Application of propionic acid in preparation of medicine for treating hepatolenticular degeneration intestinal liver axis disorder
By supplementing with propionic acid to improve the gut-hepatic axis disorder in Wilson's disease, the problem of large side effects and poor efficacy of existing treatments has been solved, achieving improvement in liver damage and intestinal inflammation, and providing a safe and effective treatment option.
Patent Information
- Application Number
- CN202511845461.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-09
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2045-12-09
AI Technical Summary
Existing treatments for Wilson's disease and gut-liver axis disorders have significant side effects, poor patient tolerance, and unsatisfactory efficacy, lacking effective treatment strategies to improve liver damage and intestinal inflammation.
Using propionic acid as the active ingredient, administered orally or intravenously, it improves liver damage and intestinal inflammation caused by Wilson's disease, reduces serum alanine aminotransferase, aspartate aminotransferase, and total bilirubin levels, increases serum albumin levels, alleviates liver inflammation and fibrosis, and reduces the expression of intestinal inflammatory factors.
It significantly improves liver damage, inflammation, and fibrosis in Wilson's disease model mice, while reducing intestinal inflammation, providing an alternative to traditional copper chelation therapy. It has high safety and broad clinical application prospects.
Smart Images

Figure CN121313618A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to the use of propionic acid in the preparation of a drug for treating Wilson's disease and enterohepatic axis disorder. Background Technology
[0002] Wilson's disease is an autosomal recessive inherited disorder of copper metabolism caused by mutations in the ATP7B gene. This leads to abnormal copper accumulation, primarily in the liver and brain, resulting in cirrhosis, neurological symptoms, and other functional impairments. Current treatments include copper-chelating drugs such as penicillamine and zinc preparations; however, these methods may have significant side effects, poor patient tolerance, and ineffective treatment for some patients. Therefore, developing new treatment strategies is crucial.
[0003] In recent years, the role of the gut microbiota and its metabolites in maintaining host health has received increasing attention. Short-chain fatty acids (SCFAs) are an important class of metabolites produced by gut microbes through the fermentation of dietary fiber, mainly including acetic acid, propionic acid, and butyric acid. They not only provide energy for intestinal cells but also enter the bloodstream, regulating the physiological functions and immune status of distal organs, constituting a key link in the regulation of the "gut-hepatic axis." Existing studies have shown that gut microbiota dysbiosis is closely related to the occurrence and development of various liver diseases, but the specific changes and roles of short-chain fatty acids, especially propionic acid, in the pathological process of Wilson's disease remain unclear.
[0004] Currently, there are no publicly available technologies or literature reports on treatment methods that use propionic acid supplementation to improve the function of the gut-liver axis in Wilson's disease. Summary of the Invention
[0005] The purpose of this invention is to provide the application of propionic acid in the preparation of drugs for treating Wilson's disease and enterohepatic axis disorders. This invention provides a new treatment strategy and drug selection for the treatment of Wilson's disease, with high safety and broad clinical application prospects.
[0006] The technical solution of the present invention: the application of propionic acid in the preparation of drugs for treating Wilson's disease and enterohepatic axis disorder.
[0007] The above-described application refers to the use of the drug to improve liver damage caused by Wilson's disease.
[0008] The aforementioned applications, which improve liver damage, manifest in one or more of the following ways: reducing serum alanine aminotransferase levels, reducing serum aspartate aminotransferase levels, reducing serum total bilirubin levels, increasing serum albumin levels, and alleviating liver inflammation and necrosis.
[0009] The aforementioned application refers to the use of the drug to improve liver inflammation and fibrosis in Wilson's disease.
[0010] The aforementioned applications, which improve liver inflammation and fibrosis, manifest in one or more of the following ways: reducing neutrophil infiltration in the liver, decreasing gene expression of type I collagen and vimentin in liver tissue, and reducing collagen deposition in the liver.
[0011] In the aforementioned applications, the drug is used to reduce intestinal inflammation associated with Wilson's disease.
[0012] In the aforementioned application, the reduction of intestinal inflammation is manifested by reducing the gene expression levels of tumor necrosis factor-α, interleukin-1β, interleukin-6, chemokine ligand 3, and chemokine ligand 5 in intestinal tissue.
