e.g., SEQ ID NO:7) or viral SV40pA, or synthetic sequences. Some expression cassettes may also include an upstream enhancer (USE) sequence for the late polya signaling of SV40. In some embodiments, the USE may be used in combination with SV40pA or heterologous polya signaling.

[0162] The expression cassette may also include post-transcriptional elements to increase transgene expression. In some embodiments, a warthog hepatitis virus (WHP) post-transcriptional regulatory element (WPRE) is used to increase transgene expression. Other post-transcriptional processing elements may be used, such as the thymidine kinase gene from herpes simplex virus or post-transcriptional elements from hepatitis B virus (HBV). The secreted sequence may be linked to transgenes, for example, VH-02 and VK-A26 sequences.

[0163] (iii) Nuclear localization sequence

[0164] In some embodiments, the vector encoding the RNA-directed endonuclease contains one or more nuclear localization sequences (NLS), such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLS. In some embodiments, one or more NLS are located at or near the N-terminus, at or near the C-terminus, or a combination of these positions (e.g., one or more NLS at the N-terminus and / or one or more NLS at the C-terminus). When more than one NLS is present, they can be selected independently of each other, such that a single NLS may exist in more than one copy and / or in combination with one or more other NLS present in one or more copies.

[0165] Other components of the B.ICL DNA vector

[0166] ICL DNA vectors produced using the synthetic methods described herein can contain nucleotides encoding other components for gene expression. For example, to select specific gene-targeting events, protective shRNA can be embedded in a microRNA and then inserted into a recombinant ICL DNA vector designed to integrate site-specifically into a highly active locus (such as an albumin locus). The ICL DNA vectors of this disclosure can contain one or more selectable markers that allow selection of cells for transformation, transfection, transduction, etc. Selective markers are genes that provide resistance to biocides or viruses, resistance to heavy metals, or resistance to auxotrophic protrophs (such as NeoR). In some embodiments, a positive selectable marker is incorporated into a donor sequence, such as NeoR. A negative selectable marker can be incorporated downstream of the donor sequence; for example, the nucleic acid sequence HSV-tk encoding the negative selectable marker can be incorporated into a nucleic acid construct downstream of the donor sequence.

[0167] C. Adjustment switch

[0168] A molecular regulatory switch is a switch that produces a measurable state change in response to a signal. Such a regulatory switch can be effectively combined with an ICL DNA vector produced using synthetic methods as described herein to control the expression output of transgenes from the ICL DNA vector. In some embodiments, the ICL DNA vector contains a regulatory switch for fine-tuning transgene expression. For example, it can function as a biodefense mechanism of the ICL DNA vector. In some embodiments, the switch is an "ON / OFF" type switch designed to initiate or deactivate (i.e., shut down) the expression of the gene of interest in the ICL DNA in a controllable and adjustable manner. In some embodiments, the switch may include a "killer switch" that, once activated, can instruct the cell containing the ICL DNA vector to undergo programmed cell death.

[0169] (i) Binary regulating switch

[0170] In some embodiments, the ICL DNA vector produced using the synthetic methods described herein contains regulatory switches that can be used to controllably regulate the expression of the transgene. For example, the expression cassette located between the ITRs of the ICL DNA vector may additionally contain regulatory regions operatively linked to the gene of interest, such as promoters, cis-elements, repressors, enhancers, etc., wherein the regulatory regions are regulated by one or more cofactors or exogenous agents. By way of example only, the regulatory regions may be regulated by small molecule switches or by inducible or repressive promoters. Non-limiting examples of inducible promoters are hormone-inducible or metal-inducible promoters. Other exemplary inducible promoter / enhancer elements include, but are not limited to, the RU486 inducible promoter, the ecdysone inducible promoter, the rapamycin inducible promoter, and the metallothionein promoter.

[0171] (ii) Small molecule regulating switch

[0172] Various small molecule-based regulatory switches known in the art are known in the art and can be combined with the synthetically produced ICL DNA vectors disclosed herein to form regulatory switch-controlled ICL DNA vectors.

[0173] (iii) Password adjustment switch

[0174] In some implementations, the regulating switch can be a "cryptographic switch" or a "cryptographic loop." When specific conditions occur—that is, when a combination of conditions is required for transgene expression and / or repression—the cryptographic switch allows for fine-tuning of control over the expression of the transgene from the synthesized ICL DNA vector.

[0175] Any and all combinations of the regulatory switches disclosed herein, such as small molecule switches, nucleic acid-based switches, small molecule-nucleic acid hybrid switches, post-transcriptional transgene regulatory switches, post-translational regulation, radiation control switches, hypoxia-mediated switches, and other regulatory switches as disclosed herein that are known to those skilled in the art, can be used in the cryptographic regulatory switches disclosed herein.

[0176] (iv) Nucleic acid-based regulatory switches controlling transgene expression

[0177] In some implementations, the regulatory switch controlling the expression of the transgene by the synthetically produced ICL DNA vector is based on a nucleic acid-based control mechanism. Exemplary nucleic acid control mechanisms are known in the art and are contemplated for use. For example, the ICL DNA vector may contain a regulatory switch encoding an RNAi molecule complementary to the transgene expressed by the ICL DNA vector. When such RNAi is expressed, the transgene will be silenced by the complementary RNAi molecule even if the ICL DNA vector expresses the transgene, and the transgene will not be silenced by the RNAi when the ICL DNA vector expresses the transgene but the RNAi is not expressed.

[0178] (v) Post-transcriptional and post-translational regulatory switches

[0179] In some implementations, the regulatory switch controlling the expression of the transgene or gene of interest by the synthetically produced ICL DNA vector is a post-transcriptional modification system.

[0180] (vi) Other exemplary regulating switches

[0181] In the synthesized ICL DNA vector, any known regulatory switch can be used to control the gene expression of the transgene expressed by the ICL DNA vector, including those triggered by environmental changes.

[0182] (vii) Kill Switch

[0183] Other embodiments of the invention relate to synthetically generated ICL DNA vectors comprising a kill switch. Kill switches, as disclosed herein, enable the killing or programmed cell death of cells containing an ICL DNA vector as a means of permanently removing the introduced ICL DNA vector from a subject's system. Those skilled in the art will appreciate that the use of a kill switch in the synthetically generated ICL DNA vector of the present invention is typically combined with targeting the ICL DNA vector to a limited number of cells that the subject can tolerate losing or targeting cell types desired to apoptosis (e.g., cancer cells). In all respects, the “kill switch” disclosed herein is designed to provide rapid and powerful cell killing of cells containing an ICL DNA vector under conditions of lack of input survival signals or other specified conditions. In other words, a kill switch encoded by the ICL DNA vector herein can restrict cell survival of cells containing the ICL DNA vector to an environment defined by a specific input signal. Such a kill switch functions as a biodefense mechanism if it is desired to remove the synthetically generated ICL DNA vector from a subject or to ensure that it does not express the encoded transgene.

[0184] 4. Pharmaceutical Composition

[0185] In another aspect, the present invention provides pharmaceutical compositions. The pharmaceutical compositions comprise a blocked-end DNA vector, such as an ICL DNA vector produced using the synthetic methods described herein, and a pharmaceutically acceptable carrier or diluent.

[0186] Closed-end DNA vectors, including ICL DNA vectors, synthesized using the methods described herein, can be incorporated into pharmaceutical compositions suitable for administration to a subject for in vivo delivery to the subject's cells, tissues, or organs. Typically, the pharmaceutical composition contains a pharmaceutically acceptable carrier. For example, closed-end DNA vectors, including ICL DNA vectors, synthesized using the methods described herein, can be incorporated into pharmaceutical compositions suitable for the desired route of therapeutic administration (e.g., parenteral administration). Various routes of administration are involved, including conventional intravenous infusion, intra-arterial infusion, and hyperbaric intravenous or intra-arterial infusion to enhance cell delivery efficiency by increasing infusion pressure. More advanced intracellular injection techniques such as intranuclear microinjection and intracytoplasmic injection are also possible. Pharmaceutical compositions for therapeutic purposes can be formulated as solutions, microemulsions, dispersions, liposomes, or other ordered structures suitable for high concentrations of synthetically produced closed-end DNA vectors (e.g., ICL DNA vectors). Sterile injectable solutions can be prepared by incorporating the required amount of a synthetically produced closed-end DNA vector, such as an ICL DNA vector compound, with one or a combination of the ingredients listed above into an appropriate buffer solution, followed by filtration sterilization. Pharmaceutical compositions can be formulated to include an ICL DNA vector for delivering transgenes in nucleic acids to recipient cells, thereby enabling the therapeutic expression of the transgene or donor sequence therein. The composition may also include a pharmaceutically acceptable vector.

[0187] Closed-end DNA vectors, including ICL DNA vectors, produced using the synthetic methods described herein can be incorporated into pharmaceutical compositions suitable for local, systemic, intraamniotic, intrathecal, intracranial, intraarterial, intravenous, intralymphatic, intraperitoneal, subcutaneous, tracheal, intratissue (e.g., intramuscular, intracardiac, intrahepatic, intrarenal, intracerebral), intrathecal, intrabladder, conjunctival (e.g., extraorbital, intraorbital, retroorbital, intraretinal, subretinal, choroidal, subchoroidal, intrastromal, anterior chamber, and vitreous), cochlear, and mucosal (e.g., oral, rectal, nasal) administration.

[0188] In some aspects, the methods provided herein comprise the delivery of one or more closed-end DNA vectors, including ICL DNA vectors, produced using synthetic methods as described herein, to host cells. This document also provides for cells produced by such methods, and organisms comprising or derived from such cells (e.g., animals, plants, or fungi). Methods for delivering nucleic acids may include lipid transfection, nuclear transfection, microinjection, biological munitions, liposomes, immunoliposomes, polycationic, or lipid nanoparticles. Lipid transfection is described, for example, in U.S. Patent Nos. 5,049,386, 4,946,787; and 4,897,355, and lipid transfection reagents are commercially available (e.g., TransfectamT and Lipofectin™) and can be delivered to cells (e.g., in vitro or ex vivo administration) or target tissues (e.g., in vivo administration).

[0189] Various techniques and methods for delivering nucleic acids into cells are known in the art. For example, closed-end DNA vectors, including ICL DNA vectors, produced using synthetic methods as described herein, can be formulated into lipid nanoparticles (LNPs), lipidoids, liposomes, lipoplexes, or core-shell nanoparticles. Typically, LNPs consist of nucleic acid (e.g., ICL DNA) molecules, one or more ionizable or cationic lipids (or salts thereof), one or more nonionic or neutral lipids (e.g., phospholipids), anti-aggregation molecules (e.g., PEG or PEG-lipid conjugates), and optionally sterols (e.g., cholesterol).

