A molecular marker associated with the radial pattern of watermelon fruit peel and use thereof

Abstract

The application provides a molecular marker related to a radial strip pattern of watermelon peel and application thereof, and belongs to the technical field of watermelon molecular breeding. The molecular marker is used for identifying the radial strip pattern of watermelon peel by detecting a SNP site, and the SNP site is located at the 28476770th nucleotide of the 6th chromosome of a watermelon genome; the watermelon peel of watermelons with the genotype CC of the SNP site is of the radial strip pattern, and the watermelons with the genotype TT or T / C of the SNP site are of the tooth strip pattern. The dCAPS molecular marker for identifying the radial strip pattern of watermelon peel by detecting the SNP site is designed, the dCAPS molecular marker has high specificity, the accuracy of identification of the radial strip pattern of the peel is 100%, the type of the peel strip pattern can be quickly and accurately identified, and the breeding process is accelerated.

Description

Technical Field

[0001] This invention belongs to the field of watermelon molecular breeding technology, and in particular relates to a molecular marker related to the radial stripe pattern on watermelon rind and its application. Background Technology

[0002] watermelon( Citrullus lanatus Watermelon (L.) is an annual, creeping vine belonging to the Cucurbitaceae family and the Citrus genus. It is an important fruit-type vegetable crop. Watermelon plays a vital role in promoting rapid income growth for farmers and meeting the growing needs of the people. Therefore, accelerating the breeding process of the watermelon industry has significant economic and production implications. However, current watermelon breeding still relies mainly on traditional methods, with limited molecular markers available for practical production and breeding, resulting in low breeding efficiency and hindering the progress of watermelon breeding. The rind markings are an important appearance quality trait of watermelons and a crucial factor influencing consumer choice; market consumers are increasingly demanding higher quality watermelons with attractive appearances.

[0003] Watermelon rind markings exhibit rich genetic diversity, including differences in their presence, number, width, pattern shape, and color. For example, rind marking shapes can be categorized into serrated stripes, reticulate patterns, striped patterns, radial stripes, and spotted patterns. Research on watermelon rind markings primarily focuses on genetic analysis and gene mapping of the genes controlling this trait. Watermelon rind color is controlled by a single gene; dark green is dominant over light green, and stripes are dominant over light green. The dominant-recessive relationship is dark green. D Stripes d s Light green d Hybridization was conducted using varieties with different rind widths, and the results showed that watermelon rind markings are controlled by a series of alleles. G Gene-controlled fruit peel is uniform and medium to dark green. g W Genes control wide stripes, g M Genes control medium-width stripes, g N Genes control narrow stripes. g The dominant-recessive relationship of genes controlling for striped fruit peel (light green or gray peel). G > g W > g M > g N > g Watermelon rind stripes exhibit diverse patterns, and molecular markers for distinguishing these different types require further development. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a molecular marker related to the radial stripe pattern of watermelon rind and its application.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a molecular marker associated with radial stripe patterns on watermelon rinds. Radial stripe patterns on watermelon rinds can be identified by detecting SNP sites on the molecular marker. The SNP sites are located at nucleotide 28476770 on chromosome 6 of the watermelon genome. Watermelons with the genotype CC at the SNP locus have radial stripes on their rind, while watermelons with the genotype TT or T / C at the SNP locus have serrated stripes on their rind.

[0006] This invention provides a dCAPS-labeled primer for identifying radial stripe covering of watermelon rind. The dCAPS-labeled primer identifies radial stripe covering of watermelon rind by detecting the SNP site. The dCAPS-labeled primer includes primer 6670F-dCAPS and primer 6670R-dCAPS. The nucleotide sequence of primer 6670F-dCAPS is shown in SEQ ID NO.1, and the nucleotide sequence of primer 6670R-dCAPS is shown in SEQ ID NO.2.

[0007] This invention provides the application of the molecular marker or the dCAPS marker primer in identifying the rind marking trait of watermelon.

[0008] This invention provides the application of the molecular marker or the dCAPS marker primer in the identification and screening of watermelon germplasm resources.

