Plasma miRNA biomarker of tumor lactic acid microenvironment and application of plasma miRNA biomarker

Abstract

The invention discloses a plasma miRNA (micro Ribonucleic Acid) biomarker of a tumor lactic acid microenvironment and application of the plasma miRNA biomarker, and relates to the field of biochemistry, and a miRNA combination comprises hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521 and hsa-miR-7974; the amplification method comprises the following steps: extracting total RNA (Ribonucleic Acid), carrying out reverse transcription, and carrying out qPCR (Quantitative Polymerase Chain Reaction) reaction on each reverse transcription product under the action of the fluorescent quantitative PCR primer to obtain a target gene. The invention discloses that hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521 and hsa-miR-7974 present a stable and dose-dependent expression change trend under the stimulation of lactic acid, and the hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521 and hsa-miR-7974 The miRNA composition can be used as a novel functional marker for reflecting the tumor acidic microenvironment state, and the recognition capability on EBV related tumor biological behaviors is remarkably improved.

Description

Technical Field

[0001] This invention relates to the field of biochemistry, and more particularly to a plasma miRNA biomarker of the tumor lactate microenvironment and its application. Background Technology

[0002] The tumor microenvironment (TME) refers to the complex biological environment surrounding tumor cells. It includes not only the malignant tumor cells themselves but also various non-tumor cell types, such as adipocytes, fibroblasts, lymphocytes, dendritic cells, and cancer-associated fibroblasts (CAFs). These cells interact through complex signaling networks, jointly constructing and regulating the occurrence, development, invasion, and metastasis of tumors. The tumor microenvironment exhibits significant physiological characteristics, primarily including hypoxia, low pH, and high osmotic pressure—microecological abnormalities. Low pH is a typical manifestation of tumor metabolic disorder. Even under oxygen-sufficient conditions, tumor cells still primarily rely on glycolysis for energy, a phenomenon known as the "Warburg effect." This metabolic reprogramming leads to the production and secretion of large amounts of lactic acid extracellularly, forming an acidic microenvironment. This acidic environment not only promotes the proliferation and invasion of tumor cells but also inhibits the host immune response, thus facilitating tumor escape. During glycolysis, glucose is rapidly broken down into pyruvate, which is further converted into lactate. Several key glycolytic enzymes (such as HK2, PKM2, and LDHA) are upregulated or have enhanced activity under the regulation of oncogenic signaling pathways, thereby accelerating the entire metabolic process. Furthermore, the proton gradient formed in the acidic microenvironment can activate proton-coupled transport proteins on cancer cell membranes, such as monocarboxylic acid transporters (MCTs), providing tumor cells with the ability to selectively take up nutrients, further supporting their rapid proliferation and survival needs. Lactic acid, as an important product of tumor metabolism, exists mainly as L-lactate in healthy individuals and is a byproduct of normal tissue metabolism. However, in the tumor state, lactate concentration is significantly elevated, reflecting not only the metabolic activity of tumor cells but also being considered an important biological marker of tumor burden and disease progression. Studies have shown that lactate can inhibit anti-tumor immune responses through multiple mechanisms, including suppressing the function of T cells and NK cells, inducing regulatory T cell differentiation, and interfering with macrophage polarization, thus becoming a negative regulator of innate and adaptive immune responses. Therefore, dynamic changes in plasma lactate levels may serve as a potential biomarker for assessing tumor development and treatment response, aiding in clinical efficacy monitoring and prognosis. Meanwhile, targeting molecules related to lactate production, transport, and metabolism has emerged as a novel cancer treatment strategy, showing promising application prospects. Thus, in-depth research into the key molecular mechanisms regulating lactate metabolism in the tumor microenvironment is of great significance for developing novel non-invasive diagnostic methods and personalized treatment strategies.

[0003] MicroRNAs (miRNAs) are a class of evolutionarily conserved, tissue-specific non-coding small RNA molecules that play a crucial role in maintaining cellular homeostasis by negatively regulating gene expression. In mammalian cells, miRNAs can guide the miRNA-induced silencing complex (miRISC) to bind to the 3′ untranslated region (3′-UTR) of target mRNAs. Through partial base complementarity, miRNAs mediate translational repression of target genes, which may be accompanied by varying degrees of mRNA degradation. Studies have shown that miRNAs are widely involved in regulating important biological processes such as cell proliferation, differentiation, apoptosis, angiogenesis, and cell metabolism. They have been proven to be closely related to the pathogenesis of various diseases, especially playing an important regulatory role in the occurrence and development of tumors. Therefore, they are considered potential diagnostic biomarkers, prognostic indicators, and therapeutic targets. In recent years, studies have identified some miRNAs (such as miR-124, miR-342-3p, and miR-210-3p) as being associated with lactate metabolism in lung and breast cancer, suggesting their potential role in glycolysis regulation. However, current research on the expression profiles of miRNAs induced by lactate (LA) stress and their target gene regulatory networks remains insufficient, particularly regarding the specific functions of miRNAs in the tumor microenvironment under the influence of the lactate microenvironment. Existing technologies lack a systematic analysis of the metabolic reprogramming and intercellular communication regulatory mechanisms of lactate-related miRNAs between tumor cells and microenvironmental components. Therefore, a systematic study of lactate stress-related miRNAs is urgently needed to elucidate their regulatory networks in the tumor microenvironment, providing theoretical basis and technical support for developing novel miRNA-based tumor diagnostic methods or targeted intervention strategies.