[0013] In the aforementioned applications, the drug is administered orally or intravenously.
[0014] In the aforementioned applications, the oral administration is administered via gavage.
[0015] A pharmaceutical composition comprising a therapeutically effective amount of propionic acid as the active ingredient and a pharmaceutically acceptable carrier for improving Wilson's disease-related enterohepatic axis dysfunction.
[0016] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention is the first to discover that propionic acid levels are significantly reduced in Wilson's disease model (ATP7B-KO mice) and patients, and are negatively correlated with the degree of liver damage, thus revealing the potential value of propionic acid replacement therapy in the treatment of this disease.
[0017] 2. In vivo experiments have confirmed that both oral and intravenous propionic acid supplementation can significantly improve liver damage, inflammation and fibrosis in disease models, while also reducing intestinal inflammation, achieving bidirectional benign regulation of the gut-liver axis.
[0018] 3. This invention applies intestinal microbial metabolites (propionic acid) to the treatment of Wilson's disease. The mechanism of action is different from that of traditional copper chelation therapy, and it can provide an alternative for patients who are not sensitive to or cannot tolerate traditional treatments.
[0019] 4. Propionic acid is a naturally occurring short-chain fatty acid in the human body. It has relatively high safety and good prospects for clinical translation. Attached Figure Description
[0020] Figure 1 This figure shows the colon and liver propionic acid content and correlation analysis between 16-week-old wild-type mice and ATP7B-KO disease-prone mice. Figure 1 A showed that the propionic acid content in the liver of diseased mice was significantly lower than that in wild-type mice; Figure 1B represents the correlation analysis between propionic acid content in colonic contents and the total number of neutrophils in the liver (r=-0.7533, P<0.0001). Figure 1 C represents the correlation analysis between propionic acid content in colonic contents and the number of N2 type neutrophils in the liver (r=-0.7429, P<0.0001).
[0021] Figure 2 This is a graph showing the serum propionic acid levels and correlation between healthy controls and patients with Wilson's disease. Figure 2 D showed that the serum propionic acid level in the patient group was significantly lower than that in the healthy control group; Figure 2 E represents the correlation analysis between serum propionic acid content and serum alanine aminotransferase level (r=-0.7380, P=0.0007). Figure 2 F represents the correlation analysis between serum propionic acid levels and serum transforming growth factor-β1 levels (r = -0.7883, P = 0.0002).
[0022] Figure 3 The figure shows the effect of oral propionic acid on body weight and liver index in wild-type mice and ATP7B-KO disease-prone mice. Figure 3 A shows the changes in body weight of mice in each group (ns indicates no statistical difference); Figure 3 B shows the changes in liver index in each group of mice (ns indicates no statistical difference).
[0023] Figure 4 The figure shows the effect of oral propionic acid on serum alanine aminotransferase and aspartate aminotransferase levels in wild-type mice and ATP7B-KO disease-prone mice. Figure 4 C represents the change in serum alanine aminotransferase levels. Figure 4 D represents the change in serum aspartate aminotransferase levels (** indicates a statistically significant difference, ns indicates no statistically significant difference).
[0024] Figure 5 The figure shows the effect of oral propionic acid on total cholesterol and high-density lipoprotein cholesterol levels in wild-type mice and ATP7B-KO disease-prone mice. Figure 5 E represents the change in total cholesterol levels. Figure 5 F represents the change in high-density lipoprotein cholesterol levels (ns indicates no statistical difference).
[0025] Figure 6 The figure shows the effect of oral propionic acid on albumin and total bilirubin levels in wild-type mice and ATP7B-KO disease-prone mice. Figure 6 G represents the change in albumin levels. Figure 6 H represents the change in total bilirubin levels (ns indicates no statistical difference).
[0026] Figure 7 The image shows the effects of oral propionic acid on liver tissue inflammation and collagen formation in wild-type mice and ATP7B-KO disease-prone mice (HE staining and Sirius red staining). Figure 7 I represents the results of HE staining of the liver, showing that liver inflammation and necrosis were reduced in the propionic acid-treated group of disease-type mice; Figure 7 J represents the results of Sirius red staining of the liver, showing reduced collagen formation in the livers of disease-type mice treated with propionic acid.