[0009] This invention provides the application of the molecular marker or the dCAPS marker primer in assisted breeding of watermelon pericarp traits.

[0010] This invention provides a kit for identifying watermelon rind markings, the kit comprising the dCAPS-labeled primers described above.

[0011] This invention provides a method for identifying watermelon rind markings, comprising the following steps: 1) Extract genomic DNA from the watermelon plants to be identified; 2) The genomic DNA of watermelon plants was amplified by PCR using the dCAPS marker primers described above to obtain the PCR amplification product; 3) The PCR amplification products were subjected to... Hha I enzyme digestion yields the digested product; 4) Electrophoretic enzyme digestion products: When the enzyme digestion product has a 148 bp band but no 119 bp band, the watermelon to be identified is a serrated stripe pattern on the rind; when the enzyme digestion product has a 119 bp band but no 148 bp band, the watermelon to be identified is a radial stripe pattern on the rind; when the enzyme digestion product has both 148 bp and 119 bp bands, the watermelon to be identified is a serrated stripe pattern on the rind.

[0012] Preferably, the PCR amplification reaction system in step 2) includes 0.5-2 μL of 80-120 ng / μL watermelon plant genomic DNA, 0.5-2 μL of 8-12 μM 6670F-dCAPS, 0.5-2 μL of 8-12 μM 6670R-dCAPS, and 10× TransStart Taq Buffer 1.0~3.0μL, 1~4 mM dNTPs 1.0~2.0μL, 1~4 units / μl TransStart Taq DNA Polymerase 0.1~0.3μL, ddH2O 12~14μL.

[0013] Preferably, the PCR amplification reaction program in step 2) is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 34 cycles, followed by 72℃ extension for 8 min.

[0014] Preferably, the enzyme digestion reaction system in step 3) includes 1-3 μl of PCR product. Hha I restriction endonuclease 0.5~2μl, 10×buffer 1~3μl, ddH2O 10~20μl; The enzyme digestion temperature is 35~40℃, and the digestion time is 0.5~2 h.

[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a molecular marker associated with radial stripe markings on watermelon rinds and its application. The molecular marker identifies radial stripe markings on watermelon rinds by detecting a SNP site located at nucleotide 28,476,770 on chromosome 6 of the watermelon genome. Watermelons with the genotype CC at the SNP site have radial stripe markings, while those with the genotypes TT or T / C at the SNP site have serrated stripe markings. The method for identifying radial stripe markings on watermelon rinds using this dCAPS molecular marker includes the following steps: genomic DNA extraction, PCR amplification, restriction endonuclease digestion, and electrophoresis. This invention designs a dCAPS molecular marker to identify radial stripe markings on watermelon rinds by detecting the aforementioned SNP site. The dCAPS molecular marker of this invention has high specificity and an accuracy rate of 100% in identifying radial stripe markings on the rind, enabling rapid and accurate identification of rind marking types and accelerating the breeding process. Attached Figure Description

[0016] Figure 1 The radial stripe coating material 65812 (left) and the serrated stripe material ZYL (right) are used for watermelon rind. Figure 2 Electrophoresis results of using primers labeled with 6670-dCAPS by the radial stripe pattern of the pericarp in a portion of the F2 population. Detailed Implementation

[0017] This invention provides a molecular marker associated with radial stripe patterns on watermelon rinds. Radial stripe patterns on watermelon rinds can be identified by detecting SNP sites on the molecular marker. The SNP sites are located at nucleotide 28476770 on chromosome 6 of the watermelon genome. When nucleotide 28476770 of chromosome 6 in the watermelon genome is T (underlined position), the nucleotide sequence is as shown in SEQ ID NO.3: SEQ ID NO.3: TCTCAGGTGGTTGGTAGGGTGATCTGGAG T AGGGTGTGACAAAAATAGCAGTGTCAAAATACAAATAATGAAATGGTATCATACATTTTTTTAGTTGAATAACGTTGAATAATATGATCTATCTATCTATATATGTGTGCCCGATGCG; When nucleotide 28476770 of chromosome 6 in the watermelon genome is C (underlined position), the nucleotide sequence is as shown in SEQ ID NO.4: SEQ ID NO.4: TCTCAGGTGGTTGGTAGGGTGATCTGGAG C AGGGTGTGACAAAAATAGCAGTGTCAAAATACAAATAATGAAATGGTATCATACATTTTTTTAGTTGAATAACGTTGAATAATATGATCTATCTATCTATATATGTGTGCCCGATGCG; Watermelons with the genotype CC at the SNP locus have radial stripes on their rind, while watermelons with the genotype TT or T / C at the SNP locus have serrated stripes on their rind.