[0004] Epidemiological studies have shown that approximately 20% of human malignant tumors are closely related to viral infection. Several viruses have been identified as being closely associated with human tumorigenesis, including Kaposi's sarcoma-associated herpesvirus (KSHV), Epstein-Barr virus (EBV), human papillomavirus (HPV), and hepatitis B / C virus (HBV / HCV). Among these, EBV (Epstein-Barr virus) belongs to the human gamma-herpesvirus family and is also known as human herpesvirus type 4 (HHV-4). As a herpesvirus widely present in the population, EBV has infected over 95% of the adult population worldwide, usually in an asymptomatic latent infection state, but can be activated and participate in the tumorigenesis process under certain conditions.17 EBV is mainly transmitted through saliva, but can also be transmitted through blood or organ transplantation. Its life cycle consists of two phases: the latency period and the lysis and replication period. In its latent infection state, the virus expresses only a small number of latent genes, such as the Epstein-Barr virus nuclear antigen (EBNA) family and latent membrane protein 1 (LMP1). These proteins have strong cell transformation capabilities, promoting host cell proliferation and immortalization. During the lysis cycle, the virus expresses a large number of structural and functional proteins, such as the viral DNA polymerase BALF5, glycoprotein GP350, and capsid proteins, which participate in the assembly and release of viral particles. EBV has been proven to be closely associated with various malignant tumors, including Burkitt lymphoma, diffuse large B-cell lymphoma (DLBCL), nasopharyngeal carcinoma (NPC), and Hodgkin's lymphoma. Among them, DLBCL is currently the most common subtype of non-Hodgkin's lymphoma (NHL), and its pathogenesis pattern is basically consistent with the overall trend of NHL; while nasopharyngeal carcinoma is a head and neck tumor that is prevalent in East Asia and Southeast Asia, with significant regional and racial differences.

[0005] Currently, the clinical diagnosis of EBV-related tumors (such as DLBCL and NPC) still mainly relies on traditional invasive biopsy combined with immunohistochemical staining. However, because lymphoma lesions are widely distributed throughout the body, both inside and outside lymph nodes, obtaining pathological tissue samples is challenging. Furthermore, the lesion areas are often accompanied by infection, necrosis, and other complex conditions, further increasing the uncertainty of pathological diagnosis and often requiring repeated punctures. As an invasive procedure, tissue biopsy itself is traumatic and may lead to risks such as bleeding, infection, or damage to adjacent tissues, especially for tumors in deep areas (such as the nasopharynx) or important functional areas. On the other hand, obtaining sufficient and representative pathological tissue samples is difficult; for example, lymphoma lesions are widespread and prone to infection and necrosis, small or flat lesions in colorectal cancer are easily missed, and cervical cancer biopsies may be affected by inflammation and bleeding. In addition, a single biopsy result may not fully reflect the condition due to tumor heterogeneity or sampling errors, leading to false negatives or unclear diagnoses, often requiring repeated biopsies, increasing patient suffering and medical burden, resulting in poor patient compliance and increased treatment costs. Furthermore, recent studies have shown that EBV not only regulates host cell signaling pathways through its encoded viral proteins but also influences the metabolic state of the tumor microenvironment. Particularly in hypoxic, acidic microenvironments, EBV infection may exacerbate metabolic reprogramming in tumor cells, promoting lactate accumulation and thus creating a microecology conducive to tumor immune escape and metastasis. Therefore, developing a non-invasive, sensitive, and highly specific detection method is of great significance for the early diagnosis, efficacy evaluation, and prognosis of EBV-related tumors. In recent years, increasing research has demonstrated that the tumor microenvironment plays a crucial role in the occurrence, development, and treatment response of cancer, with an acidic microenvironment being one of the important characteristics of abnormal tumor metabolism. Therefore, detection technologies targeting molecular markers (such as miRNAs) reflecting the characteristics of an acidic tumor microenvironment not only provide new ideas and tools for precision diagnosis and treatment of tumors but also have significant scientific research value and broad application prospects.

[0006] Therefore, those skilled in the art are dedicated to developing a lactate-responsive miRNA combinatorial model and its applications, providing a novel molecular marker for EBV-related tumors and other malignant tumors with pronounced acidic microenvironment characteristics. Summary of the Invention

[0007] In view of the above-mentioned deficiencies of the prior art, the technical problem to be solved by the present invention is to develop a lactate-responsive miRNA combinatorial system and its application.

[0008] To achieve the above objectives, the present invention provides a lactate microenvironment responsive miRNA combination, the miRNA combination being hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974; the nucleotide sequence of hsa-miR-7-5p is shown in SEQ ID No. 1, the nucleotide sequence of hsa-miR-210-3p is shown in SEQ ID No. 2, the nucleotide sequence of hsa-miR-4521 is shown in SEQ ID No. 3, and the nucleotide sequence of hsa-miR-7974 is shown in SEQ ID No. 4.

[0009] This invention provides a method for amplifying miRNA combinations in response to the lactate microenvironment, comprising the following steps: Step 1: Extract total RNA from cells; Step 2: The total RNA obtained in Step 1 is reverse transcribed by reverse transcriptase to obtain the reverse transcription product, which is an elongated miRNA first-strand cDNA. A stem-loop reverse transcription primer is designed separately according to the stem-loop structure of each miRNA in the combination. The 5' end of the stem-loop reverse transcription primer specifically binds to the 3' end of the miRNA molecule. Step 3: Perform qPCR on each reverse transcription product obtained in Step 2 using real-time PCR primers to obtain the target gene.

[0010] Furthermore, the steps for extracting total RNA in step 1 are as follows: 1) Remove the cells and transfer them to an EP tube. Centrifuge for the first time, discard the supernatant, and obtain the cell pellet. 2) Add lysis buffer to the cell pellet obtained in step 1), and pipette to fully lyse the cells and obtain cell lysis products; 3) Add an equal volume of anhydrous ethanol to the cell lysis product obtained in step 2), mix thoroughly by pipetting; then add to a centrifuge column, centrifuge a second time, and discard the first liquid; 4) Add washing solution to the centrifuge column described in step 3), and centrifuge for the third time; remove the centrifuge column from the collection tube and pour out the second liquid, place the collection tube on absorbent paper and tap it gently twice, then put the centrifuge column back into the collection tube and centrifuge for the fourth time; 5) Without discarding the waste liquid, directly transfer the centrifuge column to an RNase-free EP tube, open the cap and let it air dry to obtain a dried offline column; 6) Add RNase-free ddH2O to the membrane in the center of the dried centrifuge column obtained in step 5) and place at room temperature; 7) Centrifuge the centrifuge column obtained in step 6) for the fifth time, discard the centrifuge column, quickly transfer the obtained RNA to ice and place it for concentration determination, and then carry out subsequent experiments, or store it at -80°C for later use.