[0027] Figure 8 The effect of oral propionic acid on the relative expression levels of collagen-related genes (Col1a1, Col1a2, Vimentin) in the liver of ATP7B-KO disease-prone mice (QPCR detection results).
[0028] Figure 9 The effect of oral propionic acid on the distribution of liver neutrophil subsets (N1 and N2 types) in wild-type mice and ATP7B-KO disease mice (flow cytometry detection, based on CD11b⁺Ly6G⁺ cells).
[0029] Figure 10 The figure shows the effect of oral propionic acid on liver infiltrating cells in wild-type mice and ATP7B-KO disease-prone mice. Figure 10 B represents the change in the total number of CD11b⁺Ly6G⁺ neutrophils per 10 grams of liver tissue; Figure 10 C represents the change in the percentage of CD11b⁺Ly6G⁺CD206⁺N2 type neutrophils in the liver (ns indicates no statistical difference).
[0030] Figure 11 The effect of oral propionic acid on the relative expression levels of intestinal inflammatory factors (Tnfα, IL-1β, IL-6, Ccl3, Ccl5) in wild-type mice and ATP7B-KO disease mice is shown in the figure (QPCR detection results, ** indicates statistically significant difference, ns indicates no statistically significant difference).
[0031] Figure 12 The image shows the effect of oral propionic acid on intestinal tissue inflammation in wild-type mice and ATP7B-KO disease-type mice (HE staining, scale bar = 50 μm), indicating that intestinal inflammation was reduced in the propionic acid-treated group of disease-type mice.
[0032] Figure 13 The effect of oral propionic acid on the relative expression levels of intestinal permeability-related genes (Claudin-1, Claudin-2, JAM-A, Occludin, ZO1) in wild-type mice and ATP7B-KO disease mice (QPCR results, ns indicates no statistical difference).
[0033] Figure 14This figure shows the effect of oral propionic acid on the expression of intestinal permeability-related proteins in wild-type mice and ATP7B-KO disease-prone mice (immunofluorescence staining). Figure 14 B represents the staining result with anti-closure protein-1 antibody; Figure 14 C represents the staining results of anti-closing small cyclic protein 1 antibody (scale bar = 100 μm, ns indicates no statistical difference).
[0034] Figure 15 The effect of tail vein injection of propionic acid on the distribution of liver neutrophil subsets (N1 and N2 types) in wild-type mice and ATP7B-KO disease mice (flow cytometry detection, based on CD11b⁺Ly6G⁺ cells).
[0035] Figure 16 The effect of tail vein injection of propionic acid on the distribution of liver neutrophil subsets (N1 and N2 types) in wild-type mice and ATP7B-KO disease mice (flow cytometry detection, based on CD11b⁺Ly6G⁺ cells).
[0036] Figure 17 The effect of tail vein injection of propionic acid on the distribution of liver neutrophil subsets (N1 and N2 types) in wild-type mice and ATP7B-KO disease mice (flow cytometry detection, based on CD11b⁺Ly6G⁺ cells).
[0037] Figure 18 The effect of tail vein injection of propionic acid on liver function-related biochemical indicators (alanine aminotransferase, aspartate aminotransferase, total cholesterol, high-density lipoprotein cholesterol, albumin, and total bilirubin) in wild-type mice and ATP7B-KO disease mice is shown in the figure.
[0038] Figure 19 The image shows the effects of tail vein injection of propionic acid on liver tissue inflammation and collagen deposition in wild-type mice and ATP7B-KO disease-prone mice (HE staining and Sirius red staining). Figure 19 H represents the results of HE staining of the liver, showing that liver inflammation and necrosis were reduced in the propionic acid injection group of disease-type mice; Figure 19 I represents the results of Sirius red staining of the liver, showing reduced collagen deposition in the livers of disease-prone mice in the propionic acid injection group. Detailed Implementation
[0039] The present invention will be further described below with reference to the accompanying drawings and embodiments, but this should not be construed as limiting the present invention.
