KASP molecular marker related to wheat grain hardness and application of KASP molecular marker
By developing the KASP molecular marker for detecting wheat grain hardness, the problem of improving wheat grain hardness in existing technologies has been solved, enabling efficient screening of wheat varieties with different grain hardness and promoting the large-scale and precise breeding of wheat quality.
Patent Information
- Application Number
- CN202511828036.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-01-09
- Estimated Expiration
- 2045-12-05
AI Technical Summary
Existing technologies make it difficult to effectively improve wheat grain hardness through molecular marker-assisted selection, resulting in poor wheat quality breeding outcomes.
A primer combo based on KASP molecular markers was developed to detect the C101T SNP site in the wheat genome. The grain hardness genotype was determined by fluorescence signal analysis. Combined with PCR amplification and fluorescence signal scanning technology, efficient and accurate grain hardness identification was achieved.
This enables the rapid and accurate screening of wheat varieties with different grain hardness, promoting the large-scale and precise development of wheat quality breeding.
Smart Images

Figure CN121294724A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker breeding technology, and in particular to a KASP molecular marker related to wheat grain hardness and its application. Background Technology
[0002] Wheat (Triticum aestivum L.) is the most widely cultivated and consumed crop in the world, and one of my country's three major grain crops, playing a vital strategic role in ensuring national food security. China ranks first in both wheat production and consumption globally. With socio-economic development and improved living standards, wheat quality has received significant attention from breeders and consumers, making quality improvement one of the main tasks of wheat breeding in my country. According to my country's current "Classification Standards for Wheat Variety Quality (GB / T 17320−2013)," wheat quality indicators mainly include grain hardness, crude protein content, as well as wet gluten content, sedimentation value, water absorption, stability time, maximum tensile resistance, and energy content of wheat flour.
[0003] Grain hardness is a crucial standard for the commercial classification, grading, and pricing of wheat. It not only affects the flour yield and energy consumption in flour processing but also influences the rheological properties of flour, thereby affecting its processing quality. Different hardness categories of wheat have different uses. Hard wheat flour has a large particle size, high broken starch content, and strong water absorption capacity, making it suitable for bread and high-quality noodles. Soft wheat flour has a smaller particle size, low broken starch content, and weak water absorption capacity, making it suitable for biscuits and pastries. Therefore, research on the genetic mechanisms of wheat grain hardness is of paramount importance for guiding wheat variety improvement. Wheat grain hardness is a quantitative trait controlled by multiple genes, primarily the major genes Pina and Pinb located on the short arm of chromosome 5D. Furthermore, QTLs affecting wheat grain hardness have also been found on chromosomes 1A, 2A, 2D, 3A, 5A, 5B, and 6D. However, due to the influence of factors such as the mapping population, genetic background and mapping method, the results can only reflect the gene information contained in a specific wheat variety. Moreover, most QTLs have a small contribution rate to the phenotype and poor repeatability in different environments, so they still cannot meet the needs of marker-assisted selection (MAS).
[0004] Marker-assisted selection (MAG) is a modern breeding method that uses DNA molecular markers closely linked to a target trait to select genotypes for that trait. It has the advantage of being unaffected by external environmental factors. KASP (Kompetitive Allele-Specific PCR) is a fluorescence-based homogenization technique developed in recent years. Primers are designed based on specific SNPs or InDels in the target allele, and different fluorescent groups are added to the primer ends. Genotyping of the target sequence is based on the reading of the fluorescence signal at the PCR terminal. It has the advantages of high efficiency, accuracy, and low cost, and has broad application prospects in crop breeding.
[0005] In summary, combining the genetic characteristics of wheat grain hardness, developing KASP molecular markers related to wheat grain hardness, and establishing precise and high-throughput molecular detection methods have important theoretical and practical value for promoting the large-scale and precise development of wheat quality breeding. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide a KASP molecular marker related to wheat grain hardness and its application.
[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.