[0011] Further, step 2 also includes: the stem-loop nucleotide sequence of hsa-miR-7-5p as shown in SEQ ID No. 5, the stem-loop nucleotide sequence of hsa-miR-210-3p as shown in SEQ ID No. 6, the stem-loop nucleotide sequence of hsa-miR-4521 as shown in SEQ ID No. 7, and the stem-loop nucleotide sequence of hsa-miR-7974 as shown in SEQ ID No. 8.

[0012] Further, step 2 also includes: the stem-loop reverse transcription primer nucleotide sequence of hsa-miR-7-5p as shown in SEQ ID No. 9, the stem-loop reverse transcription primer nucleotide sequence of hsa-miR-210-3p as shown in SEQ ID No. 10, the stem-loop reverse transcription primer nucleotide sequence of hsa-miR-4521 as shown in SEQ ID No. 11, and the stem-loop reverse transcription primer nucleotide sequence of hsa-miR-7974 as shown in SEQ ID No. 12.

[0013] Furthermore, step 2 also includes using a stem-loop reverse transcription kit.

[0014] Furthermore, step 2 also includes: Step 2.1: Remove genomic DNA at 42°C for 2 minutes to obtain the reaction solution; Step 2.2: Perform the first-strand cDNA synthesis reaction on the reaction solution obtained in step 2.1.

[0015] Furthermore, the reaction conditions for the first-strand cDNA synthesis in step 2.2 are: 25℃ for 5 min; 50℃ for 15 min; 85℃ for 5 min.

[0016] Further, step 3 also includes: the nucleotide sequences of the real-time PCR primers for hsa-miR-7-5p are shown in SEQ ID No. 13 and SEQ ID No. 14, the nucleotide sequences of the real-time PCR primers for hsa-miR-210-3p are shown in SEQ ID No. 15 and SEQ ID No. 16, the nucleotide sequences of the real-time PCR primers for hsa-miR-4521 are shown in SEQ ID No. 17 and SEQ ID No. 18, and the nucleotide sequences of the real-time PCR primers for hsa-miR-7974 are shown in SEQ ID No. 19 and SEQ ID No. 20.

[0017] Furthermore, step 3 also includes preparing an internal reference PCR system and performing a PCR reaction to obtain the internal reference gene; the internal reference is U6; the relative amount of the target gene is the difference between the target gene and the internal reference gene.

[0018] Furthermore, by simulating the acidic tumor microenvironment and treating EBV-positive / negative B-lymphoma cell lines with exogenous lactate, combined with deep sequencing and qPCR screening, we discovered and verified that hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 exhibited stable and dose-dependent expression trends under lactate stimulation.

[0019] Furthermore, due to the short length of mature miRNA sequences (approximately 22 nt), traditional primer designs are prone to non-specific amplification or low efficiency. This invention employs stem-loop reverse transcription primers, which can specifically recognize the 3' end sequence of miRNAs, significantly improving reverse transcription efficiency and specificity, ensuring high-fidelity amplification even against a complex plasma RNA background, and reducing background noise.

[0020] Furthermore, tumor cells actively release miRNAs into the bloodstream from the lactate microenvironment, and these miRNAs are highly stable. Lactate accumulation then induces synergistic expression changes in these miRNAs, resulting in a consistent expression pattern across different tumor types, thus making them common metabolic markers.

[0021] Furthermore, hsa-miR-7-5p guides the miRISC complex to mediate mRNA degradation or translational repression by complementary pairing with a highly conserved binding site in the 3′-UTR of TRIM33 mRNA. Low miR-7-5p expression → high TRIM33 expression → tumor progression constitutes a clear regulatory axis.

[0022] Furthermore, by combining lactate stress with miRNA expression regulation, a regulatory pathway of "lactic acid → miRNA → target gene → tumor progression" was constructed, and a tumor microenvironment regulation model with lactate-responsive miRNA as the core was proposed.

[0023] Furthermore, lactate is not only a metabolic waste product but also an important signaling molecule. These lactate-responsive miRNAs further influence the metabolic reprogramming, immune escape, and matrix remodeling of tumor cells by targeting genes in key signaling pathways, mediating bidirectional communication between tumor cells and immune cells and fibroblasts in the tumor microenvironment (TME).

[0024] In a preferred embodiment 1 of the present invention, the screening and identification process of lactic acid microenvironment-responsive miRNA molecules is described in detail. In another preferred embodiment 2 of the present invention, the process of detecting the expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 in the plasma of tumor patients is described in detail. In another preferred embodiment 3 of the present invention, the process of measuring plasma lactate concentration in tumor patients is described in detail; In another preferred embodiment 4 of the present invention, the process of detecting the expression level of hsa-miR-7-5p in tumor tissues from patients with nasopharyngeal carcinoma and cervical cancer is described in detail. In another preferred embodiment 5 of the present invention, the process of immunohistochemical detection of TRIM33 expression level in tumor tissues of patients with nasopharyngeal carcinoma and cervical cancer is described in detail.

[0025] The beneficial technical effects of this invention are as follows: To simulate the acidic tumor microenvironment in vivo, this invention treated various EBV-positive and negative B-cell lymphoma cell lines with different concentrations of exogenous lactate. Using deep sequencing and quantitative PCR, a group of miRNA molecules exhibiting stable expression trends under lactate stimulation were screened. The study found that the expression levels of these four miRNAs showed a consistent trend with increasing lactate concentration, and exhibited significant expression differences in various EBV-related tumors (such as lymphoma, nasopharyngeal carcinoma, colorectal cancer, and cervical cancer). These miRNAs not only serve as potential biomarkers reflecting changes in the tumor's acidic microenvironment but can also be used to assess disease malignancy and treatment response, demonstrating promising clinical application prospects.

