Wheat genotype detection method based on KASP marker and application thereof

Abstract

The invention relates to a wheat genotype detection method based on a KASP marker and application thereof, and belongs to the technical field of molecular biology and crop breeding. The invention discloses two core KASP markers related to specific characters of wheat, namely K000750 (located in a chromosome 673602864, and SNP is G / C) and K000753 (located in a chromosome 550894484, and SNP is T / C), and provides specific primer sequences of the two core KASP markers, as shown in SEQ ID NO: 3-5 and SEQ ID NO: 6-8. The detection method comprises the following steps: extracting wheat genome DNA, carrying out KASP amplification reaction by using the specific primer, and analyzing and determining the genotype through a fluorescence signal. The molecular marker provided by the invention is high in flux, good in accuracy and low in cost, can be used for rapid and accurate genotype screening of wheat breeding materials, shortens the breeding cycle, and accelerates the breeding process of excellent new varieties.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and crop breeding technology, and in particular relates to a method for detecting wheat genotypes using KASP markers and its applications. Background Technology

[0002] Wheat (Triticum aestivum) is one of my country's most important food crops, with nearly 10,000 years of cultivation history, providing vital support and security for human survival and livelihood. As the world's largest grain producer, increasing my country's grain output is a fundamental task to ensure the livelihood of farmers. Building upon wheat's role in providing food for humanity, genetic improvement relies on efficient molecular marker technology. With the development of molecular breeding, the development of molecular markers with high polymorphism, good reproducibility, and reasonable cost is of great significance for wheat variety identification and molecular design breeding. Wheat is one of the most widely planted and consumed food crops globally. my country's annual wheat production ranks high, second only to corn in total output, making it a core crop for ensuring food security.

[0003] KASP marker development is one of the methods for wheat genotyping. This invention discloses a wheat-related KASP molecular marker and its development method. The process involves developing a molecular marker targeting single nucleotide polymorphism (SNP) sites in a target gene to detect whether it is related to nitrogen content. This marker is simple, convenient, and has good genetic stability, and can be used for marker-assisted breeding of target traits in wheat, improving breeding efficiency.

[0004] Molecular marker-assisted selection (MMR) is a key technology for improving wheat breeding efficiency. However, existing molecular markers and detection technologies for wheat KASP have many shortcomings, hindering their large-scale application. In the detection of wheat KASP markers, existing technologies often face numerous problems. In actual detection, differences between sample and template sequences, sample impurities, large concentration differences, or a large number of samples may lead to unsuccessful marker detection or inaccurate genotyping. This invention aims to solve these problems and improve the accuracy and reliability of wheat KASP marker detection. Therefore, there is an urgent need in the field to develop a molecular marker detection technology that is high-throughput, accurate, low-cost, easy to operate, and readily automated, to achieve rapid, accurate, and large-scale application of genotyping in wheat breeding.

[0005] In summary, while many linkage markers for wheat-related genes can be used for marker-assisted selection, their detection efficiency is low, results are not always accurate, and the development and detection outcomes are not always satisfactory. Therefore, developing KASP markers closely linked to specific wheat traits and establishing an efficient, accurate, and low-cost genotyping method is of great significance for overcoming traditional breeding bottlenecks, realizing molecular design breeding of wheat, accelerating the selection of superior new varieties, and enhancing the core competitiveness of my country's seed industry. Summary of the Invention

[0006] Based on this, the present invention provides a method for wheat genotyping based on KASP markers and its application. It involves studying wheat genotyping markers, conducting sample testing, developing markers, and verifying their detection. The aim is to improve the success rate and genotyping accuracy of wheat KASP marker detection, overcoming the difficulties in interpreting marker detection results caused by sample factors such as sequence differences, impurities, concentration differences, and testing scale in existing technologies. This ensures that effective KASP marker information can be accurately obtained from 205 or more wheat samples. The detection method of this invention is a high-throughput, high-accuracy, low-cost, simple-to-operate, and easily automated molecular marker detection technology, enabling rapid, accurate, and large-scale application of genotyping in wheat breeding.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A method for wheat genotyping based on KASP markers, wherein the KASP markers are K000750 and K000753, wherein... The natural variation site detected by the marker K000750 and SNP name AX-108960675 is located at the base G / C at 673602864 of wheat chromosome; The natural variation site detected by the marker K000753 and SNP name AX-94696367 is located at the base T / C at 550894484 of wheat chromosome 14. The above-mentioned sites can serve as SNP markers for wheat-specific traits.