[0040] Example: Propionic acid content detection and correlation analysis 1. Detection of propionic acid levels in mouse intestines and liver, and in patient serum; Six-week-old wild-type mice and ATP7B-KO disease mice, n=6 per group, were used. Fresh fecal particles or liver tissue were collected aseptically from each group (n=6) of mice, immediately frozen in liquid nitrogen, and stored at −80°C until analysis. 50–100 mg of fecal particles or liver tissue were milled with 1 mL of ultrapure water at 6.0 m / s for 2 min using a bead mill, followed by centrifugation at 12000 g for 10 min to remove particulate matter. The supernatant was acidified with 10% (v / v) phosphoric acid and derivatized with N-tert-butyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA) at 70°C for 30 min, followed by analysis by gas chromatography-mass spectrometry (GC-MS). Deuterated short-chain fatty acids (d4-acetic acid) were added for quantification normalization and recovery calibration.
[0041] For the analysis of propionic acid in the serum of the population, peripheral blood was collected from subjects (7 patients with Wilson's disease and 10 age- and sex-matched healthy individuals), the serum was separated by centrifugation, and 200 μL was used for propionic acid detection.
[0042] 2. Statistical analysis; Data were analyzed using GraphPadPrism 8.0 software. Correlation analysis was performed using Pearson's correlation coefficient. Statistically significant differences between groups were assessed using unpaired t-tests and the Mann-Whitney test. A p-value < 0.05 was considered statistically significant.
[0043] 3. Propionate was administered to mice via gavage; Six-week-old wild-type mice and ATP7B-KO disease mice were administered propionic acid at a concentration of 150 mM three times a week for 10 weeks.
[0044] 4. Inject propionic acid into the tail vein of mice; Six-week-old wild-type mice and ATP7B-KO disease mice were given propionic acid three times a week via tail vein injection at a concentration of 150 mM each time for 10 weeks.
[0045] 5. Detection of biochemical indicators in mice; Fasting blood samples were collected from mice and analyzed using a Beckman biochemical analyzer to measure the following biochemical indicators related to liver injury and liver function: alanine aminotransferase (ALT), aspartate aminotransferase (AST), total cholesterol (TChol), high-density lipoprotein cholesterol (HDL-C), albumin (Alb), and total bilirubin (TBil).
[0046] 6. Neutrophil infiltration in mouse liver; Flow cytometry was used to detect neutrophil infiltration in mouse livers. The specific method was as follows: Liver samples were homogenized in phosphate-buffered saline (PBS) through a 70-micron cell filter, followed by centrifugation at 400 rpm for 5 minutes to precipitate hepatocytes and cell debris. The supernatant rich in hepatocytes was collected and centrifuged at 1500 rpm for 5 minutes. The precipitate was resuspended in 15 mL of 35% Percoll solution and centrifuged at 2400 rpm for 5 minutes. The remaining precipitate was carefully collected and lysed with erythrocyte lysis buffer to remove erythrocytes. The cells were then washed with PBS, and finally resuspended in PBS containing 2% bovine serum albumin (BSA). Next, the cells were incubated at 4°C for 30 minutes in the dark with the following antibodies: PerCP anti-mouse / human CD11b antibody (1:100), APC anti-mouse Ly-6G antibody (0.25:100), PE anti-Nos2 (iNOS) antibody (0.5:100), and FITC anti-CD206 (MMR) antibody (0.2:100). After staining, the cells were thoroughly washed with PBS and then analyzed using a CytoFLEX LX flow cytometer (Beckman Coulter) according to standard operating procedures. Data were analyzed using CytExpert 2.4 software.
[0047] 7. Assessment of liver inflammation using HE staining of mouse liver; After routine dehydration and embedding, mouse liver tissue was sectioned to a thickness of 4 micrometers and dewaxed to water. The sections were first stained with hematoxylin for 5-10 minutes, then rinsed with running water to remove excess dye; followed by eosin staining for 1-3 minutes, and then rinsed with running water to terminate the reaction. Image acquisition was performed using a Nikon Eclipse 80i microscope.