[0026] The lactate-responsive miRNA combination disclosed in this invention provides a novel molecular marker for EBV-related tumors and other malignant tumors with pronounced acidic microenvironment characteristics. This lays the theoretical foundation for the subsequent development of non-invasive miRNA-based detection technologies and offers new directions for the early diagnosis and precision treatment of related diseases. This miRNA combination and its detection method have broad application potential in clinical diagnosis, prognostic assessment, and personalized treatment.

[0027] miRNA ensembles can serve as novel functional biomarkers reflecting the acidic microenvironment of tumors, significantly enhancing the ability to identify EBV-related tumor biological behaviors and providing new tools for non-invasive diagnosis and dynamic monitoring.

[0028] This invention verifies that these four miRNAs in plasma show significant differential expression in patients with lymphoma, nasopharyngeal carcinoma, colorectal cancer, and cervical cancer, and are closely related to their clinical stage, demonstrating their potential for cross-tumor application.

[0029] This invention provides a non-invasive, convenient, and repeatable method for auxiliary diagnosis and staging of multiple cancers based on blood samples, which helps to achieve integrated management of early detection, efficacy monitoring, and prognosis.

[0030] This invention is the first to clearly identify TRIM33 as a direct target gene of hsa-miR-7-5p, and functional experiments verified its downregulation in diffuse large B-cell lymphoma, nasopharyngeal carcinoma, and cervical cancer, which is significantly associated with malignant phenotypes such as tumor invasion and metastasis. This reveals the mechanism of action of the hsa-miR-7-5p-TRIM33 regulatory axis in tumor progression, enhancing the biological validity of this miRNA as a biomarker and providing a potential target for subsequent targeted intervention strategies.

[0031] This invention not only expands our understanding of the coupling mechanism of tumor metabolism and epigenetic regulation, but also provides a theoretical basis for developing microenvironment regulation therapies based on miRNA intervention, and has good translational medicine value.

[0032] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description

[0033] Figure 1 This is a flowchart of miRNA-seq of EBV-positive (LCL) and Ramos-negative (Ramos) B lymphoma cells before and after lactate treatment, which is a preferred embodiment of the present invention. Figure 2 This is a heatmap of differential miRNAs in EBV-positive (LCL) and Ramos-negative (Ramos) B lymphoma cells before and after lactate treatment, representing a preferred embodiment of the present invention. Figure 3 This is a quantitative PCR expression profile of four miRNAs in EBV-positive B-lymphoma cells (LCL) before and after treatment with hydrochloric acid, lactic acid, and sodium lactate, according to a preferred embodiment of the present invention. Figure 4 This is a preferred embodiment of the present invention, 1, of a database combined with RNA-seq screening of hsa-miR-7-5p target genes; Figure 5 This is a diagram illustrating the inhibition of EBV-positive B lymphoma cell (LCL) proliferation and in vitro clonogenesis by hsa-miR-7-5p targeting TRIM33, a preferred embodiment of the present invention. Figure 6This is a preferred embodiment 2 of the present invention, showing the correlation between the transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521 and hsa-miR-7974 in the plasma of 60 patients with diffuse large B-cell lymphoma and lactate levels and IPI scores. Figure 7 This is a graph showing the correlation between the transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521 and hsa-miR-7974 and lactate LDH levels in the plasma of 18 EBV-positive or negative B-lymphoma patients in a preferred embodiment of the present invention (1). Figure 8 This is a graph showing the correlation between the transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521 and hsa-miR-7974 in the plasma of 233 nasopharyngeal carcinoma patients in a preferred embodiment 2 of the present invention and lactate levels and EBV load. Figure 9 This is a correlation analysis diagram of plasma lactate concentration and transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521 and hsa-miR-7974 in 18 patients (1 with polyps, 11 with colorectal cancer, and 5 with metastatic colorectal cancer) in a preferred embodiment 2 of the present invention. Figure 10 This is a graph illustrating the correlation between TRIM33 expression level and nasopharyngeal carcinoma stage in tumor tissue of a nasopharyngeal carcinoma patient, as verified by immunohistochemistry in a preferred embodiment 5 of the present invention. Figure 11 This is a preferred embodiment 5 of the present invention, showing the correlation between the expression level of hsa-miR-7-5p / TRIM33 and the occurrence and development of cervical cancer, verified by in situ hybridization / immunohistochemistry of tumor tissue from cervical cancer patients. Figure 12 This is a graph showing the correlation between the transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 in the plasma of 233 nasopharyngeal carcinoma patients and the stage of nasopharyngeal carcinoma, which is a preferred embodiment 2 of the present invention. Detailed Implementation

[0034] The following description, with reference to the accompanying drawings, illustrates several preferred embodiments of the present invention to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0035] Example 1: Screening and identification of miRNA molecules responding to lactate microenvironment

[0036] Based on miRNA-seq results, stem-loop qRT-PCR was used to detect the expression levels of miRNAs in EBV-positive B-cell lymphoma (LCL) cells before and after lactate treatment, and a set of lactate-responsive miRNA expression profiles was screened. This set of miRNAs included hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974.

[0037] miRNA Detection - Stem-Loop Real-Time Quantitative PCR: A separate stem-loop reverse transcription primer is designed for each miRNA. The 5' end of the stem-loop RT primer specifically binds to the 3' end of the miRNA molecule. Under the action of reverse transcriptase, an elongated first-strand cDNA of the miRNA is obtained. The obtained reverse transcription product is then subjected to qPCR reaction using specific upstream and downstream primers.

[0038] The specific steps are as follows: 1. Total RNA extraction (EZ-press RNA Purification Kit (B0004D), EZBioscience) 1) Take out approximately 1×10 6 ~3×10 6 Transfer cells to 1.5 ml EP tubes, centrifuge at 500 g for 3-5 min, and discard the supernatant with a pipette.