[0018] This invention provides a dCAPS-labeled primer for identifying radial stripe covering of watermelon rind. The dCAPS-labeled primer identifies radial stripe covering of watermelon rind by detecting the SNP site. The dCAPS-labeled primer includes primer 6670F-dCAPS and primer 6670R-dCAPS. The nucleotide sequence of primer 6670F-dCAPS is shown in SEQ ID NO.1, and the nucleotide sequence of primer 6670R-dCAPS is shown in SEQ ID NO.2; SEQ ID NO.1: 5'-TCTCAGGTGGTTGGTAGGGTGATCTGGCG-3' SEQ ID NO.2: 5'-CGCATCGGGCACACATAT-3'.

[0019] This invention provides the application of the molecular marker or the dCAPS marker primer in identifying the rind marking trait of watermelon.

[0020] This invention provides the application of the molecular marker or the dCAPS marker primer in the identification and screening of watermelon germplasm resources.

[0021] This invention provides the application of the molecular marker or the dCAPS marker primer in assisted breeding of watermelon pericarp traits.

[0022] This invention provides a kit for identifying watermelon rind markings, the kit comprising the dCAPS-labeled primers described above.

[0023] This invention provides a method for identifying watermelon rind markings, comprising the following steps: 1) Extract genomic DNA from the watermelon plants to be identified; 2) The genomic DNA of watermelon plants was amplified by PCR using the dCAPS marker primers described above to obtain the PCR amplification product; 3) The PCR amplification products were subjected to... Hha I enzyme digestion yields the digested product; 4) Electrophoretic enzyme digestion products: When the enzyme digestion product has a 148 bp band but no 119 bp band, the watermelon to be identified is a serrated stripe pattern on the rind; when the enzyme digestion product has a 119 bp band but no 148 bp band, the watermelon to be identified is a radial stripe pattern on the rind; when the enzyme digestion product has both 148 bp and 119 bp bands, the watermelon to be identified is a serrated stripe pattern on the rind.

[0024] In this invention, the PCR amplification reaction system in step 2) includes: The watermelon plant genomic DNA is preferably 0.5~2 μL, more preferably 0.7~1.5 μL, even more preferably 1.0 μL, wherein the concentration is preferably 80~120 ng / μL, more preferably 90~110 ng / μL, and even more preferably 100 ng / μL; The preferred concentration of 6670F-dCAPS is 0.5~2 μL, more preferably 0.7~1.5 μL, and even more preferably 1.0 μL; wherein the preferred concentration is 8~12 μM, more preferably 9~11 μM, and even more preferably 10 μM. The preferred concentration of 6670R-dCAPS is 0.5~2 μL, more preferably 0.7~1.5 μL, and even more preferably 1.0 μL; wherein the preferred concentration is 8~12 μM, more preferably 9~11 μM, and even more preferably 10 μM. 10× TransStart Taq The buffer is preferably 1.0~3.0 μL, more preferably 1.5~2.5 μL, and even more preferably 2.0 μL; The preferred concentration of dNTPs is 1.0 to 2.0 μL, more preferably 1.3 to 1.8 μL, and even more preferably 1.6 μL; the preferred concentration is 1 to 4 mM, more preferably 2 to 3 mM, and even more preferably 2.5 mM. TransStart Taq The DNA polymerase is preferably 0.1~0.3 μL, more preferably 0.15~0.25 μL, and even more preferably 0.2 μL; wherein the concentration is preferably 1~4 units / μl, more preferably 1.5~3 units / μl, and even more preferably 2.5 units / μl; The preferred concentration of ddH2O is 12~14 μL, more preferably 12.5~13.6 μL, and even more preferably 13.2 μL.