[0190] Another method for delivering closed-end DNA vectors, including ICL DNA vectors, produced using the synthetic methods described herein, to cells is to conjugate nucleic acids with ligands that will be internalized by the cell. For example, ligands can bind to receptors on the cell surface and be internalized via endocytosis. Ligands can also be covalently linked to nucleotides in nucleic acids.

[0191] Nucleic acids, as well as closed-end DNA vectors, including ICL DNA vectors, produced using the synthetic methods described herein, can also be delivered to cells via transfection. Useful transfection methods include, but are not limited to, lipid-mediated transfection, cationic polymer-mediated transfection, or calcium phosphate precipitation. Transfection reagents are well known in the art. Nucleic acids, such as ICL DNA, can also be delivered to cells using microfluidic methods known to those skilled in the art.

[0192] Closed-end DNA vectors, including ICL DNA vectors, produced using the synthetic methods described herein can also be directly applied to organisms for transduction of cells in vivo. Application is via any route normally used to introduce molecules into final contact with blood or tissue cells, including but not limited to injection, infusion, topical application, and electroporation. Suitable methods for applying these nucleic acids are available and well known to those skilled in the art, and while more than one route can be used to apply a particular composition, a particular route often provides a more direct and efficient response than others.

[0193] Closed-end DNA vectors, including ICL DNA vectors, produced using the synthetic methods described herein, can be incorporated into liposomes for delivery to the cells or target organs of a subject. Liposomes are vesicles having at least one lipid bilayer. In the context of drug development, liposomes are commonly used as carriers for drug / therapeutic agent delivery. They function by fusing with the cell membrane and repositioning their lipid structure to deliver the drug or active pharmaceutical ingredient (API). Liposome compositions used for this type of delivery consist of phospholipids, particularly compounds having phosphatidylcholine groups; however, these compositions may also include other lipids.

[0194] Various delivery methods known in the art, or modifications thereof, can be used in vitro or in vivo to produce closed-end DNA vectors, including ICL DNA vectors, using the synthetic methods described herein. For example, in some embodiments, ICL DNA vectors are delivered by mechanical, electrical, ultrasonic, hydrodynamic, or laser-based energy to transiently permeate the cell membrane to facilitate DNA entry into target cells. For example, ICL DNA vectors can be delivered by squeezing cells through size-restricted channels or by transiently disrupting the cell membrane using other means known in the art. In some cases, the ICL DNA vector alone is injected directly as naked DNA into skin, thymus, cardiomyocytes, skeletal muscle, or hepatocytes. In some cases, ICL DNA vectors are delivered using a gene gun. Uncoated AAV vector-coated gold or tungsten spherical particles (1-3 μm in diameter) can be accelerated to high speeds by pressurized gas to permeate into target tissue cells.

[0195] This document specifically covers compositions comprising closed-end DNA vectors (including ICL DNA vectors) and pharmaceutically acceptable vectors produced using synthetic methods as described herein. In some embodiments, the ICL DNA vector is formulated with a lipid delivery system, such as the liposomes described herein. In some embodiments, such compositions are administered via any route desired by a skilled practitioner. The composition can be administered to a subject via various routes, including oral, parenteral, sublingual, percutaneous, rectal, mucosal, topical, inhalation, buccal administration, intrapleural, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intranasal sheath, and intra-articular, or combinations thereof. For veterinary use, the composition can be administered as a suitably acceptable formulation according to normal veterinary practice. Veterinarians can readily determine the dosing regimen and route of administration best suited to a particular animal. The composition can be administered via conventional syringes, needle-free injection devices, microparticle bombardment guns, or other physical methods such as electroporation (“EP”), hydrodynamic methods, or ultrasound.

[0196] In some cases, closed-end DNA vectors (including ICL DNA vectors) produced using synthetic methods as described herein can be delivered via hydrodynamic injection. This is a simple and efficient method for delivering any water-soluble compound and particle directly intracellularly to visceral organs and skeletal muscle throughout the limb.

[0197] In some cases, nanopores are created on membranes using ultrasound to facilitate intracellular delivery of DNA particles to cells of internal organs or tumors. This is to deliver closed-end DNA vectors (including ICL DNA vectors) produced using the synthetic methods described herein; therefore, the size and concentration of the closed-end DNA vectors play a crucial role in the efficiency of this system. In other cases, magnetic transfection using magnetic fields is employed to deliver closed-end DNA vectors (including ICL DNA vectors) produced using the synthetic methods described herein, thereby concentrating nucleic acid-containing particles into target cells.

[0198] In some cases, chemical delivery systems can be used, for example, by using nanocomposites, which include compressing negatively charged nucleic acids with polycationic nanoparticles belonging to cationic liposomes / micelles or cationic polymers. Cationic lipids used for delivery methods include, but are not limited to, monovalent cationic lipids, multivalent cationic lipids, muscle-containing compounds, cholesterol-derived compounds, cationic polymers (e.g., poly(ethyleneimine), poly-L-lysine, protamine, other cationic polymers), and lipid-polymer hybrids.

[0199] A. Exosomes:

[0200] In some embodiments, clustered DNA (including ICL DNA vectors) produced using synthetic methods as described herein is delivered by packaging in exosomes. Exosomes are small vesicles with a diameter between 30 and 150 nanometers, formed from endosomes via endocytosis, followed by fusion with the cell membrane, releasing the vesicle contents into the extracellular environment. Their surface consists of a lipid bilayer derived from the cell membrane of the donor cell, contains cytoplasm from the cell that produced the exosome, and displays membrane proteins from the parent cell on its surface. Exosomes are produced by various cell types, including epithelial cells, B and T lymphocytes, mast cells (MCs), and dendritic cells (DCs). Various pathways known in the art can be used to produce exosomes containing the capsid-free AAV vector of the present invention.

[0201] B. Microparticles / Nanoparticles:

[0202] In some embodiments, closed-end DNA vectors (including ICLDNA vectors) produced using synthetic methods as described herein are delivered via lipid nanoparticles. Typically, the lipid nanoparticles comprise ionizable amino lipids (e.g., 4-(dimethylamino)butyrate 37-carbon-6,9,28,31-tetraen-19-yl ester, DLin-MC3-DMA, phosphatidylcholine (1,2-distearyl-sn-glycerol-3-phosphatecholine, DSPC), cholesterol, and an outer lipid coating (polyethylene glycol-dimyristoylglycerol, PEG-DMG).

[0203] In some embodiments, the average diameter of the lipid nanoparticles is between about 10 nm and about 1000 nm. In some embodiments, the diameter of the lipid nanoparticles is less than 300 nm. In some embodiments, the diameter of the lipid nanoparticles is between about 10 nm and about 300 nm. In some embodiments, the diameter of the lipid nanoparticles is less than 200 nm. In some embodiments, the diameter of the lipid nanoparticles is between about 25 nm and about 200 nm. In some embodiments, the lipid nanoparticle formulation (e.g., a composition comprising a plurality of lipid nanoparticles) has a size distribution in which the average size (e.g., diameter) is from about 70 nm to about 200 nm, more typically about 100 nm or less.

[0204] Various lipid nanoparticles known in the art can be used to deliver closed-end DNA vectors (including ICL DNA vectors) produced using synthetic methods as described herein.

[0205] C. Conjugates

[0206] In some embodiments, closed-end DNA vectors (including ICL DNA vectors) produced using synthetic methods as described herein are conjugated to polymers (e.g., polymeric molecules) or folic acid molecules (e.g., folic acid molecules), to poly(amide) polymers, or to carbohydrates.

[0207] D. Nanocapsules

[0208] Alternatively, nanocapsule formulations containing closed-end DNA carriers (including ICL DNA carriers) produced using the synthetic methods described herein can be used. The capsules typically have a core-shell structure, where the core can be a drug, oil, or other active substance, while the shell is composed of biocompatible materials such as polymers, graphite, CNx, boron nitride, disulfides, etc.3. Nanocapsules are designed to improve the stability and bioavailability of the active substance, while enabling controlled release and targeted therapy.

[0209] E. Liposomes

[0210] Closed-end DNA vectors (including ICL DNA vectors) produced using the synthetic methods described herein can be incorporated into liposomes for delivery to the cells or target organs of a subject. Liposomes are vesicles having at least one lipid bilayer. In the context of drug development, liposomes are commonly used as carriers for drug / therapeutic agent delivery. They function by fusing with the cell membrane and repositioning their lipid structure to deliver the drug or active pharmaceutical ingredient (API). Liposome compositions used for this type of delivery consist of phospholipids, particularly compounds having phosphatidylcholine groups; however, these compositions may also include other lipids.

[0211] In some aspects, this disclosure provides a liposomal formulation comprising one or more compounds having a polyethylene glycol (PEG) functional group (so-called "PEGylated compounds"), the PEG functional group being capable of reducing the immunogenicity / antigenicity of said compound, providing it with hydrophilicity and hydrophobicity, and reducing the frequency of administration. Alternatively, the liposomal formulation may contain only a polyethylene glycol (PEG) polymer as an additional component. In these aspects, the molecular weight of PEG or the PEG functional group can range from 62 Da to about 5,000 Da.

[0212] In some aspects, liposome formulations comprise sphingomyelin and one or more lipids disclosed herein. In some aspects, liposome formulations comprise photosensitizers.

[0213] In some aspects, this disclosure provides a liposome formulation comprising one or more lipids selected from: N-(carbon-methoxy polyethylene glycol 2000)-1,2-distearyl-sn-glycerol-3-phosphate ethanolamine sodium salt, MPEG (methoxy polyethylene glycol) conjugated lipids, HSPC (hydrogenated soybean phosphatidylcholine); DSPE (distearyl-sn-glycerol-phosphate ethanolamine); DSPC (distearyl phosphatidylcholine); DOPC (dioleoyl phosphatidylcholine); DPPG (dipalmitoyl phosphatidylglycerol); EPC (lecithinylcholine); DO PS (dioleoylphosphatidylserine); POPC (palmitoyloleoylphosphatidylcholine); SM (sphingomyelin); MPEG (methoxy polyethylene glycol); DMPC (dimyristoylphosphatidylcholine); DMPG (dimyristoylphosphatidylglycerol); DSPG (distearylphosphatidylglycerol); DEPC (disorcinoylphosphatidylcholine); DOPE (dioleoyl-sn-glycerol-ethanolamine phosphate), cholesterol sulfate (CS), dipalmitoylphosphatidylglycerol (DPPG), DOPC (dioleoyl-sn-glycerol-phosphatidylcholine), or any combination thereof.