[0008] A primer combination for detecting single nucleotide polymorphisms of C101T SNPs in the wheat genome;
[0009] The C101T SNP site is located at position 408272016 bp on chromosome 4B in the IWGSC RefSeq v1.0 genome of Chinese spring wheat, corresponding to the 101st base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1. This site contains two allelic types: CC homozygous and TT homozygous, and wheat with different genotypes has different grain hardness. Specifically, the average grain hardness of wheat with the CC homozygous genotype is higher or can be higher than that of wheat with the TT homozygous genotype.
[0010] The primer combination includes: downstream primer R1 corresponding to SEQ ID NO: 2 in the sequence listing, downstream primer R2 corresponding to SEQ ID NO: 3, and upstream primer F corresponding to SEQ ID NO: 4.
[0011] As a preferred embodiment of the present invention, the 5' end of the downstream primer R1 shown in SEQ ID No: 2 is connected to the fluorescent tag sequence FAM, and the 5' end of the downstream primer R2 shown in SEQ ID No: 3 is connected to the fluorescent tag sequence HEX.
[0012] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in the identification of wheat grain hardness, the reagent or kit being used to detect the above-mentioned C101T SNP site, and containing at least the above-mentioned primer combination.
[0013] On the other hand, the present invention also includes a method for detecting the genotype of the above-mentioned C101T SNP site in the wheat genome, comprising the following (1) or (2):
[0014] (1) Direct sequencing;
[0015] (2) PCR amplification of the wheat genomic DNA to be tested is performed using the above primer combination or the above reagents or kits. The amplification products are scanned for fluorescence signals, and the scan data is analyzed graphically using GraphPad Prism: if the amplification product of the wheat to be tested has FAM fluorescence and is distributed near the x-axis, then the C101T SNP site in the wheat genome to be tested is CC homozygous; if the amplification product of the wheat to be tested has HEX fluorescence and is distributed near the y-axis, then the C101T SNP site in the wheat genome to be tested is TT homozygous.
[0016] As a preferred embodiment of the present invention, the PCR amplification in (2) comprises the following PCR amplification system: 1.5 μL template DNA, 0.0417 μL primer working solution, 0.75 μL 2×KASP Master Mix, and sterile ultrapure water to make up to 3 μL. The primer working solution includes two downstream primers R1 and R2, each with an initial concentration of 100 μM, 12 μL each; upstream primer F, with an initial concentration of 100 μM, 30 μL; and ultrapure water, 46 μL. The PCR reaction program is as follows: 94 °C pre-denaturation for 15 min; 94 °C denaturation for 20 s, annealing / extension for 20 s, 10 cycles, wherein the first annealing / extension temperature is 61 °C, and the temperature is reduced by 0.6 °C for each cycle; 94 °C denaturation for 20 s, 55 °C annealing / extension for 1 min, 26 cycles; 72 °C extension for 3 min; and storage at 4 °C.
[0017] On the other hand, the present invention also includes a method for targeted breeding of wheat. If it is necessary to breed wheat with high grain hardness, wheat with the CC homozygous locus in the wheat genome is selected as the parent for breeding; if it is necessary to breed wheat with low grain hardness, wheat with the TT homozygous locus in the wheat genome is selected as the parent for breeding.
[0018] On the other hand, the present invention also includes a method for comparing the hardness of wheat kernels to be tested, comprising the following steps:
[0019] (A1) Extract genomic DNA from the wheat to be tested;
[0020] (A2) Using the extracted genomic DNA as a template, the C101T SNP genotype was detected using the above method;
[0021] (A3) The wheat grain hardness to be tested is determined as follows: the wheat grain hardness of the above C101T SNP site in the wheat genome is higher than or candidate higher than the wheat grain hardness of the TT homozygous genotype.
[0022] On the other hand, the present invention also includes the application of the above primer combinations, reagents or kits, methods for detecting C101T SNP site genotypes, and methods for comparing the hardness of wheat grains to be tested in any of the following (1)-(6):
[0023] (1) Application in breeding of wheat grain hardness-related traits;
[0024] (2) Application in identifying or assisting in the identification of wheat grain hardness;
[0025] (3) Application in comparing the hardness of wheat grains to be tested;
[0026] (4) Application in the selection or screening of wheat individual plants, lines, strains or varieties with different grain hardness;
[0027] (5) Application in the preparation of products for comparing the hardness of wheat kernels;
[0028] (6) Application in the preparation of products for breeding or screening wheat single plants, lines, strains or varieties with different grain hardness.