[0048] 8. Sirius red staining of mouse liver to assess liver fibrosis; After routine dehydration and embedding, mouse liver tissue was sectioned to a thickness of 4 micrometers and dewaxed to water. The liver tissue sections were stained with Sirius red for 30 minutes and then rinsed with tap water for 3 minutes. Image acquisition was performed using a Nikon Eclipse 80i microscope. The primers used for qPCR detection of glial factor expression are as follows: Mouse type I collagen α1 chain (Col1a1): Upstream primer: GGCGGTTCAGGTCCAATG; Downstream primer: GCAATCCACGAGCACCCT; Mouse type I collagen α2 chain (Col1a2): Upstream primer: GCGGACTCTGTTGCTGCTT; Downstream primer: CCTGCGGGACCCCTTTGT; Mouse vimentin: Upstream primer: TTGAACGGAAAGTGGAATC; Downstream primer: AGGTCAGGCTTGGAAACG.
[0049] 9. Detection of intestinal inflammation in mice; Intestinal inflammation in mice was assessed using two methods: hematoxylin and eosin (HE) staining of intestinal tissue and qPCR detection of inflammatory cytokine expression. The HE staining procedure was as follows: after routine dehydration and embedding, mouse colon tissue was sectioned to a thickness of 4 micrometers and dewaxed to water. Sections were first stained with hematoxylin for 5–10 minutes, then rinsed with running water to remove excess dye; followed by eosin staining for 1–3 minutes, and then rinsed with running water to terminate the reaction. Image acquisition was performed using a Nikon Eclipse 80i microscope. The qPCR detection procedure for inflammatory cytokine expression was as follows: total RNA was extracted using TRIzol reagent, and the RNA was reverse transcribed into cDNA using HiScript II Q RT SuperMix for qPCR. qPCR analysis was performed using ChamQ Universal SYBR qPCR Master Mix on a LightCycler 480 II real-time quantitative PCR instrument (Roche). All reactions were performed in a final volume of 20 μL. The thermal cycling conditions for amplification were as follows: pre-denaturation at 95 °C for 30 seconds; followed by 50 cycles, each consisting of denaturation at 95 °C for 10 seconds and annealing extension at 60 °C for 30 seconds; finally, melting curve analysis was performed: 95 °C for 5 seconds, 65 °C for 60 seconds, and then gradually increased to 97 °C at a rate of 0.5 °C / 5 seconds. The primers used are as follows: Mouse tumor necrosis factor α (Tnfα): Upstream primer: TCTCATTCCTGCTTGTGGC; Downstream primer: CACTTGGTGGTTTGCTACG; Mouse interleukin-1β (IL-1β): Upstream primer: GTTCCCATTAGACAACTGC; Downstream primer: GATTCTTTCCTTTGAGGC; Mouse interleukin-6 (IL-6): Upstream primer: TACCACTCCCAACAGACC; Downstream primer: ATTGCCATTGCACAACTC; Mouse chemokine ligand 3 (Ccl3): Upstream primer: AGCCAGGTGTCATTTTCC; Downstream primer: GCATTCAGTTCCAGGTCA; Mouse chemokine ligand 5 (Ccl5): Upstream primer: ACCACTCCCTGCTGCTTT; Downstream primer: ACACTTGGCGGTTCCTTC.
[0050] 10. Mouse intestinal permeability detection; The expression of tight junction proteins in intestinal tissue was assessed using two methods: qPCR and immunofluorescence analysis. The immunofluorescence staining procedure for intestinal tissue was as follows: 5-micron-thick paraffin-embedded intestinal tissue sections were stained with immunofluorescence. The sections were first incubated with anti-Claudin-1 antibody (1:200, Abcam) or anti-ZO-1 antibody (1:100, ThermoFisher), followed by staining with Alexa Fluor™ 488-conjugated IgG (H+L) secondary antibody (Invitrogen). Cell nuclei were counterstained with DAPI. The qPCR procedure was the same, and the primer sequences used are as follows: Claudin-1 (mouse closure protein-1): Upstream primer: AGGTCTGGCGACATTAGTGG; Downstream primer: CGTGGTGTTGGGTAAGAGGT; Claudin-2 (mouse closure protein-2): Upstream primer: TCTACGAGGGACTGTGGATG; Downstream primer: TCAGATTCAGCAAGGAGTCG; Mouse connective adhesion molecule-A (JAM-A): Upstream primer: TCTCTTCACGTCTATGATCCTGG; Downstream primer: TTTTGATGGACTCGTTCTCGGG; Mouse ocludin: Upstream primer: TTGAAAGTCCACCTCCTTACAGA; Downstream primer: CCGGATAAAAAGAGTACGCTGG; Mouse closed small cyclic protein 1 (ZO1): Upstream primer: GCCGCTAAGAGCACAGCAA; Downstream primer: TCCCCACTCTGAAAATGAGGA.