[0214] In some aspects, this disclosure provides a liposome formulation comprising, preferably, ionizable lipids, cholesterol, DSPC, and DMG-PEG in a molar ratio of 50:19.25:5:0.75 or 30:54.5:0:2, and in some aspects, the total lipid content of the liposome formulation is 2-16 mg / mL. In some aspects, this disclosure provides a liposome formulation comprising lipids containing phosphatidylcholine functional groups, lipids containing ethanolamine functional groups, and PEGylated lipids. In some aspects, this disclosure provides a liposome formulation comprising lipids containing phosphatidylcholine functional groups, cholesterol, and PEGylated lipids. In some aspects, this disclosure provides a liposome formulation comprising lipids containing phosphatidylcholine functional groups and cholesterol. In some aspects, the PEGylated lipid is PEG-2000-DSPE. In some aspects, this disclosure provides a liposome formulation comprising DPPG, soybean PC, MPEG-DSPE lipid conjugates, and cholesterol.

[0215] In some aspects, this disclosure provides a liposome formulation comprising one or more lipids containing a phosphatidylcholine functional group and one or more lipids containing an ethanolamine functional group. In some aspects, this disclosure provides a liposome formulation comprising one or more of the following: lipids containing a phosphatidylcholine functional group, lipids containing an ethanolamine functional group, and sterols, such as cholesterol. In some aspects, the liposome formulation comprises DOPC / DEPC and DOPE.

[0216] In some aspects, this disclosure provides a liposome formulation that further comprises one or more pharmaceutical excipients, such as sucrose and / or glycine.

[0217] In some aspects, this disclosure provides a liposome formulation that is structurally monolayered or multilayered. In some aspects, this disclosure provides a liposome formulation comprising multivesicular particles and / or foam-based particles. In some aspects, this disclosure provides a liposome formulation with a relatively larger size than conventional nanoparticles, having a size of about 150 to 250 nm. In some aspects, the liposome formulation is a lyophilized powder.

[0218] In some aspects, this disclosure provides a liposomal formulation prepared and loaded with an ICL DNA vector disclosed or described herein by adding a weak base to a mixture having isolated ICL DNA on the exterior of the liposomes. This addition raises the pH of the exterior of the liposomes to approximately 7.3 and drives the API into the liposomes. In some aspects, this disclosure provides a liposomal formulation with an acidic pH inside the liposomes. In such cases, the interior pH of the liposomes can be pH 4-6.9, more preferably pH 6.5. In other aspects, this disclosure provides a liposomal formulation prepared using an in vivo drug stabilization technique. In such cases, a polymeric or non-polymeric highly charged anion and an in vivo trapping agent, such as a polyphosphate or sucrose octasulfate, are utilized.

[0219] In some respects, this disclosure provides lipid nanoparticles comprising a DNA carrier (ICLDNA carrier) produced using the synthetic methods described herein and ionizable lipids.

[0220] Lipid particles are typically prepared with total lipids and ICL DNA in a mass ratio of about 10:1 to 30:1. In some embodiments, the mass ratio of lipids to ICL DNA can range from about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipids and ICL DNA can be adjusted to provide the desired N / P ratio, for example, an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10, or higher. Typically, the total lipid content of the lipid particle formulation can range from about 5 mg / mL to about 30 mg / mL.

[0221] Ionizable lipids are commonly used to concentrate nucleic acid cargoes (e.g., ICL DNA) at low pH and to drive membrane association and fusion. Typically, ionizable lipids are lipids containing at least one amino group that are positively charged or protonated under acidic conditions (e.g., at pH 6.5 or lower). Ionizable lipids are also referred to herein as cationic lipids.

[0222] There are no limitations; the molar content of ionizable lipids can be 20-90% (mol) of the total lipids present in the lipid nanoparticles. For example, the molar content of ionizable lipids can be 20-70% (mol), 30-60% (mol), or 40-50% (mol) of the total lipids present in the lipid nanoparticles. In some embodiments, the ionizable lipids account for about 50 mol% to about 90 mol% of the total lipids present in the lipid nanoparticles.

[0223] In some respects, lipid nanoparticles can further comprise non-cationic lipids. Non-cationic lipids include amphiphilic lipids, neutral lipids, and anionic lipids. Therefore, non-cationic lipids can be neutral and uncharged, zwitterionic, or anionic lipids. Non-cationic lipids are often used to enhance fusion properties.

[0224] The molar content of non-cationic lipids can be 0-30% (mol) of the total lipids present in the lipid nanoparticles. For example, the molar content of non-cationic lipids is 5-20% (mol) or 10-15% (mol) of the total lipids present in the lipid nanoparticles. In various embodiments, the molar ratio of ionizable lipids to neutral lipids is about 2:1 to about 8:1.

[0225] In some embodiments, the lipid nanoparticles do not contain any phospholipids. In some aspects, the lipid nanoparticles may further contain components such as sterols to provide membrane integrity.

[0226] An exemplary sterol that can be used in lipid nanoparticles is cholesterol and its derivatives.

[0227] For example, components that provide membrane integrity, such as sterols, may comprise 0-50% (mol) of the total lipids present in the lipid nanoparticles. In some embodiments, such components comprise 20-50% (mol) or 30-40% (mol) of the total lipid content of the lipid nanoparticles.

[0228] In some aspects, lipid nanoparticles may further comprise polyethylene glycol (PEG) or lipid molecules conjugated thereto. Typically, these serve to inhibit the aggregation of lipid nanoparticles and / or provide steric stability. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymer lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, such as a lipid conjugated with (methoxy-polyethylene glycol). Exemplary PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (e.g., 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoyl DMG), PEG-dialkoxypropyl DAA), PEG-phospholipids, PEG-ceramide (Cer), polyethylene glycol-modified phosphatidylethanolamine (PEG-PE), PEG-succinate diacylglycerol (PEGS-DAG) (e.g., 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(w-methoxy(polyethoxy)ethyl) ester (PEG-S-DMG)), PEG-dialkoxypropyl carbamate, N-(carbo-methoxy-polyethylene glycol 2000)-1,2-distearate-sn-glycerol-3-phosphate ethanolamine sodium salt, or mixtures thereof.

[0229] The PEG-DAA conjugate can be, for example, PEG-dilauroyloxypropyl, PEG-dimyristoyloxypropyl, PEG-dipalmitoyloxypropyl or PEG-distearateoxypropyl. PEG-lipids can be PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-distearatelglycerol, PEG-dilauryl saccharamide, PEG-dimyristyl saccharamide, PEG-dipalmitoyl saccharamide, PEG-distearatel saccharamide, PEG-cholesterol (1-[8'-(cholest-5-en-3[β]-oxy)carboxamido-3',6'-dioxaoctyl]carbamoyl-[ω]-methyl-poly(ethylene glycol)), PEG-DMB (3,4-di-tetradecyloxybenzyl-[ω]-methyl-poly(ethylene glycol) ether), and 1,2-dimyristoyl-sn-glycerol-3-phosphate ethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some instances, PEG-lipids can be selected from the group consisting of: PEG-DMG, 1,2-dimyristoyl-sn-glycerol-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000].

[0230] Lipids conjugated to molecules other than PEG can also be used instead of PEG lipids. For example, instead of PEG-lipids or PEG-lipids, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (e.g., ATTA-lipid conjugates), and cationic polymer lipid (CPL) conjugates can also be used. Exemplary conjugated lipids, namely PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer lipids, are described below.

[0231] In some embodiments, one or more additional compounds may be therapeutic agents. Therapeutic agents may be selected from any category suitable for the therapeutic purpose. In other words, therapeutic agents may be selected from any category suitable for the therapeutic purpose. In other words, therapeutic agents can be selected based on the therapeutic purpose and the desired biological action. For example, if the ICL DNA within the LNP can be used to treat cancer, then the additional compound may be an anticancer agent (e.g., a chemotherapeutic agent, a targeted cancer therapy (including, but not limited to, small molecules, antibodies, or antibody-drug conjugates)). In another example, if the LNP containing ICL DNA can be used to treat an infection, then the additional compound may be an antimicrobial agent (e.g., an antibiotic or antiviral compound). In yet another example, if the LNP containing ICL DNA can be used to treat an immune disease or condition, then the additional compound may be a compound that modulates the immune response (e.g., an immunosuppressant, an immunostimulatory compound, or a compound that modulates one or more specific immune pathways). In some embodiments, different mixtures of different lipid nanoparticles containing, for example, ICL DNA encoding different proteins and different compounds (therapeutic agents) may be used in the compositions and methods of the present invention.

[0232] In some embodiments, the additional compound is an immunomodulator. For example, the additional compound is an immunosuppressant. In some embodiments, the additional compound is an immunostimulant.

[0233] This article also provides pharmaceutical compositions comprising synthetically produced ICL DNA carriers encapsulated with lipid nanoparticles and pharmaceutically acceptable carriers or excipients.

[0234] In some aspects, this disclosure provides a lipid nanoparticle formulation that further comprises one or more pharmaceutical excipients. In some embodiments, the lipid nanoparticle formulation also comprises sucrose, tris, trehalose, and / or glycine.

[0235] Blocked-end DNA vectors, including ICL DNA vectors, synthesized using the methods described herein, can be complexed with or encapsulated within the lipid sites of lipid nanoparticles. In some embodiments, DNA vectors, including ICL DNA vectors, synthesized using the methods described herein, can be completely encapsulated within the lipid sites of lipid nanoparticles, thereby protecting them from nuclease degradation, for example, in aqueous solutions. In some embodiments, the DNA vectors (including ICL DNA vectors) synthesized using the methods described herein within the lipid nanoparticles are substantially undegraded after exposure to nucleases at 37°C for at least about 20, 30, 45, or 60 minutes. In some embodiments, the ICL DNA in the lipid nanoparticles is substantially not degraded after the particles are incubated in serum at 37°C for at least about 30 minutes, 45 minutes, or 60 minutes, or at least about 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, 24 hours, 26 hours, 28 hours, 30 hours, 32 hours, 34 hours, or 36 hours.

[0236] In some implementations, the lipid nanoparticles are substantially non-toxic to subjects, such as mammals, like humans. In some aspects, the lipid nanoparticle formulation is a lyophilized powder.

[0237] In some embodiments, the lipid nanoparticles are solid core particles having at least one lipid bilayer. In other embodiments, the lipid nanoparticles have a non-bilayer structure, i.e., a non-layered (i.e., non-bilayer) morphology. Non-bilayer morphologies can include, for example, three-dimensional tubes, rods, cubic symmetry, etc. For example, the morphology of lipid nanoparticles (layered versus non-layered) can be readily evaluated and characterized using, for example, Cryo-TEM analysis (as described in US2010 / 0130588, which is incorporated herein by reference in its entirety).