[0025] In this invention, the preferred reaction program for PCR amplification in step 2) is 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 34 cycles, followed by 72℃ extension for 8 min.

[0026] In this invention, the enzymatic digestion reaction system in step 3) preferably comprises: The PCR product is preferably 1~3 μl, more preferably 1.5~2.5 μl, and even more preferably 2 μl; Hha The preferred concentration of restriction endonuclease is 0.5-2 μl, more preferably 0.7-1.5 μl, and even more preferably 1 μl; wherein the preferred concentration is 8-12 U / μl, more preferably 9-11 U / μl, and even more preferably 10 U / μl. The 10× buffer is preferably 1~3 μl, more preferably 1.5~2.5 μl, and even more preferably 2 μl; The amount of ddH2O added is preferably 10~20μl, more preferably 12~18μl, and even more preferably 15μl; The enzyme digestion temperature is preferably 35~40℃, more preferably 35~38℃, and even more preferably 37℃. The enzyme digestion time is preferably 0.5~2 h, more preferably 1~1.7 h, and even more preferably 1.5 h.

[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0028] Example 1

[0029] Discovery of SNP sites closely linked to the radial stripe trait of watermelon rind and development of dCAPS molecular markers

[0030] (1.1) Analysis of the genetic patterns of radial stripe markings on watermelon rind

[0031] Six generations of watermelon rind marking were obtained through crosses between the radial stripe maternal parent "65812" (P1) and the serrated stripe paternal parent "ZYL" (P2), followed by self-crossing and backcrossing. The rind marking phenotype was investigated and recorded. Based on the results of the rind marking phenotype investigation of the parents, F1, BC1P1, BC1P2, and 413 segregating F2 populations, it was concluded that the gene for radial stripe marking in watermelon rind is controlled by a single major gene, and that radial stripes are recessive to serrated stripes. (Parental phenotypes are shown in the image.) Figure 1 (As shown)

[0032] (1.2) Localization of genes related to radial stripe pattern on watermelon rind

[0033] F2 segregating populations were obtained by crossing the radial-striped maternal parent "65812" and the serrated-striped paternal parent "ZYL". From the F2 segregating populations, 30 radial-striped and 30 serrated-striped watermelon plants were selected, and genomic DNA was extracted from their leaves. The genomic DNA from the 30 radial-striped watermelon plants and the genomic DNA from the 30 serrated-striped watermelon plants were then mixed together. The mixed samples from the parents and F2 generation were sequenced using an Illumina HiSeq 2000 sequencer, yielding high-quality and valid data. The data were compared with the watermelon reference genome 97103, and SNP-index values ​​were calculated using bioinformatics analysis. Candidate regions for genes related to the rind marking trait were found to be located between nucleotides 25363972 and 29504071 on chromosome 6 of the watermelon genome.

[0034] (1.3) Obtaining candidate SNP sites

[0035] Using SNP loci located between nucleotides 25363972 and 29504071 on chromosome 6 of the watermelon genome, obtained by BSA-seq, genotypic analysis was performed on individual plants in the F2 population. Combined with individual plant phenotypes (radial stripes and serrated stripes), recombinant plants were screened. The genotypes of these recombinant plants were further identified using SNPs within the interval, resulting in new recombinant plants. The candidate interval was gradually shortened from both ends, ultimately pinpointing the target gene to nucleotides 28328882 to 28572311. The genotype and phenotype detected by SNP 28476770 within this interval were perfectly matched, with no crossover event, confirming a close link between this SNP locus and the rind stripe trait. In serrated stripe plants, this SNP locus was homozygous for TT or heterozygous for T / C, while in radial stripe plants, it was homozygous for CC.

[0036] (1.4) Design of dCAPS marker primers

[0037] Based on the above SNP sites, a dCAPS marker primer was designed. The dCAPS marker primer consists of an upstream primer 6670F-dCAPS and a downstream primer 6670R-dCAPS.