[0051] Experimental results: 1. Propionic acid levels were negatively correlated with liver damage in diseased mice; To detect propionic acid content in the intestines and liver, intestinal feces and liver tissue were collected from wild-type and ATP7B-KO disease mice, and the propionic acid content was measured. Figure 1 and Figure 2 As shown, the propionic acid content in the liver of diseased mice was significantly reduced ( Figure 1 A). Intestinal propionic acid levels are negatively correlated with the number of infiltrating neutrophils in the liver. Figure 1 B), is negatively correlated with the number of N2 type neutrophils in the liver. Figure 1 C). Serum propionic acid levels in patients with Wilson's disease were significantly lower than in healthy controls. Figure 2 D), serum propionic acid levels were negatively correlated with ALT, a liver damage marker. Figure 2 E), serum propionic acid levels were negatively correlated with TGF-β1 levels ( Figure 2 F).
[0052] 2. Oral supplementation with propionic acid can improve liver damage, inflammation, and fibrosis in diseased mice; Wild-type and ATP7B-KO disease mice were exogenously supplemented with propionic acid via gavage, and changes in liver damage, inflammation, and fibrosis were examined. Figures 3-8 As shown, propionic acid supplementation can reduce the body weight of diseased mice ( Figure 3 A) Liver index ( Figure 3 B), alanine aminotransferase ( Figure 4 C), Aspartate aminotransferase ( Figure 4 D), serum total bilirubin ( Figure 6 H); increased total cholesterol in diseased mice ( Figure 5 E), High-density lipoprotein cholesterol (HDL-C) Figure 5 F), albumin ( Figure 6 G). HE staining results of liver tissue showed that propionic acid supplementation could reduce liver inflammation and necrosis in diseased mice. Figure 7 I). Sirius red staining results of liver tissue showed that propionic acid supplementation could reduce collagen formation in the liver of diseased mice (I). Figure 7 J). QPCR results from liver tissue showed that propionic acid supplementation reduced the expression of collagen formation-related genes in the liver tissue of diseased mice, including type I collagen α1 chain gene, type I collagen α2 chain gene, and vimentin gene (J). Figure 8Flow cytometry analysis of mouse liver neutrophils showed that propionic acid supplementation reduced the number of CD11b+Ly6G+ neutrophils in the livers of diseased mice (see [link]). Figure 9 and Figure 10 B), while simultaneously reducing the number of CD11b+Ly6G+CD206+ N2 type neutrophils in the liver of diseased mice (see B). Figure 9 and Figure 10 C).
[0053] 3. Oral supplementation with propionic acid can reduce intestinal inflammation in diseased mice; Wild-type and ATP7B-KO disease mice were orally supplemented with propionic acid exogenously, and their intestinal inflammation was assessed. Figure 4 As shown, oral propionic acid can reduce the expression of tumor necrosis factor α, interleukin-1β, interleukin-6, chemokine ligand 3, and chemokine ligand 5 in the liver of diseased mice. HE staining of intestinal tissue showed that oral propionic acid can reduce intestinal inflammation in diseased mice. Figure 12 ).
[0054] 4. Oral supplementation with propionic acid had no effect on intestinal permeability in diseased mice; Wild-type and ATP7B-KO disease mice were orally supplemented with propionic acid exogenously, and their intestinal permeability was assessed. Figure 13 As shown, oral propionic acid did not affect the expression of intestinal permeability-related genes such as closure protein-1, closure protein-2, adhesion molecule A, closure cyclic protein, and closure cyclic protein 1 in diseased mice. Immunofluorescence staining results of intestinal tissue with anti-closure protein-1 and anti-closure cyclic protein 1 antibodies showed that oral propionic acid did not affect the expression of intestinal permeability proteins in diseased mice. Figure 14 B and Figure 14 C).