[0029] Finally, the present invention also includes various testing products prepared based on the above applications.
[0030] The beneficial effects of the above technical solution are as follows: This invention provides a C101T SNP locus associated with wheat grain hardness, located at position 408272016 bp on chromosome 4B in the IWGSC RefSeq v1.0 genome of Chinese spring wheat, corresponding to the 101st base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1; this locus contains two allelic types: CC homozygous and TT homozygous. Based on this SNP locus, this invention has developed a KASP molecular marker and provides a method for identifying or assisting in the identification of wheat grain hardness. Finally, experimental verification using a large number of wheat materials revealed that the grain hardness of the tested wheat with the CC homozygous genotype is higher than, or candidate higher than, the grain hardness of the tested wheat with the TT homozygous genotype. This invention is of great significance for marker-assisted breeding of high-quality wheat. Attached Figure Description
[0031] Figure 1 This is a schematic diagram showing the KASP primer positions on chromosome 4B for different allele types of the C101T SNP related to grain hardness in common wheat.
[0032] Figure 2 This is a schematic diagram showing the genotyping results of 497 wheat germplasms in a natural population.
[0033] Figure 3 This is a schematic diagram illustrating the association between wheat germplasm of genotypes qGH4B.1a and qGH4B.1b and the mean hardness of wheat grains in natural populations under different environments. Detailed Implementation
[0034] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that, when used in this specification and appended claims, the term "comprising" indicates the presence of the described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that the term "and / or" as used in this specification and appended claims refers to any combination and all possible combinations of one or more of the associated listed items, and includes such combinations.
[0035] As used in this specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrases "if determined" or "if [the described condition or event] is detected" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once [the described condition or event]," or "in response to detection." Furthermore, in the description of this specification and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" described in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in yet other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms “including,” “comprising,” “having,” and variations thereof all mean “including but not limited to,” unless otherwise specifically emphasized.
[0036] Example 1: Discovery of SNP sites related to wheat grain hardness and development of KASP markers
[0037] 1. Discovery of the C101T SNP site
[0038] This invention, through analysis of a large number of wheat germplasm materials (all common wheat germplasm materials were preserved by the Wheat Research Center of the Institute of Grain and Oil Crops, Hebei Academy of Agricultural and Forestry Sciences), discovered a SNP locus associated with wheat grain hardness. This SNP locus is located at position 408272016 bp on chromosome 4B of the wheat genome (referencing the Chinese spring wheat genome IWGSC RefSeqv1.0), corresponding to the 101st base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, and is designated as the C101T SNP locus. This SNP locus contains two allele types: C-type or T-type. Refer to the sequence shown in SEQ ID NO: 1:
[0039] TCGAGTCTTGATCGTTACCTAATGTGACGTGGGCCACAAGTTGCTGGATGTCTCTAAGCTCTGCATGTGCTTGAATGGATAGGGGTAGGTGAAACGCTTCYTGAAGGGAAGATGTGCTTAGAAAATCTTGAACAGAGACATCTTCATTTTTGGCAAAGGAGAAGGCCCTTGGGTGTGATTCAGCTAGAATGTCATTGAGC (SEQ ID NO: 1; among them, Y at position 101 is C or T).