[0038] 6670F-dCAPS (SEQ ID NO.1): 5'-TCTCAGGTGGTTGGTAGGGTGATCTGGCG-3'; 6670R-dCAPS (SEQ ID NO.2): 5'-CGCATCGGGCACACATAT-3'; The 148 bp PCR product amplified by this primer was then processed by DNA restriction endonuclease. HhaAfter digestion with enzyme I, the following results were observed: the fragments were divided into two segments of 119 bp and 29 bp, with the corresponding SNP site in the PCR product being CC; and the fragment was only 148 bp, with the corresponding SNP site in the PCR product being TT.

[0039] (1.5) Identification of watermelon rind marking type using dCAPS marker primers

[0040] (1.5.1) Genomic DNA was extracted from watermelon leaves using the conventional CTAB method. RNA was removed. The volume of the genomic DNA sample was 100 μL. The DNA quality and concentration were detected using an ultra-micro spectrophotometer and the concentration was diluted to 100 ng / μL.

[0041] (1.5.2) PCR reaction system and procedure

[0042] Reaction system: 1 μl of total DNA from watermelon leaves (100 ng / μl), 1 μl of 10 μM 6670F-dCAPS, 1 μl of 10 μM 6670R-dCAPS, 10× TransStart Taq Buffer 2.0μL, dNTPs 1.6μL (2.5mM), 2.5units / μl TransStart Taq DNA Polymerase 0.2μL, ddH2O 13.2μL.

[0043] PCR reaction program: 94℃ for 5 min, 34 cycles of 94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, and 72℃ for 8 min.

[0044] (1.5.3) Enzyme digestion reaction system and procedure

[0045] Reaction system: 2 μl of PCR product, Hha I restriction endonuclease 1 μl, 10× buffer 2 μl, ddH2O 15 μl.

[0046] Reaction procedure: constant temperature treatment at 37℃ for 1.5 hours.

[0047] (1.5.4) Perform 8% polyacrylamide gel electrophoresis, development, staining and banding interpretation on the PCR products after enzyme digestion.

[0048] After the dCAPS amplification / enzyme digestion reaction is complete, take 1 μl of loading buffer (6× Loading Buffer) and add 5 μL of amplification / enzyme digestion PCR product. Mix well with a pipette and vertically spot 3 μl into an 8% polyacrylamide gel for electrophoresis detection. Electrophoresis at 260V for 1 h is sufficient. After silver staining, remove the gel and take a picture for storage once the bands are clear. Figure 2Electrophoretic images of some plants in the F2 segregating population labeled with 6670-dCAPS, from... Figure 2 The size of the target band detected can determine the accurate genotype, which can then be verified against the phenotype. Here, A represents the serrated band pattern, B represents the radial band pattern, and H represents the heterozygous genotype.

[0049] Example 2

[0050] Identification of pericarp marking type in hybrid populations using SNP loci

[0051] (2.1) Selection of experimental materials

[0052] Using 802 F2 plants obtained from the hybrid combination “65812” (radial stripes) × ZYL (serrated stripes) as experimental materials, phenotypic results showed that in the F2 generation population, there were 594 serrated stripes and 208 radial stripes.

[0053] (2.2) Identification of the F2 population using SNP loci

[0054] The dCAPS marker 6670-dCAPS, associated with the rind marking trait on chromosome 6 of watermelon obtained in Example 1, was used to identify 802 F2 plants. The specific identification method was the same as that in Example 1. The identification results showed that the results identified by this dCAPS molecular marker were consistent with the phenotype of the F2 population, with an accuracy of 100%. Table 1 shows the identification and verification results of 6670-dCAPS in a portion of the F2 population, where A represents the serrated stripe genotype, B represents the radial stripe genotype, and H represents the heterozygous genotype (serrated stripe).

[0055] Table 1. Identification and validation of 6670-dCAPS in the F2 population.

[0056]

[0057]

[0058] Example 3

[0059] Identification of 25 watermelon germplasm resources using dCAPS molecular markers

[0060] (3.1) Selection of experimental materials

[0061] Twenty-five watermelon germplasm resources selected from the existing germplasm resources in the laboratory were used as experimental materials. Among them, 24 watermelons had serrated stripes and 1 had radial stripes. The specific names and phenotypes are shown in Table 2.