[0039] 2) Add 450µI of lysis buffer and pipette 10-15 times to ensure complete cell lysis.

[0040] 3) Add an equal volume of anhydrous ethanol to the cell lysis products and mix thoroughly by pipetting. Then add to a centrifuge column and centrifuge at 4000 g for 1 minute (if there is liquid residue in the column after centrifugation, centrifuge again at 12000 g for 1 minute), and discard the liquid.

[0041] 4) Add 500 μl of washing buffer to the centrifuge column and centrifuge at 12000 g for 1 min. Remove the centrifuge column from the collection tube and discard the liquid. Place the collection tube on absorbent paper and tap it gently twice. Then put the centrifuge column back into the collection tube and centrifuge the empty column at 12000 g for 1 min.

[0042] 5) No need to discard the waste liquid. Directly transfer the centrifuge column to an RNase-free 1.5 ml EP tube, open the cap and let it air dry for 2 min.

[0043] 6) Add 30-50 μl of RNase-free ddH2O to the membrane in the center of the centrifuge column and let it stand at room temperature for 2 min.

[0044] 7) Centrifuge at 12000 g for 1 min. Discard the centrifuge column. The resulting RNA should be quickly transferred to ice and placed for concentration determination before proceeding with subsequent experiments, or stored at -80°C for later use.

[0045] 2. miRNA reverse transcription

[0046] Take out an appropriate amount of RNA sample at -80℃ and use the stem-loop reverse transcription kit (miRNA 1st Strand cDNASynthesis Kit, Vazyme) to reverse transcribe and synthesize the first-strand cDNA.

[0047] 1) Genomic DNA removal

[0048] Prepare the following mixture in RNase-free centrifuge tubes:

[0049] Reaction conditions: 42℃ for 2 min

[0050] 2) First-strand cDNA synthesis

[0051] Prepare the following mixture in RNase-free centrifuge tubes:

[0052] The first-strand cDNA synthesis reaction was carried out under the following conditions: 25℃ for 5 min; 50℃ for 15 min; 85℃ for 5 min.

[0053] The product can be used immediately for quantitative PCR reactions or stored at -20°C. cDNA should be protected from repeated freeze-thaw cycles.

[0054] 3. Quantitative PCR detection of miRNA expression levels

[0055] 1) Prepare the following mixture in a PCR tube:

[0056] Use U6 as an internal control. The system is the same as above, but the primers are changed to U6-F and U6-R. The rest is the same. Mix well, avoiding air bubbles.

[0057] 2) The PCR reaction conditions are as follows:

[0058] Calculation of experimental results: Relative amount of target gene = 2 - ΔCT (target gene - internal reference gene).

[0059] The miRNA-seq process for EBV-positive (LCL) and EBV-negative (Ramos) B lymphoma cells before and after lactate treatment is as follows: Figure 1 As shown, the differential miRNA heatmap is as follows: Figure 2 As shown; the quantitative PCR expression profiles of four miRNAs in EBV-positive B-lymphoma cells (LCL) before and after treatment with hydrochloric acid, lactate, and sodium lactate are shown below. Figure 3 As shown; the process of screening hsa-miR-7-5p target genes using miRNA database combined with RNA-seq, and identifying TRIM33 as a target gene of hsa-miR-7-5p, is as follows. Figure 4 As shown, Part A represents the screening of hsa-miR-7-5p target genes using a miRNA database combined with RNA-seq; Part B shows the transcriptional level test results; Part C shows the protein level test results; Part D shows the dual-luciferase reporter gene; and Part E shows the tissue level test results from clinical samples. hsa-miR-7-5p targets TRIM33 to inhibit the proliferation and in vitro colony formation of EBV-positive B-cell lymphoma (LCL) cells, as shown below. Figure 5 As shown, Part A represents the detection results of hsa-miR-7-5p targeting TRIM33 to inhibit the proliferation of EBV-positive B lymphoma cells (LCL), and Part B represents the detection results of the in vitro clonogenic process.

[0060] Example 2: Detection of expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 in plasma of tumor patients

[0061] Total RNA was extracted using the Trizol method, and the quality (OD260 / OD280) and concentration of the extracted RNA were initially determined. The expression of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 in clinical samples was detected using stem-loop real-time quantitative PCR. The study found that the lactate response trend of miRNAs in the plasma of lymphoma, nasopharyngeal carcinoma, and colon cancer patients was consistent with the cellular level and significantly correlated with tumor malignancy. Correlation analysis of the transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 in the plasma of 60 patients with diffuse large B-cell lymphoma with lactate levels and IPI scores is as follows: Figure 6As shown, Part A presents the correlation analysis between the transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 in the plasma of 60 patients with diffuse large B-cell lymphoma and lactate levels; Part B presents the correlation analysis with IPI scores; and the correlation analysis between the transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 in the plasma of 18 patients with EBV-positive or negative B-cell lymphoma and LDH levels is shown below. Figure 7 As shown; the correlation analysis of the transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 in the plasma of 233 nasopharyngeal carcinoma patients with lactate levels and EBV load is as follows. Figure 8 As shown; the correlation analysis between plasma lactate concentration and the transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 in 18 patients (1 with polyps, 11 with colorectal cancer, and 5 with metastatic colorectal cancer) is as follows. Figure 9 As shown, Part A represents the correlation with plasma lactate concentration, and Part B represents the correlation analysis of the transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974. This indicates that hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 have potential application value in the diagnosis and staging of lymphoma, nasopharyngeal carcinoma, and colon cancer.

[0062] Table 1 shows the correlation analysis between miRNA profiles and clinicopathological features in 60 patients with diffuse large B-cell lymphoma.

[0063] Table 1. Correlation analysis between miRNA profiles and clinicopathological features in 60 patients with diffuse large B-cell lymphoma.

