Application of isolorydine hydrochloride in preparation of antiviral drugs
Isochlordine hydrochloride was used to prepare an anti-porcine epidemic diarrhea virus (PEDV) drug. By testing its cytotoxicity and antiviral effects at different concentrations, the problem of the lack of effective anti-PEDV drugs in the existing technology was solved, and significant inhibitory and therapeutic effects on PEDV were achieved.
Patent Information
- Application Number
- CN202511611430.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-05
- Publication Date
- 2026-01-13
AI Technical Summary
The lack of effective drugs against porcine epidemic diarrhea virus (PEDV) in the current technology leads to high mortality and economic losses, especially posing a serious threat of infection to newborn piglets.
Isochlordine hydrochloride was used as the active ingredient to prepare an anti-porcine epidemic diarrhea virus (PEDV) drug. By testing its cytotoxicity and antiviral effects at different concentrations, it was found that it was non-toxic to Vero cells at 100 μM and could significantly reduce the mRNA level and protein expression of PEDV N.
Isochlordine hydrochloride has shown a significant inhibitory effect on PEDV, and is reliable in efficacy, has no toxic side effects, is abundant in resources and inexpensive, and can effectively prevent and treat porcine epidemic diarrhea.
Smart Images
Figure CN121313640A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the application of isoquinoline alkaloid - isocoridine hydrochloride in the preparation of drugs against porcine epidemic diarrhea virus, which belongs to the field of biomedical technology. Background Technology
[0002] Porcine Epidemic Diarrhea Virus (PEDV) is a single-stranded positive-sense RNA virus belonging to the order Nidovirales, family Coronaviridae, and genus Alphacoronavirus. PEDV was first discovered in the UK in 1971 and subsequently spread to other European countries such as Belgium and the Netherlands. Since 1980, PEDV began to circulate in Asian countries but did not pose a serious threat to the pig farming industry until 2010, when a variant strain of PEDV broke out in southern my country and spread rapidly, causing a nationwide outbreak of epidemic diarrhea in pig farms and inflicting devastating damage on China's pig farming industry. To date, PEDV remains the main pathogen causing porcine epidemic diarrhea in my country. This virus is highly contagious and primarily transmitted via the fecal-oral route. Infected pigs exhibit symptoms such as diarrhea, vomiting, lethargy, and anorexia. Pigs of all ages can be infected, but the severity varies. Weaned piglets and growing-finishing pigs show milder symptoms. Infection in adult sows can affect reproductive performance, while the mortality rate for piglets under one week old can be as high as 90%. Porcine epidemic diarrhea (PED) has severely hampered the healthy development of my country's pig industry and caused enormous economic losses to pig farming worldwide.
[0003] After oral ingestion, PEDV primarily infects the middle jejunum and ileum, with the jejunum being more susceptible. The villous intestinal cells of the large intestine are also frequently infected. PEDV infection leads to the destruction, atrophy, shortening, and shedding of intestinal villous epithelial cells; disruption of tight junctions; reduction of mucin; decrease in intestinal goblet cells; loss of mucus secretion function; and reduced resistance to pathogens. This, in turn, affects the expression and function of some enzymes, further impacting the small intestine's breakdown and absorption of nutrients, causing osmotic imbalance, and leading to water flowing from the tissues into the intestinal lumen, ultimately resulting in osmotic diarrhea. The slow turnover rate of intestinal villi cells in piglets under one week old, the even later proliferation of intestinal hepatocytes and crypt cells, and the immature innate immune function are the main reasons for the high mortality rate in newborn piglets.
[0004] Isocoridine, also known as isocoridine or isocorine alkaloid, is an isoquinoline alkaloid extracted from the Menispermaceae plant *Eriocaulon buergerianum*. The isocoridine hydrochloride involved in this invention is the hydrochloride form of isocoridine. Studies have reported that isocoridine possesses anti-hemorrhagic shock, antiarrhythmic, antitumor, and antispasmodic effects. There are currently no reports on its antiviral effects.
[0005] 1. Kocherhans R, Bridgen A, Ackermann M, Tobler K: Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence. Virus Genes 2001, 23(2):137-144.
[0006] 2. Li W, van Kuppeveld FJM, He Q, Rottier PJM, Bosch BJ: Cellularentry of the porcine epidemic diarrhea virus. Virus Res 2016, 226:117-127.
[0007] 3. Zhang H, Zou C, Peng O, Ashraf U, Xu Q, Gong L, Fan B, Zhang Y, XuZ, Xue C et al : Global Dynamics of Porcine Enteric Coronavirus PEDVEpidemiology, Evolution, and Transmission. Mol Biol Evol 2023, 40(3).
[0008] 4. Li Wan: Construction of infectious clones of porcine epidemic diarrhea virus and research on its antiviral drugs and vaccines. PhD Virus Res 2022. 5. Jung K, Saif LJ, Wang Q: Porcine epidemic diarrhea virus (PEDV): An update on etiology, transmission, pathogenesis, and prevention and control. Vet Med Rep 2020, 286:198045. 6. Liu Ruiling, Li Yuchen, Tang Rongfeng, Yang Qian: Preliminary analysis of the effects and mechanisms of porcine epidemic diarrhea virus infection on small intestinal goblet cells. Int J Mol Sci 2025, 56(02):900-911.