[0008] Furthermore, the flanking nucleotide sequence of the variant site on chromosome 673602864 of the wheat variety SNP AX-108960675 is shown in SEQ.NO.1.

[0009] SEQ.NO.1: AGTAGTGATCTAAACTCTATGATCTAAACGCTCTAGGGAATAGTAATTAACTCAGCTAAGATCGGCTCGACAGATGTGTGGATGCCGACGACATCGACCT[G / C]ATGATGATCGTCAAGATCTGTGCCTCCACTGTCTAACCTGACGCGCCCTGCTGCTTTGGCGTCCCTGCCTAGTTAGTGTGGTTTGTGATTTCTCCGTCTG.

[0010] Furthermore, the flanking nucleotide sequence of the variant site on chromosome 550894484 of the wheat variety SNP AX-94696367 is shown in SEQ.NO.2.

[0011] SEQ.NO.2: GTTCCTTGGGCACCTTAAAAAGCTAAGCTTTGCCGGAATCACCCCCGACTTCCTGATGTTGCTGCGCCAATGTTCTAGAATTGGCAGGGTGCGATGGCAG[T / C]ATTCTCTACGCCATTGACCGCTACTGGTCTGGACATGCATAGGTATGTAAAACACTCAACTGATTGGAATTTCAATATTATTTCCTCGTGTAACTTG.

[0012] Furthermore, the K000750 labeled primer: Primer Seq Allele X: 5'GAAGGTGACCAAGTTCATGCTGCCGACGACATCGACCTG 3', as shown in SEQ.NO.3; Primer Seq Allele Y: 5'GAAGGTCGGAGTCAACGGATTGCCGACGACATCGACCTC 3', as shown in SEQ.NO.4; Primer Seq common: 5'ACAGTGGAGGCACAGATCTTGAC 3', as shown in SEQ.NO.5.

[0013] Furthermore, the K000753 labeled primer: Primer Seq Allele X: 5'GAAGGTGACCAAGTTCATGCTCGGTCAATGGCGTAGAGAATA 3', as shown in SEQ.NO.6; Primer Seq Allele Y: 5'GAAGGTCGGAGTCAACGGATTGGTCAATGGCGTAGAGAATG 3', as shown in SEQ.NO.7; Primer Seq common: 5'ACTTCCTGATGTTGCTGCG 3', as shown in SEQ.NO.8.

[0014] Furthermore, the wheat genotype detection method based on KASP markers includes the following steps: (1) Sample preparation: 205 wheat samples were selected and DNA extraction and quality testing were carried out in accordance with the standard procedure to ensure that the sample quality met the testing requirements; (2) Marker selection: Select the developed markers K000750 and K000753; (3) Detection: KASP marker detection 1) Aliquot the diluted DNA and the MIX and KASP markers required for the PCR reaction into 384 plates and seal them; 2) Perform PCR reaction using a 384 PCR instrument; 3) After PCR, remove plate 384 and centrifuge at 4000 rpm for 1 min; 4) After centrifugation, the 384 plates are automatically scanned using a FLUO star Omega SNP fluorescence reader. All data are automatically transmitted to the central server, where genotype analysis and interpretation are performed using Kraken software, and a test report is generated. (4) Based on the typing results, conduct testing and analysis to ensure the accuracy of the typing results.

[0015] This invention uses the genomic DNA of wheat to be tested as a template, employs primer combination design, and performs sequencing. Based on the sequencing results obtained from the above steps, the genotype of the wheat to be tested is obtained.

[0016] Furthermore, the wheat genotype at the KASP AX-108960675 locus is heterozygous G / C; The wheat genotype at the KASP AX-94696367 locus is heterozygous T / C.

[0017] Furthermore, the PCR reaction system in step (3) is 4 μL, including: 2 μL of DNA to be detected, 2 μL of 2×KASP Master mix, and 0.056 μL of primer mixture.