[0064] Where DLBCL represents diffuse large B-cell lymphoma; PS represents performance status; IPI represents the International Prognostic Index; LDH represents lactate dehydrogenase; and LA represents lactate. a) is a one-way ANOVA test; b) is a chi-square test; and c) is a one-way ANOVA test for miRNA profiling based on IPI scores.

[0065] Information on 18 EBV-positive or negative B-lymphoma samples is shown in Table 2.

[0066] Table 2 Information on 18 EBV-positive or negative B-lymphoma samples

[0067]

[0068] Correlation analysis of the transcriptional expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 in the plasma of 233 nasopharyngeal carcinoma patients with nasopharyngeal carcinoma stage is as follows: Figure 12 As shown in Table 3, the correlation analysis between the expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 and clinicopathological features in 233 nasopharyngeal carcinoma patients was performed.

[0069] Table 3. Correlation analysis between the expression levels of hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974 and clinicopathological features in 233 nasopharyngeal carcinoma patients.

[0070] NPC represents nasopharyngeal carcinoma; T represents the primary tumor; N represents lymph node metastasis; M represents distant metastasis; EBV+ represents EBV positive; EBV- represents EBV negative; LA represents lactate; a: one-way ANOVA test; b: chi-square test.

[0071] Table 4 shows the tissue sample information of 20 patients with nasopharyngeal carcinoma.

[0072] Table 4. Information on tissue samples from 20 nasopharyngeal carcinoma patients

[0073] NPC stands for nasopharyngeal carcinoma; T for primary tumor; N for lymph node metastasis; M for distant metastasis; TTMT for targeted therapy of malignant tumors; RT for radiotherapy of malignant tumors; MCT for maintenance chemotherapy of malignant tumors; and I / O for immunotherapy / oncology. The "-" symbol indicates that the monocyte EBV-DNA detection value is below the minimum detection range.

[0074] The specific steps for extracting Total RNA using the Trizol method are as follows, and the stem-loop method for real-time quantitative PCR detection is the same: 1) Add 1 ml of Trizol to a RNase-free EP tube containing the blood sample, lyse on ice for 3-5 min, and proceed to the next experiment, or store at -80℃.

[0075] 2) Add 200 μl of chloroform and quickly invert to mix about 15 times. Let stand for 3-5 minutes.

[0076] 3) Centrifuge at 13000 rpm for 4℃ for 10 min. The RNA will dissolve in the aqueous phase and remain at the bottom. DNA will be in the middle.

[0077] 4) Transfer the supernatant to a new EP tube, being careful not to absorb the white DNA layer.

[0078] 5) Add 500 μl of isopropanol, immediately invert and mix about 15 times, and let stand for 3-5 minutes.

[0079] 6) Centrifuge at 13000 rpm and 4 degrees for 10 min.

[0080] 7) Discard the supernatant and add 1 ml of 75% ethanol (vortex 3s).

[0081] 8) Centrifuge at 13000 rpm for 5-10 minutes at 4 degrees Celsius, then discard the supernatant. Invert the container onto filter paper for 10 minutes.

[0082] 9) Add 20-50 μl of RNase-free ddH2O to dissolve, mix well by pipetting, and obtain the RNA sample.

[0083] 10) Measure RNA quality and concentration using Nandrop2000 and store at -80℃.

[0084] Example 3: Determination of plasma lactate concentration in cancer patients

[0085] Plasma lactate concentration was measured using a lactate assay kit (L-Lactate Assay Kit I, etonbioscience).

[0086] Lactate dehydrogenase converts lactate and NAD+ into pyruvate and NADH. This kit is based on an NADH-coupled enzyme reaction system, detecting lactate by the reduction of tetrazolium salt (INT) to formazan (which has a maximum absorption peak at 490 nm). Absorbance intensity is positively correlated with lactate concentration. A series of lactate standards can be used to quantitatively determine the lactate concentration in samples (plasma, culture medium, and other samples).

[0087] The specific steps are as follows: 1. Preparation of Standard Curve 1) Add 50 μl, 40 μl, 30 μl, 20 μl, 10 μl, 5 μl, 1 μl, and 0 μl of L-lactic acid standard reagent to each well. Then adjust to 50 μl / well with ddH2O.

[0088] 2) Add 50 μL of L-lactic acid assay solution to each well containing L-lactic acid standard and test sample.

[0089] 3) Incubate at 37 ℃ for 30 min.

[0090] 4) Add 50 μl of 0.5 M acetic acid to each well and stop the reaction.

[0091] 5) Measure the absorbance at 490 nm using a microplate reader.

[0092] 6) Construct a standard curve: Average the OD490 nm values ​​of each lactate standard, test sample, and blank in duplicate wells. To obtain the corrected absorbance, subtract the average OD490 nm value of the blank from the average OD490 nm value of all standards and samples. 1-Lactate (μM) = [(corrected absorbance) - (y-intercept)] / slope.

[0093] 2. Determination of lactate concentration in plasma samples: Add 10 μL of plasma sample and 40 μL of ddH2O to each well, and follow the same steps as above.

[0094] Example 4: In situ hybridization detection of hsa-miR-7-5p expression level in tumor tissues from nasopharyngeal carcinoma and cervical cancer patients

[0095] Tissues were immediately fixed after washing with PBS and stored at 4°C. Using the SweAMI technique, the hsa-miR-7-5p sequence was tailed to form a probe (hsa-miR-7-5p probe sequence: ACAACAAAATCACTAGTCTTCCA, as shown in SEQ ID No. 21). This probe was used as an intermediate hybridization medium to bind with a fluorescent signal probe to form a fluorescent tag, enabling the localization and quantification of the target gene-probe hybrid. The results were consistent with plasma detection results, validating the feasibility of hsa-miR-7-5p as a diagnostic and staging biomarker for malignant tumors such as lymphoma, nasopharyngeal carcinoma, and colorectal cancer.