[0040] 2. Development of KASP molecular markers
[0041] A KASP molecular marker was developed based on the C101T SNP site from step 1, along with a KASP primer combination for detecting this marker. Two downstream KASP primers, R1 and R2, were designed based on the C101T SNP site, with FAM and HEX fluorescent adapter sequences added to the 5' ends of each primer. A universal upstream KASP primer, F, was also designed. The nucleotide sequences of the three primers are shown below:
[0042] Downstream primer R1: 5'- GAAGGTGACCAAGTTCATGCT ATTTTCTAAGCACATCTTCCCTTCAG-3' (SEQ ID NO: 2)
[0043] In this context, a single underscore represents a FAM fluorescent tag sequence;
[0044] Downstream primer R2: 5'- GAAGGTCGGAGTCAACGGATT GATTTTCTAAGCACATCTTCCCTTCAA-3' (SEQ ID NO: 3)
[0045] The double underlined part represents the HEX fluorescent tag sequence;
[0046] Upstream primer F: 5'-ATGGATAGGGGTAGGTGAAACGCTT-3' (SEQ ID NO: 4)
[0047] like Figure 1 As shown in the figure, the sequence is the physical location of chromosome 4B in the IWGSC RefSeq v1.0 of the Chinese spring wheat genome, from 408271916 bp to 408272115 bp. The positions of the upstream and downstream primers of the KASP molecular marker are marked with boxes, and the red background represents the C101T SNP site at the physical location of chromosome 4B, 408272016 bp.
[0048] Example 2: Method for detecting wheat genotypes using KASP molecular markers
[0049] 1. Extraction of genomic DNA from the tested wheat
[0050] Genomic DNA was extracted from common wheat using the CTAB method and dissolved in 300 μL of ultrapure water. DNA quality was assessed by 1% agarose gel electrophoresis, requiring clear bands, no obvious impurities, and no degradation. The concentration was determined, and the DNA was diluted to 28.3 ng / μL.
[0051] 2. PCR amplification
[0052] PCR amplification was performed using diluted genomic DNA as a template.
[0053] Preparation of KASP-labeled primer working solution: Two KASP downstream primers, R1 and R2, were designed based on the SNP at the physical location of chromosome 4B (408272016 bp), which is related to wheat grain hardness. FAM and HEX fluorescent adapter sequences were added to the 5' end of the primers, respectively. A universal KASP upstream primer, F, was also designed. The primer sequences are shown in Example 1. The KASP-labeled primer working solution consisted of: 12 μL each of the two downstream primers (100 μM), 30 μL of the upstream primer (100 μM), and 46 μL of ultrapure water. After mixing, the solution was stored at -20 ℃ for later use.
[0054] PCR amplification system: 1.5 μL template DNA, 0.0417 μL primer working solution, 0.75 μL 2×KASP Master Mix (LGC, Lot No. 13426773), and sterile ultrapure water to make up to 3 μL.
[0055] PCR reaction program: 94 °C pre-denaturation for 15 min; 94 °C denaturation for 20 s, annealing / extension for 20 s (first annealing / extension temperature was 61 °C, decreasing by 0.6 °C per cycle), 10 cycles; 94 °C denaturation for 20 s, 55 °C annealing / extension for 1 min, 26 cycles; 72 °C extension for 3 min; store at 4 °C.
[0056] 3. Genotyping determination
[0057] After the PCR reaction, the fluorescence signal was converted into analyzable values using a fluorescence signal reader (Omega) and a fluorescence detection system (Araya). The fluorescence scanning results were graphically displayed using GraphPad Prism. If the amplification product of the tested wheat showed FAM fluorescence distributed near the x-axis, the C101T SNP site in the tested wheat genome was CC homozygous; if the amplification product of the tested wheat showed HEX fluorescence distributed near the y-axis, the C101T SNP site in the tested wheat genome was TT homozygous. CK served as a negative control, distributed near the origin. Figure 2 As shown, CC represents the genotype qGH4B.1a; TT represents the genotype qGH4B.1b.
[0058] Example 3: Application of KASP molecular markers
[0059] Forty-seven Chinese wheat germplasm materials were planted for five consecutive years (2018-2019, 2019-2020, 2020-2021, 2021-2022, and 2022-2023) at the Dishang Experimental Station of the Institute of Grain and Oil Crops, Hebei Academy of Agricultural and Forestry Sciences. Each year, they were sown under normal irrigation and fertilization conditions (irrigated twice, once at the jointing stage and once at the grain-filling stage, with an irrigation volume of 50 m³). 3 Under the conditions of 12 kg / mu of nitrogen fertilizer, with a row length of 3 m, a randomized block design with three replicates.