[0018] Furthermore, the PCR program in step (3) is as follows: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, with a temperature decrease of 1℃ for each cycle, for a total of 10 cycles; 95℃ for 20 s, 55℃ for 1 min, for a total of 40 cycles.

[0019] Furthermore, the detection method is used for genotyping of wheat breeding materials, thereby shortening the breeding cycle.

[0020] Compared with the prior art, the present invention has the following beneficial effects: This invention provides KASP markers K000750 and K000753 for screening wheat genotype varieties. By detecting single nucleotide polymorphisms in genes in different wheat varieties, this invention determines whether the location of the locus is related to the target. Utilizing this characteristic, traits that are more adapted to the wheat growth cycle can be screened efficiently and reliably. This invention can accelerate the breeding process of high-quality new wheat varieties and has important application value. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be described below.

[0022] Figure 1 The genotyping results of wheat at chromosome 673602864 provided in this embodiment of the invention; wherein, red and blue represent homozygous type, green represents heterozygous type, pink represents no signal, and black represents no template control, that is, ultrapure water is used to replace sample DNA.

[0023] Figure 2 The genotyping results of wheat at chromosome 550894484 provided in this embodiment of the invention; wherein, red and blue represent homozygous type, green represents heterozygous type, pink represents no signal, and black represents no template control, that is, ultrapure water is used to replace sample DNA. Detailed Implementation

[0024] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0026] The wheat varieties used in the following examples are all commercially available.

[0027] Example 1 The inventors screened KASP molecular markers for genotyping verification in natural wheat populations.

[0028] 1.1 Experimental Materials and Objectives To verify the effectiveness and practicality of the KASP molecular markers described in this invention, 205 genetically diverse natural wheat populations were selected as test samples. These samples, sourced from the wheat breeding experimental field of Henan Agricultural University, covered winter wheat, spring wheat, and hybrid progeny materials, exhibiting broad genetic diversity. Markers K000750 and K000753 were used for detection to verify their genotyping efficiency, polymorphism, and accuracy in large-scale populations. For the control DNA genome, known wheat standards were used; K000750 was genotyped as G:C, and K000753 as T:C.

[0029] 1.2 Experimental Methods The following scheme is for the genotyping validation of the KASP molecular marker in natural wheat populations.

[0030] (1) Select two already developed markers: K0007500 (corresponding to customer number AX-108960675) and K000753 (corresponding to customer number AX-94696367).

[0031] (2) Primer design: The flanking sequences of the SNP site are 100 bp before and after the target position on the 5'-3' positive strand of the corresponding genome. Specific primers are designed for the two markers respectively, and two genotyping strategies are adopted: K000750 labeled primer: Primer Seq Allele X: 5'GAAGGTGACCAAGTTCATGCTGCCGACGACATCGACCTG 3', as shown in SEQ.NO.3; Primer Seq Allele Y: 5'GAAGGTCGGAGTCAACGGATTGCCGACGACATCGACCTC 3', as shown in SEQ.NO.4; Primer Seq common: 5'ACAGTGGAGGCACAGATCTTGAC 3', as shown in SEQ.NO.5.

[0032] K000753 labeled primer: Primer Seq Allele X: 5'GAAGGTGACCAAGTTCATGCTCGGTCAATGGCGTAGAGAATA 3', as shown in SEQ.NO.6; Primer Seq Allele Y: 5'GAAGGTCGGAGTCAACGGATTGGTCAATGGCGTAGAGAATG 3', as shown in SEQ.NO.7; Primer Seq common: 5'ACTTCCTGATGTTGCTGCG 3', as shown in SEQ.NO.8.

[0033] (3) Explanation of sequence results Sequence consistent and in the same direction: The sequence is a 5'-3' positive strand sequence, and it is consistent with the sequence within 100 bp before and after the target position on the 5'-3' positive strand retrieved from the genome; Sequence Consistency Reverse: The sequence is a 3'-5' antisense strand sequence. After reverse complementation of the sequence provided by the client, it is consistent with the sequence within 100 bp before and after the target position on the 5'-3' sense strand retrieved from the genome.