[0096] The specific steps are as follows: 1) Dehydration and paraffin embedding: After tissue fixation, a tissue block of about 3 mm thickness is cut from the target area in a fume hood, dehydrated by a low to high gradient of alcohol, cleared with xylene, and embedded in paraffin.

[0097] 2) Paraffin sections: The tissue paraffin blocks were sliced ​​to a thickness of 4μm using a tissue slicer, spread and retrieved using a slide spreader, and baked in a 62℃ oven for 2 hours.

[0098] 3) Dewaxing paraffin sections to water: The sections are placed in environmentally friendly dewaxing and clearing solution I for 15 min, environmentally friendly dewaxing and clearing solution II for 15 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 85% ethanol for 5 min, 75% ethanol for 5 min, and then soaked in DEPC water.

[0099] 4) Repair and digestion: Repair the tissue according to the antigen type. After natural cooling, draw circles with a histochemical pen, and digest with proteinase K at 40 degrees Celsius for 15 minutes. Rinse with pure water and wash three times with PBS, 5 minutes each time.

[0100] 5) Prehybridization: Add prehybridization solution and incubate at 37 °C for 1 hour.

[0101] 6) Hybridization: Discard the pre-hybridization solution, add the hybridization solution containing the probe, and incubate overnight in a constant temperature incubator.

[0102] 7) Washing after hybridization: Wash away the hybridization solution; wash with 2×SSC at 37℃ for 10 min; wash with 1×SSC at 37℃ for 2×5 min; wash with 0.5×SSC at room temperature for 10 min. If there are many non-specific hybrids, formamide can be added for washing.

[0103] 8) Add the corresponding branch probe for hybridization: Gently shake the slice dry, add the preheated corresponding branch probe hybridization solution (60 μL), and place it horizontally in a humidified chamber at 40℃ for 45 min for hybridization.

[0104] 9) Washing after hybridization: Pour off the hybridization solution and rinse the slices sequentially with 2× SSC, 1× SSC, 0.5× SSC and 0.1× SSC preheated to 40℃ for 5 min at 40℃.

[0105] 10) Add the corresponding signal probe: Add hybridization solution containing the signal probe at a dilution ratio of 1:200. Incubate at 42°C for 3 hours. Then, wash sequentially with the following SSCs: 2×SSC, 37°C for 10 minutes; 1×SSC, 37°C for 2×5 minutes; 0.5×SSC, 37°C for 10 minutes.

[0106] 11) DAPI counterstaining of the nucleus: Add DAPI staining solution to the slide, incubate in the dark for 8 min, rinse, and then add anti-fluorescence quenching mounting medium to mount the slide.

[0107] 12) Microscopic examination and photography: The slides were observed and images were acquired under a Nikon upright fluorescence microscope.

[0108] The in situ hybridization probe sequence for hsa-miR-210-3p is 5'-TCAGCCGCTGTCACACGCACAG-3', as shown in SEQ ID No. 22.

[0109] Example 5: Immunohistochemical detection of TRIM33 expression level in tumor tissues from patients with nasopharyngeal carcinoma and cervical cancer

[0110] Tissues were immediately fixed after washing with PBS and stored at 4°C. Utilizing the principle of specific binding between antigen and antibody, the expression of TRIM33 in tissue cells was determined by a chemical reaction that caused the labeled antibody to develop color, allowing for its localization, qualitative, and quantitative analysis. Immunohistochemical analysis of nasopharyngeal carcinoma tumor tissues was used to verify the correlation between TRIM33 expression levels and nasopharyngeal carcinoma stage. Figure 10 As shown, LDHA is lactate dehydrogenase; in situ hybridization / immunohistochemistry of cervical cancer patient tumor tissues verified the correlation between hsa-miR-7-5p / TRIM33 expression levels and the occurrence and development of cervical cancer, as shown in the figure. Figure 11 As shown, Normal represents normal tissue, HSIL represents high-grade squamous intraepithelial lesion, and CC represents cervical cancer; this validates the correlation between TRIM33 and the malignant progression of nasopharyngeal carcinoma and cervical cancer.

[0111] The specific steps are as follows: 1) Dewaxing paraffin sections to water: sequentially immerse the sections in environmentally friendly dewaxing solution I for 10 min, environmentally friendly dewaxing solution II for 10 min, environmentally friendly dewaxing solution III for 10 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, anhydrous ethanol III for 5 min, and then wash with distilled water.

[0112] 2) Antigen retrieval: Retrieve antigens according to tissue type. During this process, prevent excessive evaporation of buffer solution and avoid drying the slide. After natural cooling, place the slide in PBS (pH 7.4) and wash it three times on a decolorizing shaker for 5 minutes each time.

[0113] 3) Blocking endogenous peroxidase: Place the slide in a 3% hydrogen peroxide solution and incubate at room temperature in the dark for 25 min. Then place the slide in PBS (pH 7.4) and wash it three times on a decolorizing shaker for 5 min each time.

[0114] 4) Serum blocking: Add 3% BSA to the histochemistry zone to evenly cover the tissue, and block at room temperature for 30 minutes. (Use rabbit serum for primary antibody derived from goat, and BSA for primary antibody derived from other sources.)

[0115] 5) Add primary antibody: Gently shake off the blocking solution, add the primary antibody prepared in PBS at a certain ratio to the slide, and incubate the slide flat in a humidified chamber at 4°C overnight.

[0116] 6) Add secondary antibody: Place the slide in PBS (pH 7.4) and wash three times on a decolorizing shaker for 5 minutes each time. After slightly drying the sections, add the secondary antibody (HRP-labeled) of the corresponding species to the primary antibody to cover the tissue and incubate at room temperature for 50 minutes.

[0117] 7) DAB staining: Place the slide in PBS (pH 7.4) and wash it three times on a decolorizing shaker for 5 minutes each time. After slightly drying the slide, add freshly prepared DAB staining solution to the circle. Control the staining time under a microscope. A positive result is brownish-yellow. Rinse the slide with tap water to stop the staining process.