[0238] In some other embodiments, the lipid nanoparticles having a non-layered morphology are electronically dense. In some aspects, this disclosure provides lipid nanoparticles that are structurally monolayered or multilayered. In some aspects, this disclosure provides a lipid nanoparticle formulation comprising multivesicular particles and / or foam-based particles.

[0239] The pKa of the formulated cationic lipids can be correlated with the efficacy of LNP delivery of nucleic acids. The preferred range of pKa is about 5 to about 7. The pKa of the cationic lipids in the lipid nanoparticles was determined using a assay based on 2-(p-toluidine)-6-naphthalenesulfonic acid (TNS) fluorescence.

[0240] 5. Methods for delivering closed-end DNA vectors

[0241] In some implementations, closed-end DNA vectors (including ICL DNA vectors) produced using the synthetic methods described herein can be delivered to target cells in vitro or in vivo using various suitable methods. Closed-end DNA vectors, including ICL DNA vectors, produced using the synthetic methods described herein can be applied or injected alone. Closed-end DNA vectors (including ICL DNA vectors) produced using the synthetic methods described herein can be delivered to cells without the aid of transfection reagents or other physical means. Alternatively, any transfection reagent known in the art, or other physical means known in the art to promote DNA entry into cells, such as liposomes, alcohols, polylysine-rich compounds, arginine-rich compounds, calcium phosphate, microvesicles, microinjection, electroporation, etc., can be used to deliver closed-end DNA vectors (including ICL DNA vectors) produced using the synthetic methods described herein.

[0242] In another embodiment, closed-end DNA vectors (including ICL DNA vectors) produced using the synthetic methods described herein are administered to the CNS (e.g., the brain or eye). For example, ICL DNA vectors can be introduced into the spinal cord, brainstem (medulla oblongata, pons), midbrain (hypothalamus, thalamus, epithalamus, pituitary gland, substantia nigra, pineal gland), cerebellum, telencephalon (striatum, cerebrum including the occipital, temporal, parietal, and frontal lobes, cortex, basal ganglia, hippocampus and amygdala, limbic system, neocortex, striatum, cerebrum, and hypothalamus). ICL DNA vectors can also be administered to different regions of the eye, such as the retina, cornea, and / or optic nerve. ICL DNA vectors can be delivered into the cerebrospinal fluid (e.g., via lumbar puncture). In cases where the blood-brain barrier has been disturbed (e.g., brain tumor or cerebral infarction), closed-end DNA vectors (including ICL DNA vectors) produced using the synthetic methods described herein can also be administered intravascularly to the CNS.

[0243] In some embodiments, closed-end DNA vectors, including ICL DNA vectors, produced using the synthetic methods described herein, can be administered to desired CNS regions via any route known in the art, including but not limited to intrathecal, intraocular, intracerebral, intraventricular, intravenous (e.g., in the presence of sugars such as mannitol), intranasal, intraauricular, intraocular (e.g., vitreous, subretinal, anterior chamber), and periocular (e.g., subcapsular region), as well as intramuscular delivery retrogradely to motor neurons. In some embodiments, closed-end DNA vectors (including ICL DNA vectors) are produced using the synthetic methods described herein.

[0244] In some embodiments, closed-end DNA vectors (including ICL DNA vectors) produced using synthetic methods as described herein are administered in liquid formulations to desired regions or compartments in the CNS via direct injection (e.g., stereotactic injection). In other embodiments, synthetically produced ICL DNA vectors can be provided, for example, by topical application to the desired region or by intranasal administration of an aerosol formulation. Application to the eye can be made by topical application of droplets. As an alternative, ICL DNA vectors can be administered, for example, as solid sustained-release formulations. In further embodiments, synthetically produced ICL DNA vectors can be used for retrograde transport to treat, improve, and / or prevent diseases and conditions involving motor neurons (e.g., amyotrophic lateral sclerosis (ALS); spinal muscular atrophy (SMA), etc.). For example, synthetically produced ICL DNA vectors can be delivered to muscle tissue, from which they can migrate to neurons.

[0245] 6. Other uses of ICL DNA vectors

[0246] Compositions and closed-terminal DNA vectors (including ICL DNA vectors) produced using the synthetic methods described herein can be used to express target genes and transgenes for various purposes. In some embodiments, the resulting transgene encodes a gene intended for use in creating animal disease models, for example, to study the function of the transgene product. In another embodiment, the resulting transgene encodes one or more proteins or functional RNAs that can be used for treatment or prevention. In some embodiments, the resulting transgene encodes one or more peptides, polypeptides, or proteins that can be used to treat, prevent, or improve a disease state or symptom in a mammalian subject. The resulting transgene can be adequately transferred to a subject (e.g., expressed therein) to treat a disease associated with reduced, absent, or dysfunctional expression of the gene. In some embodiments, the resulting transgene can be adequately expressed in a subject to treat a disease associated with the suppression or otherwise reduced expression of a gene by the resulting transgene, or with increased expression, activity, or inappropriate upregulation of the gene product. In other embodiments, the resulting transgene replaces or complements a defective copy of the natural gene. Those skilled in the art will understand that a transgene may not be an open reading frame of the gene itself to be transcribed; rather, it may be a promoter or repressor region of a target gene, and an ICL DNA vector may modify such a region to regulate the expression of the gene of interest.

[0247] 7. Instructions for use

[0248] The techniques described herein also demonstrate how to use the closed-end DNA vectors (including ICL DNA vectors) synthesized by the methods described herein, including, for example, ectopic, in vitro and in vivo applications, methods, diagnostic procedures and / or gene therapy protocols.

[0249] Synthesized closed-terminal DNA vectors, such as the ICL DNA vectors disclosed herein, can also be used in methods for delivering nucleotide sequences of interest (e.g., transgenes) to target cells (e.g., host cells). These methods can particularly be for delivering transgenes to the cells of a subject in need and for treating a disease of interest. This invention allows transgenes encoded in ICL DNA vectors, such as proteins, antibodies, nucleic acids (e.g., miRNAs), to be expressed in vivo in the cells of a subject, thereby enabling the expression of the transgene to exert a therapeutic effect. These results can be observed in both in vivo and in vitro delivery modes using closed-terminal DNA vectors (e.g., ICL DNA vectors).

[0250] Furthermore, the present invention provides a method for delivering transgenes in the cells of a subject in need, the method comprising multiple administrations of a synthetically produced closed-terminal DNA vector (e.g., an ICL DNA vector) containing the nucleic acid or transgene of interest. Since the ICL DNA vector of the present invention does not induce an immune response as typically observed with encapsulated viral vectors, such a multiple-administration strategy is likely to achieve greater success in ICL DNA-based systems.

[0251] Synthesized closed-end DNA vectors (e.g., ICL DNA vectors) are administered in amounts sufficient to transfect cells in the desired tissue and provide adequate gene transfer and expression levels without excessive adverse effects. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, intravenous (e.g., in liposomal formulations), direct delivery to selected organs (e.g., intravenous delivery to the liver via the portal vein), intramuscular, and other parenteral routes. If necessary, routes of administration can be combined.

[0252] Delivery of closed-end DNA vectors (e.g., ICL DNA vectors) is not limited to delivering gene substitutions. For example, synthetically produced closed-end DNA vectors (e.g., ICL DNA vectors) as described herein can be used in conjunction with other delivery systems provided as part of gene therapy. A non-limiting example of a system that can be combined with synthetically produced ICL DNA vectors according to this disclosure includes systems that deliver alone one or more cofactors or immunosuppressants for efficient gene expression of transgenes.

[0253] The present invention also provides a method for treating a disease in a subject, the method comprising introducing a composition or formulation containing a therapeutically effective amount of a synthetically generated closed-terminal DNA (e.g., an ICL DNA vector) optionally with a pharmaceutically acceptable carrier into desired target cells (particularly muscle cells or tissues) of the subject. While, for example, a synthetically generated ICL DNA vector may be introduced in the presence of a carrier, such a carrier is not required. The selected, for example, synthetically generated ICL DNA vector contains a nucleotide sequence of interest that can be used to treat the disease. Specifically, for example, a synthetically generated ICL DNA vector may contain a desired exogenous DNA sequence operatively linked to a control element capable of directing the transcription of a desired polypeptide, protein, or oligonucleotide encoded by the exogenous DNA sequence when introduced into the subject. For example, a synthetically generated ICL DNA vector may be administered via any suitable route as provided above and elsewhere herein.

[0254] The ICL DNA vector compositions or formulations provided herein comprise one or more synthetically produced ICL DNA vectors of the present invention together with one or more pharmaceutically acceptable buffers, diluents, and / or excipients. Such compositions may be included in one or more diagnostic or therapeutic kits for the diagnosis, prevention, treatment, or improvement of one or more symptoms of a disease, injury, condition, trauma, or dysfunction. In one aspect, the disease, injury, condition, trauma, or dysfunction is a human disease, injury, condition, trauma, or dysfunction.

[0255] Another aspect of the technology described herein provides a method for providing a diagnostically or therapeutically effective amount of a synthetically produced ICL DNA vector to a subject in need, the method comprising providing the subject's cells, tissues, or organs with a synthetically produced ICL DNA vector as disclosed herein, the amount and timing of which effectively enables transgene expression from the ICL DNA vector, thereby providing the subject with a diagnostically or therapeutically effective amount of proteins, peptides, or nucleic acids expressed by the ICL DNA vector. In this other aspect, the subject is a human being.

[0256] Another aspect of the technology described herein provides a method for diagnosing, preventing, treating, or improving at least one or more symptoms of a disease, condition, dysfunction, injury, abnormality, or trauma in a subject. Generally speaking, the method includes at least the following steps: administering one or more of the disclosed synthetically produced ICL DNA vectors to a subject in need, in an amount and for a duration sufficient to diagnose, prevent, treat, or improve the subject's disease, condition, dysfunction, injury, abnormality, or trauma. In this other aspect, the subject is a human being.

[0257] Another aspect is the use of synthetically generated ICL DNA vectors as tools for treating or alleviating one or more symptoms of a disease or disease state. Defective genes in many hereditary diseases are known, generally falling into two categories: defective states, usually enzymatic and generally inherited in a recessive manner; and unbalanced states, which may involve regulatory or structural proteins and are usually, but not always, inherited in a dominant manner. For defective state diseases, synthetically generated ICL DNA vectors can be used to deliver transgenes to bring normal genes into diseased tissues for alternative therapy; in some embodiments, antisense mutations are also used to create animal disease models. For unbalanced disease states, the disease state can be created in a model system using synthetically generated ICL DNA vectors, which can then be used to counteract the disease state. Therefore, the synthetically generated ICL DNA vectors and methods disclosed herein allow for the treatment of hereditary diseases. As used herein, disease states can be treated by partially or completely rescuing defects or unbalances that cause or exacerbate the disease.