[0034] (4) Experimental methods: Genomic DNA was extracted from 205 wheat samples using the CTAB method, and the purity was measured. The specific process was as follows: 0.1 g of young wheat leaves were ground into powder in liquid nitrogen. 600 μL of preheated modified CTAB extraction buffer was added, and the mixture was incubated at 65℃ for 60 min, inverting three times during incubation. An equal volume of chloroform-isoamyl alcohol (24:1 v / v) mixture was added, and the mixture was inverted three times. The mixture was centrifuged at 12000 rpm for 10 min at 4℃. The supernatant was transferred to a new centrifuge tube, and an equal volume of pre-cooled isopropanol was added. The mixture was allowed to stand at -20℃ for 30 min. The mixture was centrifuged at 12000 rpm for 15 min at 4℃, and the supernatant was discarded. The precipitate was washed twice with 75% ethanol and placed in a well-ventilated area of ​​a clean bench for 15 min. 50 μL of water was added to dissolve the DNA precipitate. The DNA concentration and purity were determined using a micro spectrophotometer. A DNA template with a concentration of 50 ng / μL ± 5% (A260 / A280 = 1.8–2.0) was obtained.

[0035] The modified CTAB extract uses existing technology, referring to the following literature: Doyle, JJ, & Doyle, JL (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin, 19, 11-15. The testing process is as follows: I. KASP Tag Design 1. Sequence evaluation Based on the species, version, chromosome number, chromosome location, SNP genotype, SNP and flanking sequences, SNP name, etc. provided by the client, Blast analysis is performed with the genome of the corresponding species and version to obtain sequence consistency, the number of similar sequences in the genome (identity > 83% and coverage > 80%), etc.

[0036] 2. Marker Design Based on the evaluated sequences selected / given by the client, primers are manually designed one by one using Primer5 primer design software, following primer design principles and precautions, to obtain their FAM, HEX, and universal primer sequences.

[0037] 3. Primer synthesis and preparation After primer synthesis, the dry powder was centrifuged at 12,000 rpm for 10 min, diluted with ddH2O to 100 mmol / L, and dissolved by vortexing to obtain solutions of primers FAM, HEX, and universal primers, respectively.

[0038] Take a 2D tube and caps, add 23 μL of 10Mm Tris-HCl, 6 μL each of FAM and HEX solutions, and 15 μL of universal primer solution, mix well and centrifuge to obtain the primer mixture.

[0039] II. KASP Markup Detection 1. Aliquot the diluted DNA and the MIX and KASP markers required for the PCR reaction into 384 plates and seal them.

[0040] 2. Perform PCR reaction using a 384 PCR instrument. PCR reaction system: The system is 4 μL, including: 2 μL of DNA to be tested, 2 μL of 2× KASP Master mix, and 0.056 μL of primer mixture.

[0041] PCR reaction program: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, decreasing by 1℃ per cycle, for a total of 10 cycles; 95℃ for 20 s, 55℃ for 1 min, for a total of 40 cycles.

[0042] 3. After PCR, remove plate 384 and centrifuge at 4000 rpm for 1 min.

[0043] 4. After centrifugation, the 384 plates are automatically scanned using a FLUO star Omega SNP fluorescence reader. All data is automatically transmitted to the central server, where genotyping and interpretation are performed using Kraken software, and a test report is generated.

[0044] Third, conduct testing and analysis based on the typing results to ensure the accuracy of the typing results.

[0045] The classification interpretation criteria are shown in Table 1 below. Note: Successful verification does not guarantee 100% classification success during detection.

[0046] Table 1 Classification Interpretation Criteria

[0047] Table 2 shows the genotyping results of 205 wheat KASP marker validations, as shown below. In the table, A:A and C:C represent homozygous types, A:G and C:T represent heterozygous types, and NC represents no signal or weak signal.

[0048] Table 2. Genotyping results of 205 wheat KASP marker validation accessions.

[0049]

[0050]

[0051]

[0052] The experimental results above show that A:A and C:C represent homozygous types, A:G and C:T represent heterozygous types, and NC represents no signal or a weak signal.