[0060] 1. Genotyping
[0061] The genotype of the test material was detected according to the method for detecting the genotype of wheat using KASP molecular markers as described in Example 2.
[0062] The results showed that among the 497 Chinese wheat germplasm materials, 472 were of the qGH4B.1a allele type, meaning the C101T SNP genotype was CC homozygous, and 25 were of the qGH4B.1b allele type, meaning the C101T SNP genotype was TT homozygous. The allele types of the 497 wheat germplasm materials are shown in Table 1.
[0063] 2. Detection of wheat grain hardness-related traits
[0064] After harvest, the hardness of wheat grains from 497 wheat germplasm materials was measured using a Perten single grain characteristics analyzer (SKCS-4100) from Sweden. The hardness of wheat grains from different years and under different conditions is shown in Table 1.
[0065] Table 1. Genotyping results of C101T SNP loci in wheat germplasm and grain hardness of wheat in different years.
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078] Note: 1. NA indicates missing kernel hardness data.
[0079] 2. Genotype qGH4B.1a is homozygous for CC and qGH4B.1b is homozygous for TT.
[0080] Statistical results showed that the mean grain hardness of wheat germplasm carrying the qGH4B.1a allele (i.e., the CC homozygous genotype at the C101T SNP locus) was higher than that of wheat germplasm carrying the qGH4B.1b allele (i.e., the TT homozygous genotype at the C101T SNP locus) in different years, with a highly significant difference (P < 0.01), as shown in Table 2. Figure 3 As shown. Figure 3In the data, 18-19_C represents the genotype qGH4B.1a from 2018 to 2019, 18-19_T represents the genotype qGH4B.1b from 2018 to 2019, 19-20_C represents the genotype qGH4B.1a from 2019 to 2020, 19-20_T represents the genotype qGH4B.1b from 2019 to 2020, and 20-21_C represents the genotype qGH4B.1a from 2020 to 2021. 0-21_T represents the genotype qGH4B.1b in 2020-2021, 21-22_C represents the genotype qGH4B.1a in 2021-2022, 21-22_T represents the genotype qGH4B.1b in 2021-2022, 22-23_C represents the genotype qGH4B.1a in 2022-2023, and 22-23_T represents the genotype qGH4B.1b in 2022-2023; ** represents P < 0.01, i.e., the difference is highly significant.
[0081] Table 2. Statistical analysis of the relationship between C101T SNP genotype in common wheat and wheat grain hardness.
[0082]
[0083] Note: P < 0.01 indicates that the difference is highly significant.
[0084] In summary, by using the aforementioned KASP molecular markers, the C101T SNP genotype associated with wheat grain hardness can be identified, thereby enabling rapid and efficient screening of wheat varieties with different grain hardness and accelerating the breeding process of high-quality new wheat varieties.
[0085] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.
Claims
1. Primer combination, characterized in that: Used to detect single nucleotide polymorphisms of C101T SNPs in the wheat genome; The C101T SNP site is located at position 408272016 bp on chromosome 4B in the IWGSC RefSeq v1.0 genome of Chinese spring wheat, corresponding to the 101st base from the 5' end of the nucleotide sequence shown in SEQ ID NO:
1. This site contains two allelic types: CC homozygous and TT homozygous, and wheat with different genotypes has different grain hardness. Specifically, the average grain hardness of wheat with the CC homozygous genotype is higher or can be higher than that of wheat with the TT homozygous genotype. The primer combination includes: downstream primer R1 corresponding to SEQ ID NO: 2, downstream primer R2 corresponding to SEQ ID NO: 3, and upstream primer F corresponding to SEQ ID NO:
4.
2. The primer combination according to claim 1, characterized in that, The downstream primer R1 shown in SEQ ID No: 2 has a fluorescent tag sequence FAM attached to its 5' end, and the downstream primer R2 shown in SEQ ID No: 3 has a fluorescent tag sequence HEX attached to its 5' end.