[0258] ICL DNA vectors produced using the synthetic methods described herein can be used to treat, improve, or prevent eye diseases including those involving the retina, posterior optic nerve, and retina (e.g., retinitis pigmentosa, diabetic retinopathy and other retinal degenerative diseases, uveitis, age-related macular degeneration, glaucoma). Many eye diseases and conditions are associated with one or more of three types of indications: angiogenesis, inflammation, and degeneration. In some embodiments, ICL DNA vectors produced using the synthetic methods described herein can be used to deliver anti-angiogenic factors, anti-inflammatory factors, factors that delay cell degeneration, factors that promote cellular immunity or cell growth, and combinations thereof. For example, diabetic retinopathy is characterized by angiogenesis. Diabetic retinopathy can be treated by delivering one or more anti-angiogenic factors intraocularly (e.g., in the vitreous humor) or periocularly (e.g., in the subcapsular region of the eyeball). One or more neurotrophic factors can also be co-delivered intraocularly (e.g., in the vitreous humor) or periocularly. Other eye diseases that can be treated, improved, or prevented using the ICL DNA vector of the present invention include: geographic atrophy, vascular or “wet” macular degeneration, Stargardt disease, Leber congenital amaurosis (LCA), Usher syndrome, pseudoxanthoma elastica (PXE), X-linked retinitis pigmentosa (XLRP), X-linked retinoschisis (XLRS), choroidal agenesis, Leber hereditary optic neuropathy (LHON), color blindness, cone-rod dystrophy, Fuchsendothelial corneal dystrophy, diabetic macular edema, and eye cancers and tumors.

[0259] In some embodiments, inflammatory ocular diseases or conditions (e.g., uveitis) can be treated, improved, or prevented using ICL DNA vectors produced by the synthetic production methods described herein. One or more anti-inflammatory factors can be expressed by intraocular (e.g., vitreous or anterior chamber) administration of ICL DNA vectors produced by the synthetic production methods described herein. In other embodiments, ocular diseases or conditions characterized by retinal degeneration (e.g., retinitis pigmentosa) can be treated, improved, or prevented using the ICL DNA vectors of the present invention. Intraocular (e.g., vitreous) administration of ICL DNA vectors encoding one or more neurotrophic factors produced by the synthetic production methods described herein can be used to treat such diseases based on retinal degeneration. In some embodiments, diseases or conditions involving both angiogenesis and retinal degeneration (e.g., age-related macular degeneration) can be treated using ICL DNA vectors produced by the synthetic production methods described herein. Age-related macular degeneration can be treated by intraocular (e.g., vitreous) administration of an ICL DNA vector encoding one or more neurotrophic factors, produced by the synthetic production method described herein, and / or intraocular or periocular (e.g., in the subcapsular region of the ocular fascia) administration of an ICL DNA vector encoding one or more anti-angiogenic factors, produced by the synthetic production method described herein. Glaucoma is characterized by elevated intraocular pressure and loss of retinal ganglion cells. Treatment of glaucoma includes the administration of one or more neuroprotective agents that protect cells from excitotoxic damage using an ICL DNA vector as disclosed herein.

[0260] In one embodiment of the invention, such a formulation includes an N-methyl-D-aspartate (NMDA) antagonist, cytokines, and neurotrophic factors, and can be delivered intraocularly, optionally intravitreally, using an ICL DNA vector produced by the synthetic production method described herein.

[0261] In some implementations, the synthesized ICL DNA vector is not limited to one type of ICL DNA vector. Thus, on the other hand, multiple ICL DNA vectors containing different transgenes or the same transgene but operatively linked to different promoters or cis-regulatory elements can be simultaneously or sequentially delivered to target cells, tissues, organs, or subjects. Therefore, this strategy can allow for simultaneous gene therapy or gene delivery of multiple genes. Different portions of the transgene can also be routed to separate ICL DNA vectors (e.g., different domains and / or cofactors required for the functionality of the transgene), which can be administered simultaneously or at different times and can be regulated separately, thereby adding additional control over the level of transgene expression. Given the lack of an anti-capsid host immune response due to the absence of a viral capsid, delivery can also be performed multiple times, and for gene therapy in a clinical setting, it is important to subsequently increase or decrease the dose. It can be anticipated that, due to the absence of a capsid, no anti-capsid response will occur.

[0262] Example 1: Method for synthesizing ICL DNA vector (see...) Figure 1 and Figure 2 )

[0263] (1) Synthesis and annealing of phosphorylated ITR

[0264] 1) Designing inverted terminal repeat (ITR) sequences: Add a dangling element containing a cleavage dangling element complementary to the restriction endonuclease restriction site to the end of the ITR sequence. An exemplary ITR structure is shown below. Figures 3A-3D As shown.

[0265] 2) The above ITR sequence was synthesized by chemical synthesis:

[0266] ITR sequence synthesis employs the solid-phase phosphoramidite method, which mainly involves fixing DNA onto a solid support to complete the DNA chain synthesis. The DNA chain is extended from the 3' end to the 5' end, with adjacent nucleotides linked by a 3'→5' phosphodiester bond.

[0267] (2) Construct an expression cassette containing cis-regulatory elements and the target gene (taking the ICL DNA1 vector with nucleotide sequence SEQ ID NO:12 as an example). Using a plasmid vector (plasmid backbone is https: / / www.addgene.org / vector-database / 2093 / ) as a template, insert the luciferase gene sequence (GenBank: MK484105.1) into the middle coding region of the plasmid vector. The expression cassette is generated by PCR amplification of the plasmid template.

[0268] 1) Synthesis of PCR primers containing restriction endonuclease sites and protective bases: GCATCAGATCTGCAAGGCTTGACCGACAATT (SEQ ID NO:13) is the forward primer for the expression cassette containing bglII endonuclease; GCATCGTCGACCCGCCTCAGAAGCCATAGAG (SEQ ID NO:14) is the reverse primer for the expression cassette containing SalI endonuclease; GCATCGTCGACGCAAGGCTTGACCGACAATT (SEQ ID NO:15) is the forward primer for the expression cassette containing SalI endonuclease. For expression cassettes with different structures, the above-mentioned reverse primers containing SalI endonuclease were used for amplification to ensure that the sequences of other parts of the expression cassette are consistent except for the optimized structural part. For the selection of forward primers, forward primers containing SalI sites are selected, and the two ends of the expression cassette will be connected with the same ITR sequence. Forward primers containing bglII sites are selected, and different ITR sequences are connected.

[0269] 2) PCR amplification and enzyme digestion

[0270] In a 50 μL reaction system, add 25 μL of 2×Buffer (containing dNTPs), 50 ng of plasmid template DNA, 5 μL of a mixture containing forward and reverse primers (each primer concentration 10 mM), and 1 U of high-fidelity DNA polymerase (Yisheng, 10148ES76). Place the mixture in a PCR instrument and set the following thermal cycling program: the initial denaturation phase is set at 98 °C for 3 minutes to ensure complete DNA denaturation; followed by multiple cycles, each cycle including denaturation at 98 °C (10 seconds), annealing at 68 °C (20 seconds), and extension at 72 °C at a rate of 30 seconds per kb DNA; finally, perform a final extension step at 72 °C for 5 to 10 minutes to ensure complete extension of all DNA fragments. PCR products were analyzed by agarose gel electrophoresis, and the amplification of synthesized ICL DNA1 was as follows: Figure 4A As shown, the synthesized product bands were clear and single, no primer dimers were observed, and the yield was high. After purification, the PCR product was used for subsequent enzyme digestion. The specific enzyme digestion conditions were as follows: in every 100 μL of reaction system, 10 μL of 10× buffer (Yisheng, 10301ES40), 1 μL of BglII endonuclease (10 U / μL), 1 μL of SalI endonuclease (10 U / μL) and 6 μg of expression cassette sequence were added, and the mixture was incubated at 37℃ for 16 h.

[0271] (3) T4 DNA ligase ligates the expression cassette and ITR

[0272] The digested expression cassette was added to both ends of the ITR sequences at a specific molar ratio and ligated using T4 DNA ligase. In a 200 μL reaction system, 20 μL of 10×T4 DNA ligase reaction buffer (Yisheng, 10301ES40), 1 μL (400 U / μL) of T4 DNA ligase, 8 μg of the digestion product, and an equimolar ratio of ITR sequences were added. The mixture was incubated at room temperature for 16 hours.

[0273] To reduce vector self-ligation and enhance the ligation efficiency between ITR and expression vectors, different molar ratios (3:1, 6:1, 12:1, 24:1, 48:1, 96:1) of the total ITR to the expression cassette of the ICL DNA1 expression vector were set. Agarose gel electrophoresis was used to observe the ligation products. The results showed that when the molar ratio reached 96:1, self-ligation between expression vectors was effectively suppressed. Figure 4B Therefore, this study decided to use a 96:1 molar ratio for ligation in subsequent experiments to achieve optimal ligation efficiency and avoid self-ligation problems. Removal of unused ITR: 0.4 × 10⁴ volumes of DNA beads (Novizan, N411-01) were added to the ligation reaction system. After binding for 5 min, the mixture was washed twice with 80% anhydrous ethanol, followed by elution with double-distilled water to remove bound DNA and unbound ITR from the reaction system. The principle is that DNA beads of different concentrations bind DNA fragments of different sizes. DNA beads bind larger ICL DNA sequences, while ITR sequences, due to their smaller molecular weight, cannot be bound by DNA beads and remain in the ligation system. The DNA beads bound to the expression cassette are then eluted with water to obtain high-purity ICL DNA. Figure 4C As shown, the ICL DNA recovery rate during this process is over 95%, with high purity. The 260 / 280 ratio is between 1.8 and 1.9, and the 260 / 230 ratio is between 2 and 2.5. The entire process takes 10-20 minutes, which is relatively short. Most importantly, there is no ITR residue in the recovered product.

[0274] (4) Removal of expression cassettes with incompletely closed ends: Some ITR expression cassettes have no ITRs at either end. Since the ITR size is only about 100 nt, the molecular weight difference between products with both ends connected, one end connected, or neither end connected is small, making purification by liquid chromatography or gel extraction impossible. Using the exonuclease activity of T7 DNA polymerase (Thermo Fisher Scientific, EP0081), incompletely closed expression vectors are removed, recovering high-purity ICL DNA. Specifically, in the purified expression cassette system, 0.5 U of T7 DNA polymerase is added per 1 μg of expression cassette, and the reaction is carried out at 37°C for 1 h to remove incompletely closed expression cassettes. The results are as follows: Figure 4DAs shown.