[0053] This invention utilizes carefully designed primers to detect specific SNP sites, enabling precise identification of target traits in wheat. This technology provides accurate genotypic information for molecular breeding and facilitates rapid screening of ideal wheat varieties. Therefore, the technical and theoretical support of this invention makes a significant technological contribution to the development of high-yield wheat varieties, promoting agricultural technological progress and increasing crop yields.

[0054] The present invention has been described in detail above with general description and specific embodiments. However, some modifications or improvements can be made to the present invention, and all of them shall fall within the scope of protection claimed by the present invention.

Claims

1. A method for wheat genotyping based on KASP markers, characterized in that, The KASP is labeled K000750 and K000753, where, The natural variation site detected by the marker K000750 and SNP name AX-108960675 is located at the base G / C at 673602864 of wheat chromosome 4; The natural variation site detected by the marker K000753 and SNP name AX-94696367 is located at the base T / C at 550894484 of wheat chromosome 14. The above-mentioned sites can serve as SNP markers for wheat-specific traits.

2. The detection method according to claim 1, characterized in that, The flanking nucleotide sequence of the variant site on chromosome 673602864 of the wheat variety SNP AX-108960675 is shown in SEQ.NO.

1.

3. The detection method according to claim 1, characterized in that, The flanking nucleotide sequence of the variant site on chromosome 550894484 of the wheat variety SNP AX-94696367 is shown in SEQ.NO.

2.

4. The detection method according to claim 1, characterized in that, The K000750 labeled primer: Primer Seq Allele X: 5'GAAGGTGACCAAGTTCATGCTGCCGACGACATCGACCTG 3', as shown in SEQ.NO.3; Primer Seq Allele Y: 5'GAAGGTCGGAGTCAACGGATTGCCGACGACATCGACCTC 3', as shown in SEQ.NO.4; Primer Seq common: 5'ACAGTGGAGGCACAGATCTTGAC 3', as shown in SEQ.NO.

5.

5. The detection method according to claim 1, characterized in that, The K000753 labeled primer: Primer Seq Allele X: 5'GAAGGTGACCAAGTTCATGCTCGGTCAATGGCGTAGAGAATA 3', as shown in SEQ.NO.6; Primer Seq Allele Y: 5'GAAGGTCGGAGTCAACGGATTGGTCAATGGCGTAGAGAATG 3', as shown in SEQ.NO.7; Primer Seq common: 5'ACTTCCTGATGTTGCTGCG 3', as shown in SEQ.NO.

8.

6. The detection method according to claim 1, characterized in that, The wheat genotype detection method based on KASP markers includes the following steps: (1) Sample preparation: 205 wheat samples were selected and DNA extraction and quality testing were carried out in accordance with the standard procedure to ensure that the sample quality met the testing requirements; (2) Marker selection: Select the developed markers K000750 and K000753; (3) Detection: KASP marker detection 1) Aliquot the diluted DNA and the MIX and KASP markers required for the PCR reaction into 384 plates and seal them; 2) Perform PCR reaction using a 384 PCR instrument; 3) After PCR, remove plate 384 and centrifuge at 4000 rpm for 1 min; 4) After centrifugation, the 384 plates are automatically scanned using a FLUO star Omega SNP fluorescence reader. All data are automatically transmitted to the central server, where genotype analysis and interpretation are performed using Kraken software, and a test report is generated. (4) Based on the typing results of the test, conduct testing and analysis to ensure the accuracy of the typing results.

7. The detection method according to claim 6, characterized in that, The wheat genotype at the KASP AX-108960675 locus is heterozygous G / C; The wheat genotype at the KASP AX-94696367 locus is heterozygous T / C.

8. The detection method according to claim 6, characterized in that, The PCR reaction system in step (3) is 4 μL, including: 2 μL of DNA to be detected, 2 μL of 2× KASP Master mix, and 0.056 μL of primer mixture.

9. The detection method according to claim 6, characterized in that, The PCR program in step (3) is as follows: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, with a temperature drop of 1℃ per cycle, for a total of 10 cycles; 95℃ for 20 s, 55℃ for 1 min, for a total of 40 cycles.

10. The detection method according to claim 1, characterized in that, The detection method is used for genotype screening of wheat breeding materials, thereby shortening the breeding cycle.

Images