[0055] 5. Tail vein injection of propionic acid can improve liver damage, inflammation, and fibrosis in diseased mice; To further evaluate the effects of intravenous propionic acid on wild-type mice and ATP7B-KO disease mice, such as Figure 15 As shown, tail vein injection (TVI) of propionic acid significantly reduced the number of infiltrating neutrophils and N2-type neutrophils in the liver of diseased mice (see [link]). Figure 15 and Figure 16 Tail vein injection of propionic acid reduced body weight and liver index in diseased mice (see figure). Figure 17 D, E). In diseased mice, serum transforming growth factor-β1 levels decreased significantly after intravenous injection of propionic acid via the tail vein. Figure 17F). Liver function and liver injury markers, including cytosine aminotransferase (CMT), aspartate aminotransferase (AST), total cholesterol (TChol), high-density lipoprotein cholesterol (HDL-C), albumin, and total bilirubin, were significantly improved after intravenous injection of propionic acid in diseased mice (18). HE staining of liver tissue showed that intravenous injection of propionic acid significantly reduced liver inflammation and necrosis in diseased mice (F). Figure 19 H), Sirius red staining of liver tissue showed that tail vein injection of propionic acid significantly reduced collagen deposition in diseased mice (H). Figure 19 I).
[0056] Based on the aforementioned therapeutic effects, propionic acid can be combined with pharmaceutically acceptable carriers to prepare drug compositions in various dosage forms. For example: Oral preparations: Propionic acid or its salts can be mixed with fillers, disintegrants, lubricants, etc., to form tablets, capsules or granules.
[0057] Injectable preparations: Sodium propionate or potassium propionate can be dissolved in water for injection, adjusted to a suitable pH and osmotic pressure, and then filtered to remove bacteria to prepare an intravenous injection.
[0058] The "therapeutic effective dose" can be determined through routine experiments based on the patient's age, weight, and severity of illness, for example, by referring to the dosage in animal experiments for conversion.
[0059] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.
Claims
1. Application of propionic acid in the preparation of drugs for treating Wilson's disease and enterohepatic axis disorders.
2. The application according to claim 1, characterized in that, The drug is used to improve liver damage caused by Wilson's disease.
3. The application according to claim 2, characterized in that, The improvement in liver damage is manifested in one or more of the following: reducing serum alanine aminotransferase levels, reducing serum aspartate aminotransferase levels, reducing serum total bilirubin levels, increasing serum albumin levels, and reducing liver inflammation and necrosis.
4. The application according to claim 1, characterized in that, The drug is used to improve liver inflammation and fibrosis in Wilson's disease.
5. The application according to claim 4, characterized in that, The improvement in liver inflammation and fibrosis is manifested in one or more of the following: reducing neutrophil infiltration in the liver, reducing gene expression of type I collagen and vimentin in liver tissue, and reducing collagen deposition in the liver.
6. The application according to claim 1, characterized in that, The drug is used to reduce intestinal inflammation associated with Wilson's disease.
7. The application according to claim 6, characterized in that, The reduction in intestinal inflammation is manifested by decreasing the gene expression levels of tumor necrosis factor-α, interleukin-1β, interleukin-6, chemokine ligand 3, and chemokine ligand 5 in intestinal tissue.
8. The application according to any one of claims 1 to 7, characterized in that, The drug can be administered orally or intravenously.
9. The application according to claim 8, characterized in that, The oral administration is administered via gavage.
10. A pharmaceutical composition, characterized in that, It contains a therapeutically effective amount of propionic acid as the active ingredient, as well as a pharmaceutically acceptable carrier, for improving the function of the gut-liver axis in Wilson's disease.
Citation Information
Patent Citations
New application of algin in treatment of hepatolenticular degeneration
CN113440539A
Hepatolenticular degenerative cells, and preparation method and evaluation method thereof
CN115491346A
Application of methylation inhibitor in preparation of medicine for improving symptoms of hepatolenticular degeneration disease
CN115804786A
GPR52 modulator compounds
CN116507622A
USE OF PROPIONIC ACID, BUTYRIC ACID AND THEIR DERIVATIVES IN THE TREATMENT OF HEPCIDIN DEFICIENCY AND THEIR CONSEQUENCES
FR3051115A1