[0118] 8) Counterstaining cell nuclei: Counterstain with hematoxylin for about 3 minutes, wash with tap water, differentiate with hematoxylin differentiation solution for a few seconds, rinse with tap water, re-blue with hematoxylin blue solution, and rinse with running water.

[0119] 9) Dehydration and mounting: Place the sections in the following solutions in sequence: 75% alcohol for 5 min, 85% alcohol for 5 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, n-butanol for 5 min, and xylene I for 5 min to dehydrate and clear the sections. Remove the sections from the xylene solution and let them air dry slightly before mounting with mounting adhesive.

[0120] 10) Microscopic examination: Interpret the results under a white light microscope. Hematoxylin stains the cell nuclei blue, and DAB shows positive expression as brownish-yellow.

[0121] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A lactate microenvironment-responsive miRNA combination, characterized in that, The miRNA combinations are hsa-miR-7-5p, hsa-miR-210-3p, hsa-miR-4521, and hsa-miR-7974; the nucleotide sequence of hsa-miR-7-5p is shown in SEQ ID No. 1, the nucleotide sequence of hsa-miR-210-3p is shown in SEQ ID No. 2, the nucleotide sequence of hsa-miR-4521 is shown in SEQ ID No. 3, and the nucleotide sequence of hsa-miR-7974 is shown in SEQ ID No.

4.

2. The amplification method for lactate microenvironment-responsive miRNA combinations as described in claim 1, characterized in that, The method includes the following steps: Step 1: Extract total RNA from cells; Step 2: The total RNA obtained in Step 1 is reverse transcribed by reverse transcriptase to obtain a reverse transcription product, which is an elongated miRNA first-strand cDNA; wherein a stem-loop reverse transcription primer is designed separately according to the stem-loop structure of each miRNA in the combination, and the 5' end of the stem-loop reverse transcription primer specifically binds to the 3' end of the miRNA molecule; Step 3: Perform qPCR on each reverse transcription product obtained in Step 2 using real-time PCR primers to obtain the target gene.

3. The method as described in claim 2, characterized in that, The step 1, extracting total RNA, is as follows: 1) Remove the cells and transfer them to an EP tube. Centrifuge for the first time, discard the supernatant, and obtain the cell pellet. 2) Add lysis buffer to the cell pellet obtained in step 1), and pipette to fully lyse the cells and obtain cell lysis products; 3) Add an equal volume of anhydrous ethanol to the cell lysis product obtained in step 2), mix thoroughly by pipetting; then add to a centrifuge column, centrifuge a second time, and discard the first liquid; 4) Add washing solution to the centrifuge column described in step 3), and centrifuge for the third time; remove the centrifuge column from the collection tube and pour out the second liquid, place the collection tube on absorbent paper and tap it gently twice, then put the centrifuge column back into the collection tube and centrifuge for the fourth time; 5) Without discarding the waste liquid, directly transfer the centrifuge column to an RNase-free EP tube, open the cap and let it air dry to obtain a dried offline column; 6) Add RNase-free ddH2O to the membrane in the center of the dried centrifuge column obtained in step 5) and place at room temperature; 7) Centrifuge the centrifuge column obtained in step 6) for the fifth time, discard the centrifuge column, quickly transfer the obtained RNA to ice and place it for concentration determination, and then carry out subsequent experiments, or store it at -80°C for later use.

4. The method as described in claim 2, characterized in that, Step 2 further includes: the stem-loop nucleotide sequence of hsa-miR-7-5p is shown in SEQ ID No. 5, the stem-loop nucleotide sequence of hsa-miR-210-3p is shown in SEQ ID No. 6, the stem-loop nucleotide sequence of hsa-miR-4521 is shown in SEQ ID No. 7, and the stem-loop nucleotide sequence of hsa-miR-7974 is shown in SEQ ID No.

8.

5. The method as described in claim 4, characterized in that, Step 2 further includes: the stem-loop reverse transcription primer nucleotide sequence of hsa-miR-7-5p is shown in SEQ ID No. 9, the stem-loop reverse transcription primer nucleotide sequence of hsa-miR-210-3p is shown in SEQ ID No. 10, the stem-loop reverse transcription primer nucleotide sequence of hsa-miR-4521 is shown in SEQ ID No. 11, and the stem-loop reverse transcription primer nucleotide sequence of hsa-miR-7974 is shown in SEQ ID No.

12.

6. The method as described in claim 2, characterized in that, Step 2 also includes using a stem-loop reverse transcription kit.

7. The method as described in claim 6, characterized in that, Step 2 also includes: Step 2.1: Remove genomic DNA at 42°C for 2 minutes to obtain the reaction solution; Step 2.2: Perform the first-strand cDNA synthesis reaction on the reaction solution obtained in step 2.

1.

8. The method as described in claim 7, characterized in that, The reaction conditions for the first-strand cDNA synthesis in step 2.2 are: 25℃ for 5 min; 50℃ for 15 min; 85℃ for 5 min.

9. The method as described in claim 2, characterized in that, Step 3 further includes: the nucleotide sequences of the real-time PCR primers for hsa-miR-7-5p are shown in SEQ ID No. 13 and SEQ ID No. 14; the nucleotide sequences of the real-time PCR primers for hsa-miR-210-3p are shown in SEQ ID No. 15 and SEQ ID No. 16; the nucleotide sequences of the real-time PCR primers for hsa-miR-4521 are shown in SEQ ID No. 17 and SEQ ID No. 18; and the nucleotide sequences of the real-time PCR primers for hsa-miR-7974 are shown in SEQ ID No. 19 and SEQ ID No.

20.

10. The method as described in claim 2, characterized in that, Step 3 further includes preparing an internal reference PCR system and performing a PCR reaction to obtain an internal reference gene; the internal reference is U6; the relative amount of the target gene is the difference between the target gene and the internal reference gene.

Images