[0275] (5) ICL DNA purity detection

[0276] Capillary electrophoresis of synthesized ICL DNA to assess its purity is a common and effective experimental method. In one implementation case, Figure 4E The purity of the synthesized ICL DNA1 was determined by capillary electrophoresis. The single-peak display results showed that the tested ICL DNA samples were highly pure, lacking obvious impurities or adulterants. These findings ensured the high quality of the ICL DNA samples.

[0277] Example 2 ICL DNA Vector

[0278] ICL DNA vectors have the simplest cis-acting elements and target gene: promoter / enhancer, target gene, polyadenylated sequence, and ITRs at both ends.

[0279] The expression efficiency of the ICL DNA vector was detected by in vitro cell experiments. The ICL DNA1 vector contains a CMV enhancer, a CMV promoter, a luciferase expression gene (GenBank: MK484105.1), a polyA element, and ITR sequences from AAV2 at both ends. The specific steps for detection are as follows:

[0280] (1) Cell culture and plating: One day before the experiment, HEK293T (CRL-11268) cell suspension was plated at 2 × 10⁻⁶ cells per well. 4 Cells are seeded into 96-well plates to allow them to reach an appropriate growth state (usually 60-80% confluence) at transfection. The cell culture medium should contain 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Thermo Fisher Scientific), and cultured at 37°C and 5% CO2.

[0281] (2) Transfection: 12 hours after cell plating, the transfection mixture was prepared using Thermo Fisher Lipo2000 lipid transfection reagent at a rate of 3 μL per microgram of DNA. The transfection mixture was added to each well. Based on the amount of DNA vector added, three groups were set up: 25 ng, 50 ng and 100 ng.

[0282] (3) Culture and detection: Continue culturing cells for 48 hours to allow for full expression of the luciferase gene. After 48 hours, add buffer containing the substrate D-luciferin (Yisheng, 11404ES80) to each well. This substrate will be catalyzed by luciferase to produce light. Place the 96-well plate in a microplate reader (luminescence analyzer) and measure the fluorescence intensity of each well. The fluorescence intensity is directly proportional to the luciferase activity, thus reflecting the expression level of the ICL DNA vector in cells. Figure 6A The control plasmid (https: / / www.addgene.org / vector-database / 2093 / ) vector (inserting the Luciferase gene, sequence source, GenBank: MK484105.1) contains the same promoter, target gene, and poly(A) tail sequence as the ICL DNA1 vector, but the plasmid contains additional elements such as resistance genes.

[0283] ITR plays an important role in the replication and packaging of AAV virus and is an important cis-activation sequence of AAV. By comparing the terminally closed DNA vector ILC DNA1 (its nucleotide sequence is shown in SEQ ID NO:12) containing ITR sequences (GATCAGGAACCTGCAGGCAGCTGCGCGCTCGCTCGCACTGAGGCCGCCCGG GCAAAGCCCGGGCGTCGGGCACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCGCAGA GAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO:1) and TCGACCTGCAGGAAC CCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCTCGCTCACTGAGGCCGGGCGACC AAAGGTCGCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG (SEQ ID NO:2)) with the terminally closed DNA vector LC DNA (which does not contain ITR sequences and has the same expression cassette structure as ILC DNA1, using GATCA ggccg) The difference in intracellular expression efficiency between gccgttttcggccggccA (nucleotide sequence as shown in SEQ ID NO:16) and TCGACggccg gccgttttcg gccggccG (nucleotide sequence as shown in SEQ ID NO:17) reveals the potential role of ITR sequences in gene expression regulation. Experimental results show that ( Figure 6B ICL DNA vectors containing ITR sequences exhibited higher expression levels compared to LC cDNA vectors containing only ordinary hairpin structures. This phenomenon suggests that ITR sequences may enhance gene expression through multiple mechanisms.

[0284] In addition to allowing for the formation of hairpin secondary structures, the ITR sequence also retains the Rep binding site (RBS) and the terminal dissociation site (trs). The modified ITR sequence retains the RBS, trs sequences, and the structure and position of the Rep binding element from the corresponding sequence of wild-type AAV2 ITR, forming the terminal loop portion of one of the hairpin secondary structures of ITR. Here, we compared a conventional ITR (artificially designed containing RBS, trs sequences, and Rep binding elements) with an ITR from the AAV2 virus. ICL DNA1 had a wild-type ITR from the AAV2 virus and a modified ITR relative to the wild-type ITR at both ends. ICL DNA2 had two different conventional ITRs at both ends (GATCTGCGCGCTCGCTCGCTCACTGAGGCCGCC CGGGCAAAGCCCGGGCGTCGGGCGTTTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCA (SEQ ID NO.3) and TCGACGCGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGC CCTTTGGGCGGCCTCAGTGAGCGAGCGAGCGCGCG (SEQ ID NO.4)). This means that compared to ICL DNA1, the expression cassette sequence remained unchanged, only the ITR sequence was replaced. ICL DNA3 had modified ITRs from the AAV2 virus at both ends. R(TCGACCTGCaggaacccctagtgatggagttggccactccctctctgCgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccg acgcccgggcggcctcagtgagCgagcgagCgcgcagCtgCctgcaGG), which also replaces the ITR sequence. By comparing the expression levels of these vectors in cells, such as... Figure 6C The study showed that all three types of ICL DNA could express the target gene. The ICL DNA1 vector containing ITR derived from AAV2 virus showed higher gene expression efficiency than ICL DNA2. Further analysis showed that ICL DNA1, with different ITR sequences at both ends, had better expression efficiency than ICL DNA3, which had the same sequences at both ends and both derived from AAV2 virus.

[0285] Example 3: Optimization of carrier structure

[0286] To enhance gene expression efficiency and prolong its duration of action, this study optimized key elements of the ICL DNA1 vector. The first step in optimization was sequence modification within the corresponding plasmid template, which was then used as a template for the target expression cassette sequence in PCR amplification. In this element optimization, the marmot hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO:6) was specifically introduced and placed between the target gene and the polyadenylated tailing signal (polyA), i.e., sequence...

[0287] The sequence acattccacattccTCTAGA (SEQ ID NO:18) and TCTAGAGGGGCCCGTTTAAAC (SEQ ID NO:19) are related. WPRE sequences have been shown to significantly enhance gene expression stability and efficiency in multiple biological systems. This effect is mainly attributed to the positive influence of WPRE on mRNA processing, nuclear export, and stability. In this study, a closed-terminal DNA vector ICLDNA-WPRE containing the WPRE sequence was constructed and compared with a control vector (ICLDNA1) without the WPRE sequence. Experimental results are as follows: Figure 6D As shown, the ICL DNA-WPRE vector containing the WPRE sequence clearly demonstrates superior gene expression levels compared to the control group. This result definitively confirms the significant role of the WPRE sequence in enhancing gene expression efficiency in closed-terminal DNA vectors, thereby improving gene expression stability and prolonging its duration.

[0288] To further improve the expression efficiency of this vector, we further optimized the expression cassette element based on the WPRE element. In eukaryotes, the Kozak sequence is a key nucleic acid sequence located after the 5' cap structure of mRNA, and its function is to recruit translation initiation factors, thereby promoting the translation initiation of mRNA containing the 5' cap structure. Therefore, we introduced a Kozak sequence before the start codon of the target gene, namely the sequence AGCTGGCTAGCacattccacattccacattcc (SEQ ID NO:20) between the start codon ATG of the target gene, in order to enhance translation efficiency. We screened three different Kozak sequences for testing: Kozak1 (GCCACC), Kozak2 (GCCACCATGG, SEQ ID NO:21), and Kozak3 (GCCACCATGGGC, SEQ ID NO:21).

[0289] (SEQ ID NO:22). Using the aforementioned synthesis method, we prepared three different ICL DNA vectors—ICL DNA1-WPRE-K1, ICL DNA1-WPRE-K2, and ICL DNA1-WPRE-K3—based on the ICL DNA-WPRE vector. Each vector contained a unique Kozak sequence, and these vectors were compared with those containing only ICL DNA WPRE. These constructed vectors were then transfected into 293T cells using Lipo2000, and the expression level of luciferase was detected using a microplate reader. Experimental results are shown below. Figure 6E As shown, under high-dose transfection conditions, ICL DNA vectors containing the Kozak1 (ICL DNA1-WPRE-K1) and Kozak3 (ICL DNA1-WPRE-K3) sequences exhibited significantly increased luciferase expression levels. In summary, the addition of the Kozak1 or Kozak3 sequence can effectively enhance the expression intensity of ICL DNA. In subsequent structural optimization and functional experiments, the Kozak1 sequence was chosen to be integrated into the expression cassette to achieve optimal expression and biological function. To demonstrate the integrity of the ICL DNA1-WPRE-K1 end-closure structure, Figure 6F-6H The integrity of ICL DNA end closures was identified by agarose gel electrophoresis under both natural and denaturing conditions. Restriction endonuclease digestion with NdeI followed by electrophoresis of the digestion products was used for evaluation. After restriction endonuclease lysis and gel electrophoresis analysis, the presence of characteristic bright bands migrating at twice the size on the denaturing gel compared to the natural gel, and the presence of monomeric and dimer (2x) bright bands on the denaturing gel of the undylated material, are characteristic of ICL DNA vectors. Figure 6F As shown, the ICL DNA1-WPRE-K1 vector, after digestion with NdeI, will produce 750bp and 2750bp fragments. However, the ICL DNA1-WPRE-K1 vector with a continuous structure will open its double strands under denaturing gel conditions, and fragments of 1500nt and 5500nt are expected to be observed. Figure 6G and 6H As shown, under the action of NdeI, fragments of 750bp and 2750bp in ICL DNA1-WPRE-K1 can be observed in normal agarose gel, while in alkaline denaturing gel, the 750bp fragment is opened and a fragment of 1500nt in size is observed, which proves the continuity of the vector.

[0290] To verify the compatibility of the LCL DNA vector with other promoters and to assess the impact of different promoters on gene expression, this study also employed a strategy of sequence optimization within the plasmid template. The optimized plasmid was used as a template for PCR amplification to generate the target expression cassette sequence. Specifically, based on ICL DNA1-WPRE-K1, we used EF1α (SEQ ID NO:9) and...