3. A reagent or kit for identifying or assisting in the identification of wheat grain hardness, characterized in that: The reagent or kit is used to detect the C101T SNP site as described in claim 1, and contains at least the primer combination as described in either claim 1 or 2.
4. A method for detecting the genotype of the C101T SNP locus as described in claim 1 in the wheat genome, characterized in that, Including the following (1) or (2): (1) Direct sequencing; (2) Perform PCR amplification on the wheat genomic DNA to be tested using the primer combination described in claim 1 or 2 or the reagent or kit described in claim 3, scan the fluorescence signal of the amplification product, and perform graphical analysis of the scan data using GraphPad Prism: if the amplification product of the wheat to be tested has FAM fluorescence and is distributed near the x-axis, then the C101T SNP site in the wheat genome to be tested is CC homozygous; if the amplification product of the wheat to be tested has HEX fluorescence and is distributed near the y-axis, then the C101T SNP site in the wheat genome to be tested is TT homozygous.
5. The method according to claim 4, characterized in that, The PCR amplification in (2) is as follows: template DNA 1.5 μL, primer working solution 0.0417 μL, 2×KASP Master Mix 0.75 μL, and sterile ultrapure water to make up to 3 μL; the primer working solution includes two downstream primers R1 and R2, each with an initial concentration of 100 μM, 12 μL each, upstream primer F, with an initial concentration of 100 μM, 30 μL, and ultrapure water 46 μL; the PCR reaction program is as follows: 94 ℃ pre-denaturation for 15 min; 94 ℃ denaturation for 20 s, annealing / extension for 20 s, 10 cycles, of which the first annealing / extension temperature is 61 ℃, and the temperature is reduced by 0.6 ℃ for each cycle; 94 ℃ denaturation for 20 s, 55 ℃ annealing / extension for 1 min, 26 cycles; 72 ℃ extension for 3 min; and storage at 4 ℃.
6. A method for targeted breeding of wheat, characterized by: First, the polymorphism of the C101T SNP site described in claim 1 in the wheat genome is detected. If wheat with high grain hardness is to be bred, wheat with the CC homozygous type of the site in the wheat genome is selected as the parent for breeding. If wheat with low grain hardness is to be bred, wheat with the TT homozygous type of the site in the wheat genome is selected as the parent for breeding.
7. A method for comparing the hardness of wheat kernels to be tested, characterized in that: Includes the following steps: (A1) Extract genomic DNA from the wheat to be tested; (A2) Using the extracted genomic DNA as a template, the genotype of the C101T SNP site was detected by the method described in claim 4; (A3) The wheat grain hardness to be tested is determined as follows: the wheat grain hardness of the C101T SNP site in claim 1, which is homozygous for CC, is higher than or candidate to be higher than the wheat grain hardness of the TT homozygous genotype.
8. The application of the primer combination of claim 1 or 2, the reagent or kit of claim 3, the method for detecting the C101T SNP locus genotype of claim 1 as described in any one of claims 4-5, the wheat directional breeding method of claim 6, and the method for comparing the hardness of wheat grains of claim 7 in any one of the following (1)-(6): (1) Application in breeding of wheat grain hardness-related traits; (2) Application in identifying or assisting in the identification of wheat grain hardness; (3) Application in comparing the hardness of wheat grains to be tested; (4) Application in the selection or screening of wheat individual plants, lines, strains or varieties with different grain hardness; (5) Application in the preparation of products for comparing the hardness of wheat kernels; (6) Application in the preparation of products for breeding or screening wheat single plants, lines, strains or varieties with different grain hardness.
9. Various testing products prepared based on the application described in claim 8.
Citation Information
Patent Citations
Wheat fruited spikelet number and / or grain hardness character related molecular marker and application thereof
CN114480698A
Application of KASP molecular marker related to grain weight and grain length of wheat and primer composition of KASP molecular marker
CN114908188A
KASP marker related to wheat grain hardness and application of KASP marker
CN116555467A
KASP marker for identifying protein content of wheat grains and application of KASP marker
CN119162360A
KASP molecular marker for identifying wheat precipitation value in multiple environments and application of KASP molecular marker
CN120290765A