[0062] (3.2) Using dCAPS molecular markers, 25 watermelon germplasm resources were identified.

[0063] The dCAPS molecular marker (6670-dCAPS) on chromosome 6 of watermelon obtained in Example 1, which is related to the rind markings, was used to identify 25 watermelon germplasm resources. The specific identification method is the same as that in Example 1.

[0064] Table 2. Identification and validation of 6670-dCAPS in 25 watermelon germplasm resources.

[0065] In summary, the dCAPS molecular marker of this invention can accurately identify the radial stripe pattern on watermelon rind. It is not only fast and effective, but can also be identified at the seedling stage, which greatly shortens the breeding cycle and can be applied on a large scale in production.

[0066] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of a molecular marker associated with radial stripe markings on watermelon rind in identifying watermelon rind marking traits, characterized in that, Radial stripes on watermelon rinds can be identified by detecting SNP sites on the molecular markers, where the SNP sites are located at nucleotide 28476770 on chromosome 6 of the watermelon genome. The watermelon genome is the watermelon reference genome 97103; Watermelons with the genotype CC at the SNP locus have radial stripes on their rind, while watermelons with the genotype TT or T / C at the SNP locus have serrated stripes on their rind. When nucleotide 28476770 on chromosome 6 of the watermelon genome is T, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.3; When nucleotide 28476770 on chromosome 6 of the watermelon genome is C, the molecular marker nucleotide sequence is shown in SEQ ID NO.

4.

2. A method for identifying the markings on a watermelon rind, characterized in that, Includes the following steps: 1) Extract genomic DNA from the watermelon plants to be identified; 2) PCR amplification of watermelon plant genomic DNA was performed using dCAPS-labeled primers to obtain PCR amplification products; 3) The PCR amplification products were subjected to... Hha I enzyme digestion yields the digested product; 4) Electrophoretic enzyme digestion products: When the enzyme digestion product has a 148 bp band but no 119 bp band, the watermelon to be identified is a serrated stripe pattern on the rind; when the enzyme digestion product has a 119 bp band but no 148 bp band, the watermelon to be identified is a radial stripe pattern on the rind; when the enzyme digestion product has both 148 bp and 119 bp bands, the watermelon to be identified is a serrated stripe pattern on the rind. The dCAPS marker primers identify radial stripes on watermelon rinds by detecting SNP sites, which are located at nucleotide 28,476,770 on chromosome 6 of the watermelon genome. The watermelon genome is the watermelon reference genome 97103; Watermelons with the genotype CC at the SNP locus have radial stripes on their rind, while watermelons with the genotype TT or T / C at the SNP locus have serrated stripes on their rind. The dCAPS-labeled primers include primer 6670F-dCAPS and primer 6670R-dCAPS; The nucleotide sequence of primer 6670F-dCAPS is shown in SEQ ID NO.1, and the nucleotide sequence of primer 6670R-dCAPS is shown in SEQ ID NO.

2.

3. The method according to claim 2, characterized in that, Step 2) The PCR amplification reaction system includes 0.5-2 μL of 80-120 ng / μL watermelon plant genomic DNA, 0.5-2 μL of 8-12 μM 6670F-dCAPS, 0.5-2 μL of 8-12 μM 6670R-dCAPS, and 10× TransStart Taq Buffer 1.0~3.0μL, 1~4 mM dNTPs 1.0~2.0μL, 1~4units / μl TransStart Taq DNA Polymerase 0.1~0.3μL, ddH2O 12~14μL.

4. The method according to claim 3, characterized in that, Step 2) The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 34 cycles, followed by 72℃ extension for 8 min.

5. The method according to claim 2, characterized in that, Step 3) The enzyme digestion reaction system includes 1-3 μl of PCR product. Hha I restriction endonuclease 0.5~2μl, 10×buffer 1~3μl, ddH2O 10~20μl; The enzyme digestion temperature is 35~40℃, and the digestion time is 0.5~2 h.

Images