[0291] The SV40 (SEQ ID NO:11) sequence replaced the CMV promoter and enhancer sequences (SEQ ID NO:8 and SEQ ID NO:10), and three different ICL DNA vectors containing promoters were transfected into 293T cells. Experimental results are as follows: Figure 6I As shown, in linear DNA expression vectors with closed ends, the CMV, EF1α, and SV40 promoters can all effectively initiate the expression of luciferase reporter genes. However, by comparing the luciferase expression levels mediated by these three promoters, it was found that the CMV promoter is more efficient in promoting the expression of the target gene. This finding confirms that LCL DNA vectors have the ability to carry different promoters, and that the efficiency of gene expression can be optimized by selecting appropriate promoters.

[0292] The ICL DNA vector, after integrating the CMV promoter, Kozak1 sequence, and WPRE element, exhibits superior gene expression performance. This optimization strategy aims to improve the efficiency and stability of gene expression through the synergistic effect of these elements. The CMV promoter is widely used due to its ability to drive high levels of gene expression. The addition of the Kozak1 sequence further optimizes the translation initiation efficiency of mRNA, while the WPRE element enhances mRNA stability and translation efficiency. The combined application of these elements provides a solid molecular biological foundation for constructing an efficient gene expression system. The next step is to validate the in vivo expression of this optimized ICL DNA1-WPRE-K1 vector.

[0293] Example 4: Preparation of lipid nanoparticles (C3-ILC DNA) encapsulating ILC DNA carrier

[0294] 1. Preparation of ionizable lipid C3

[0295]

[0296] Step 1: Synthesis of intermediates 1-2

[0297] To a solution of citronellol (16.86 mmol, 1 eq) and triethylamine (16.86 mmol, 1 eq) in dichloromethane (100 mL), p-nitrophenyl chloroformate (20.03 mmol, 1.2 eq) dissolved in dichloromethane was slowly added dropwise. The reaction mixture was stirred at room temperature for 3 h, and the reaction was stopped. The mixture was extracted with water, and the combined organic layers were dried over MgSO4 and the solvent was removed under vacuum to give crude product 1-1. Hydroxyethyl acrylate (20.03 mmol, 1.2 eq), potassium carbonate (20.03 mmol, 1.2 eq), and N,N-dimethylformamide solvent (200 mL) were added to a 250 mL round-bottom flask containing crude product 1-1. The mixture was stirred at 80 °C for 3 h, and TLC showed that compound 1-1 completely disappeared. After removing DMF under vacuum, the product was washed with brine, and the combined organic layers were dried with MgSO4 and the solvent was removed under vacuum to obtain a crude product. The crude product was purified by column chromatography (elution buffer: PE / EA = 10 / 1), and the pure product fraction was evaporated to obtain a pale yellow oily compound 1-2 (10.06 g, 69%). 1 H NMR (400MHz, CDCl3) δ6.51–6.39(m,1H),6.23–6.09(m,1H),5.86(dd,J=6.5,5.2Hz ,1H),5.08(dd,J=7.7,6.5Hz,1H),4.38(s,4H),4.25–4.12(m,2H),1.98(dt,J=21.1 ,7.2Hz,2H),1.73(dd,J=13.0,5.5Hz,1H),1.68(s,3H),1.60(s,3H),1.50(ddd,J= 26.5,18.9,9.7Hz,2H),1.40–1.29(m,1H),1.22–1.13(m,1H),0.92(d,J=6.5Hz,3H)

[0298] Step 2: Synthesis of compound C3

[0299] N,N-dimethylethylenediamine (0.33 mmol, 1 eq) and compounds 1-2 (1.01 mmol, 3 eq) were mixed and stirred at 70 °C for 48 h. The mixture was purified by column chromatography (silica gel column, eluent was dichloromethane solution containing 0-10% methanol (v / v)) to give compound C3 (370 mg, 54%) as a pale yellow oil. 1H NMR (400MHz, CDCl3) δ5.08 (dd, J=7.7, 6.5Hz, 4H), 4.31 (dd, J=11.7, 5.6Hz, 18H), 4.19 (dd,J=13.5,6.5Hz,8H),2.79(t,J=7.1Hz,8H),2.55–2.40(m,16H),1.98(dt,J=14.8,7 .2Hz,8H),1.75–1.69(m,4H),1.68(s,12H),1.60–1.52(m,17H),1.51–1.43(m,4H),1. 34(dt,J=11.7,7.1Hz,4H), 1.20(ddd,J=13.7,8.0,5.4Hz,4H), 0.92(d,J=6.5Hz,12H).

[0300] 2. The lipid components of the lipid nanoparticles encapsulating the ILC DNA carrier include ionizable lipid C3, cholesterol, DSPC, and DMG-PEG. When the lipid nanoparticles are injected intramuscularly, their molar ratio is 50:19.25:5:0.75 (in intravitreal injection and tail vein injection experiments, the ratio is 30:54.5:0:2). These lipid components are accurately weighed and mixed in anhydrous ethanol to form an organic phase solution. In addition, a 25 mM sodium acetate solution with a pH of 5.2 was prepared as the aqueous phase. ICL DNA vector was added to the aqueous phase at a certain mass ratio (30:1 for intravitreal injection experiments; 10:1 for intramuscular and tail vein injection experiments). Then, the organic phase and aqueous phase were rapidly mixed at a volume ratio of 1:3 using microfluidic mixing technology to form a preliminary LNP structure. After the preliminary LNP was allowed to stand for 15 min, an equal volume of 25 mM NaAC was added, and the solution was purified by dialysis in ultrapure water and 1×DPBS for 1 h and 3 h, respectively, to remove unreacted lipids and organic solvents and achieve effective encapsulation of nucleic acids.

[0301] To evaluate the encapsulation efficiency of lipid nanoparticles on ICL DNA vectors, nucleic acid gel electrophoresis was performed, and the results are as follows: Figure 7A As shown in the diagram, in the gel electrophoresis analysis, the first well contained ICL DNA vectors encapsulated by LNPs, while the second well contained naked ICL DNA vectors. Due to the encapsulation effect of the LNPs, the ICL DNA vectors could not migrate in the gel, thus forming visible bands in the corresponding wells, indicating that the ICL DNA was effectively encapsulated inside the LNPs. Conversely, the naked ICL DNA vectors, serving as the control group, were able to migrate freely in the gel to their intended locations.

[0302] Example 5: Animal Experiment Verification

[0303] To evaluate the transgene of firefly luciferase in mice, 1 μg of IC50 DNA was injected intravitreally into the vitreous cavity of three approximately 5-week-old Balb / c mice. The expression of luciferase in the mouse eyes was continuously observed for 98 days after injection. Ten minutes after intraperitoneal injection of 100 μl (30 mg / ml) of luciferin substrate, mice were anesthetized for in vivo imaging (IVIS).

[0304] In the in vivo gene expression study, IVIS (In Vivo Imaging System) technology was used to perform continuous imaging analysis on mice treated with ICL DNA at preset time points. Figure 7B The following is an example showing the intravitreal intravitreal imaging results of Balb / c mice on days 15, 20, 30, 44, 82, and 98 after intravitreal injection of ICL DNA. Figure 7C The results provided a line graph of the imaging statistics, showing that the observed fluorescence signals were significantly higher than the background level. This phenomenon indicates that the vector can express genes in the eye and can express them for a long time.

[0305] In another experiment analyzing in vivo gene expression, an intramuscular injection of the C3-ILC DNA vector was used in Balb / c mice. Each mouse received 20 micrograms of the vector. Lipid nanoparticles are an effective gene delivery system that protects the DNA vector from enzymatic degradation in vivo and promotes its intracellular uptake. Balb / c mice were continuously observed after injection using IVIS (In Vivo Imaging System) technology. Significant fluorescent signals were observed using the IVIS imaging system at early post-injection time points, namely days 1 and 2. These fluorescence signals indicate that the luciferase reporter gene was effectively expressed at the injection site. Figure 7D ).

[0306] In another experiment analyzing in vivo gene expression, a tail vein injection method was used. Balb / c mice were injected with the C3-ILC DNA vector at a dose of 40 micrograms per mouse. The Balb / c mice were continuously observed after injection using IVIS (InVivo Imaging System) technology. Significant fluorescent signals were observed using the IVIS imaging system on days 1, 3, 6, 8, and 10 post-injection. These fluorescence signals indicate that the luciferase reporter gene is effectively expressed in the liver and can be expressed for a prolonged period. Figure 7EThe fluorescence signal intensity on the tenth day was higher than that on the third day, indicating that ICL DNA was replicated, thereby enhancing the expression of luciferase protein.

[0307] Example 6: Large-scale construction of ICL vector

[0308] Given the high molar ratio of ITR to expression cassette (96:1), the synthesis of ICL vectors requires a large quantity of ITR. However, traditional chemical synthesis methods face the dual challenges of high cost and low yield in ITR preparation. To overcome these limitations, this study attempts to use single-stranded PCR (Polymerase Chain Reaction) technology for large-scale amplification of ITR sequences. This method utilizes the principle of asymmetric PCR, amplifying with unequal amounts of a single primer pair to efficiently generate a large number of single-stranded ITR sequences. Through single-stranded PCR, we aim to achieve efficient and low-cost large-scale production of ITR sequences, thereby meeting the large demand for ITR sequences in ICL vector synthesis. This strategy not only holds promise for significantly reducing the production cost of ITR sequences but also for increasing their yield, providing an economical and effective solution for the large-scale production of gene therapy vectors. By optimizing the single-stranded PCR conditions, a 50 μL reaction system was prepared by adding 1 μL of 100 μM single primer (1 μL of 10 μM primer was added to the control group), 5 μL of DMSO, 1 U of high-fidelity DNA polymerase (Yisheng, 10148ES76), and 25 μL of reaction buffer (containing dNTPs). Two rounds of amplification were performed according to the enzyme's instructions. In the first round, AAV2-bg-R: AGGAACCCCTAGTGATGGAG (SEQ ID NO:23) and AAV2-SAII-R: CCTGCAGGCAGCTGCTGCGC (SEQ ID NO:24) primers were used to amplify the complementary strands of AAV2-WT ITR and AAV2-mod ITR, respectively. In the second round, the product from the first round was used as a template, and AAV2-LF: GATCAGAGACCTGCAGGCAG (SEQ ID NO:25) and AAV2-RF: TCGACCTGCAGGAACCCCTA (SEQ ID NO:25) primers were used to amplify the complementary strands of AAV2-WT ITR and AAV2-mod ITR, respectively. Using primers NO:26, AAV2-WT ITR and AAV2-mod ITR sequences were amplified, respectively.

[0309] The results are shown in Figure 8. Figure 8AThe results of agarose gel electrophoresis show the amplification of two complementary ITR sequences by single-primer PCR in the first round. The results showed that complementary AAV2-WT ITR sequences were successfully synthesized in wells 1 (with 1 μL, 10 μM primer) and 2 (with 1 μL, 100 μM primer). Similarly, complementary AAV2-mod-ITR sequences (samples 5-8) were successfully synthesized in wells 5 (with 1 μL, 10 μM primer) and 6 (with 1 μL, 100 μM primer). The results from wells 5 (with 1 μL, 100 μM primer) were more specific and yielded higher results. The negative control group (samples 3 and 7 without template and samples 4 and 8 without primer) showed no amplification bands, verifying the specific amplification effectiveness of the primers and template.

[0310] Figure 8B The agarose gel electrophoresis results of the second round of single-stranded PCR (using the first-round product as a template) are presented. The specific setup was as follows: Well 1 was the negative control (no template, only primers); Wells 2 and 3 were used to synthesize AAV2 WT ITR, with primer concentrations of 10 μM and 100 μM, respectively; Wells 4 and 5 were used to synthesize AAV2-mod-ITR, with primer concentrations of 10 μM and 100 μM, respectively. The results showed that Wells 2 and 4 successfully amplified the target bands, and the bands were higher than those in the primer control well 1, proving that we successfully synthesized two ITR sequences.

[0311] All publications and references cited in this specification and the embodiments herein, including but not limited to patents and patent applications, are incorporated herein by reference in their entirety, as if each individual publication or reference were expressly and individually identified as fully elucidated. Any patent application claiming priority to this application is also incorporated herein by reference in the same manner as described above for publications and references.

Claims

1. A linear, nonviral DNA vector closed at its ITR ends, characterized in that, The linear nonviral DNA vector includes the following elements: an asymmetric inverted terminal repeat (ITR) sequence and an expression cassette; the asymmetric inverted terminal repeat (ITR) sequence includes a first ITR sequence and a second ITR sequence, the first ITR sequence and the second ITR sequence being located at opposite ends of the expression cassette sequence, the expression cassette including a cis-regulatory element; the first ITR sequence and the second ITR sequence and / or the structure may be the same or different, preferably different.

2. The linear nonviral DNA vector as described in claim 1, characterized in that, The linear nonviral DNA vector includes one or two of the following: (1) The ITR sequence is derived from the Parvoviridae family, such as canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19, adeno-associated virus, preferably derived from adeno-associated virus, more preferably derived from AAV2 serotype; preferably, the ITR sequence is a wild-type ITR sequence or a mutant ITR sequence derived from AAV serotype; further preferably, the hairpin ends of the ITR sequence oligonucleotides have sticky ends complementary to the sense strand and antisense strand of the double-stranded polynucleotide of the expression cassette, and the ITR sequence preferably includes nucleotide sequences as shown in SEQ ID NO:1, 2, 3 or 4; more preferably, the first ITR sequence is as shown in SEQ ID NO:1, and / or, the second ITR sequence is as shown in SEQ ID NO:2; (2) The cis-regulatory element includes a promoter and a poly(A) tail; preferably, the cis-regulatory element further includes one or more of a riboswitch, an insulator, a miR-regulatory element, a post-transcriptional regulatory element, a Kozak sequence, a tissue and cell type-specific promoter, and an enhancer; more preferably, the cis-regulatory element includes an enhancer, a promoter, a Kozak sequence, a post-transcriptional regulatory element, and a poly(A) tail; more preferably, from the 5' end to the 3' end, the expression cassette includes an enhancer, a promoter, a Kozak sequence, a target gene sequence insertion site, a post-transcriptional regulatory element, and a poly(A) tail connected in sequence.

3. The linear nonviral DNA vector as described in claim 2, characterized in that, The linear nonviral DNA vector includes one or more of the following: (1) The promoter is selected from one or more of constitutive promoters, inducible promoters, and tissue-specific promoters; the constitutive promoter is a CMV promoter, CAG promoter, EF1a promoter, SV40 promoter, CaMV promoter, or UBC promoter; the inducible promoter is a lac promoter, trp promoter, or tac promoter; and the tissue-specific promoter is an hSyn promoter, mecp2 promoter, TUBA1A promoter, c-fos promoter, hVGAT promoter, Slc6a3 promoter, or gfaABC1D promoter. The promoter may be selected from one or more constitutive promoters, such as Iba1 promoter, CNP promoter, cTNT promoter, mNkx2.5 promoter, SM22a promoter, MCK promoter, MYOG promoter, ACTA1 promoter, COL2A1 promoter, mRUNX2 promoter, SP-C promoter, TBG promoter, PDX1 promoter, FABP4 promoter, TIE promoter, K14 promoter, or rpe65; preferably, the promoter is selected from one or more constitutive promoters; more preferably, the promoter is a CMV promoter, and the CMV promoter preferably includes the nucleotide sequence shown in SEQ ID NO:8; (2) The enhancer is selected from one of the CMV enhancer, RSV enhancer and SV40 late poly-A signal upstream enhancer sequence, preferably the CMV enhancer; (3) The Kozak sequence is GCCACC or GCCACCATGGGC; (4) The post-transcriptional regulatory element is derived from marmot hepatitis virus, and the sequence of the post-transcriptional regulatory element preferably includes the nucleotide sequence shown in SEQ ID NO:

6.

4. A method for synthesizing a linear nonviral DNA vector as described in any one of claims 1-3, characterized in that, The expression cassette containing sticky ends and the ITR sequence are ligated to obtain the linear nonviral DNA vector.

5. The synthesis method as described in claim 4, characterized in that, The synthesis method includes the following steps: Step 1: Synthesize the ITR sequence using chemical synthesis or single-stranded PCR technology; Step 2: Amplify the double-stranded polynucleotide containing the expression cassette sequence and digest it with a restriction endonuclease; the amplification uses PCR primers, which contain restriction endonuclease sites and protective bases; Step 3: Connect the ITR sequence to the expression cassette obtained after enzyme digestion in Step 2; The synthesis method may optionally further include: step four, purification to remove ITR sequences not attached to the expression cassette and expression cassettes with unclosed ends.

6. The synthesis method as described in claim 5, characterized in that, The synthesis method includes one or more of the following: (1) The ITR sequence was synthesized using single-stranded PCR technology, preferably using primer sequences including the nucleotide sequences shown in SEQ ID NO:23, 24, 25 and 26; (2) The enzyme digestion conditions are as follows: 10 μL of 10× buffer, 10 U of endonuclease I, 10 U of endonuclease II and 6 μg of expression cassette sequence are added to every 100 μL of the enzyme digestion reaction system; the reaction system is incubated at 37°C for 4 to 16 h; the endonuclease I and the endonuclease II may be the same or different, preferably BglII endonuclease or SalI endonuclease independently; the enzyme digestion reaction system is preferably incubated at 37°C for 16 h; (3) In step three, the molar ratio of the ITR sequence to the expression cassette obtained after enzyme digestion is 3 to 96:1; preferably, the molar ratio is 24 to 96:1; more preferably, the molar ratio is 24:1 or 96:

1. (4) The ligation conditions in step three are as follows: In 200 μL of the ligation reaction system, add 20 μL of 10×T4 DNA ligase reaction buffer, 400 U T4 DNA ligase, 8 μg of the expression cassette and ITR sequence obtained after enzyme digestion, and incubate the ligation reaction system at room temperature for 16 hours. (5) In step four, DNA beads are used to remove the ITR sequence that is not attached to the expression cassette, and / or T7 DNA polymerase is used to remove the expression cassette with unclosed ends; preferably, the ratio of the expression cassette to the T7 DNA polymerase is 1 μg: 0.3-0.6 U, more preferably 1 μg: 0.5 U, and / or, after mixing the expression cassette and the T7 DNA polymerase, the reaction is carried out at 35-40°C for 0.6-1.2 h, more preferably at 37°C for 1.0 h.

7. A transformant, characterized in that, The transformant comprises a linear nonviral DNA vector as described in any one of claims 1-3.

8. A pharmaceutical composition or pharmaceutical preparation, characterized in that, The pharmaceutical composition or pharmaceutical formulation includes the linear nonviral DNA vector and optional delivery vector as described in any one of claims 1-3; Preferably, the delivery carrier is a biocompatible material for encapsulating the linear nonviral DNA carrier into nanocapsules, preferably one of exosomes, lipid nanoparticles, polymers that can be conjugated to the linear nonviral DNA carrier, or folic acid molecules and liposomes. More preferably, the carrier is a lipid nanoparticle, the lipid component of the lipid nanoparticle includes ionizable lipid C3, cholesterol, DSPC and DMG-PEG, and the molar ratio of the ionizable lipid C3, cholesterol, DSPC and DMG-PEG is preferably 50:19.25:5:0.75 or 30:54.5:0:

2.

9. The pharmaceutical composition or pharmaceutical preparation according to claim 8, characterized in that, The pharmaceutical formulation is a DNA-LNP complex encapsulating the linear nonviral DNA vector, and the DNA-LNP complex is prepared by the following steps: (1) The lipid components of lipid nanoparticles are mixed in anhydrous ethanol to form an organic phase; (2) The linear nonviral DNA vector is dissolved in sodium acetate solution to form an aqueous phase; (3) The organic phase and the aqueous phase are mixed and purified to remove unreacted lipids and organic solvents; Preferably, the mass ratio of the ionizable lipid C3 to the linear nonviral DNA vector is 5 to 30:1, more preferably 10:1 or 30:1; And / or, the concentration of the sodium acetate solution is 20-30 mM and the pH is 5.0-5.5; preferably, the concentration of the sodium acetate solution is 25 mM and the pH is 5.2; And / or, the volume ratio of the organic phase to the aqueous phase is 1:1 to 5, preferably 1:3; And / or, the purification is performed by desalting and buffer replacement via a dialysis bag, with a replacement time of 4–6 h. The dialysis buffer is PBS buffer, DPBS buffer, HEPES buffer, or Tris buffer, preferably DPBS buffer.

10. A diagnostic kit, characterized in that, The diagnostic kit includes a linear nonviral DNA vector as described in any one of claims 1-3, a transformant as described in claim 7, or a pharmaceutical composition or pharmaceutical formulation as described in claim 8 or 9.

11. The use of the linear nonviral DNA vector as described in any one of claims 1-3, the transformant as described in claim 7, or the pharmaceutical composition or pharmaceutical formulation as described in claim 8 or 9 in expressing the target gene, characterized in that, The application is for non-diagnostic or non-therapeutic purposes.

12. The use of the linear nonviral DNA vector as described in any one of claims 1-3, the transformant as described in claim 7, or the pharmaceutical composition or pharmaceutical formulation as described in claim 8 or 9 in the preparation of therapeutic agents or diagnostic kits; Preferably, the therapeutic agent is used to treat eye diseases and liver diseases.

Images