[0009] 7.Tu Y, Li Figure 1 2023, 24(5). Summary of the Invention
[0010] This invention relates to a novel use of isocoridine hydrochloride in pharmaceutical preparation, primarily in the preparation of drugs against porcine epidemic diarrhea virus.
[0011] The technical solution of this invention is: the application of isocoridine hydrochloride in the preparation of antiviral drugs, wherein the structural formula of isocoridine hydrochloride is as follows:
[0012]
[0013] The structural formula of isocoridine hydrochloride.
[0014] Furthermore, the drug is used to treat and / or prevent porcine epidemic diarrhea caused by viral infection.
[0015] Furthermore, the virus is porcine epidemic diarrhea virus.
[0016] The beneficial effects of this invention are as follows: This invention reveals for the first time its antiviral activity, especially against PEDV. In PEDV-infected Vero cells, 100 μM isocoridine hydrochloride showed no toxicity, with an IC50 of 6.78 μM. In host cells IPEC-LD (cells obtained by limiting dilution and monoclonal culture of IPEC-J2 small intestinal epithelial cells, which significantly increased susceptibility to PEDV compared to IPEC-J2), isocoridine hydrochloride showed no toxicity at 100 μM, exhibited slight toxicity at 200 μM, and 5 μM isocoridine hydrochloride significantly reduced PEDV N mRNA levels, while 10 μM isocoridine hydrochloride significantly inhibited PEDV N protein expression.
[0017] This invention relates to the use of the above-mentioned compounds to prepare drugs against swine epidemic diarrhea virus, which have the advantages of reliable efficacy, no toxic side effects, abundant resources, and low price. Attached Figure Description
[0018] Figure 2 This is a schematic diagram of PEDV infection of Vero cells and the cytopathic effect of isocoridine hydrochloride.
[0019] Figure 3 This study investigated the effects of different concentrations of isocoridine hydrochloride on the survival rate of Vero cells.
[0020] Figure 4 It is the half-maximal inhibitory concentration (IC50) of isocoridine hydrochloride for inhibiting PEDV infection. 50 )curve.
[0021] Figure 5 This is an immunofluorescence verification of the anti-PEDV effect of isocoridine hydrochloride in Vero cells.
[0022] Figure 6 The effect of different concentrations of isocoridine hydrochloride on the survival rate of IPEC-LD cells.
[0023] Figure 7 The study used qPCR to detect the inhibitory effect of isocoridine hydrochloride on PEDV replication and proliferation in IPEC-LD cells.
[0024] Figure 8 This refers to the inhibitory effect of isocoridine hydrochloride on PEDV N protein expression in IPEC-LD cells.
[0025] Figure 1 This is an immunofluorescence verification of the anti-PEDV effect of isocoridine hydrochloride in IPEC-LD cells. Detailed Implementation
[0026] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will now be described in detail with reference to the accompanying drawings and embodiments.
[0027] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the present invention or its application or use.
[0028] Example 1
[0029] 1. Medicines and reagents:
[0030] The isocoridine hydrochloride involved in this invention was purchased from Shanghai Taoshu Biotechnology Co., Ltd. (Shanghai, China) with a purity exceeding 99% as determined by HPLC. The compound was dissolved in dimethyl sulfoxide (DMSO) as a stock solution with a concentration of 50 mM. During experiments, it was diluted to the working concentration using MEM (Vero cells) containing 16 μg / mL trypsin or DMEM (IPEC-LD cells) containing 4 μg / mL trypsin. DMEM, MEM, and fetal bovine serum (FBS) were all purchased from Gibco Reagents, Inc., USA. PEDV N antibody was purchased from Alpha Diagnostic Intl Inc (#PEDV12-F), and GAPDH antibody was purchased from Affinity (#AF7021). The primer sequences for PEDV N were F: GGAGAATTCCCAAGGGCGAA, R: ATCTGAGCATAGCCTGACGC, and the primer sequences for GAPDH were F: TCGGAGTGAACGGATTTGGC, R: TGACAAGCTTCCCGTTCTCC.
[0031] 2. Cytotoxicity assay of isocoridine hydrochloride:
[0032] Cells at 1 10 4 100 μL (Vero) per well and 5 10 3 The cells were seeded at a density of 100 μL (IPEC-LD) per well into 96-well plates and cultured until the cell density reached 80% before starting the experiment.
[0033] Discard the cell culture medium from each well and use 1 Wash twice with PBS solution. Dilute the drug to final concentrations of 100 μM, 50 μM, 25 μM, 12.5 μM, 6.25 μM, and 3.13 μM using maintenance medium (MEM containing 16 μg / mL trypsin or DMEM containing 4 μg / mL trypsin). Also include blank control wells (containing maintenance medium without the drug). Five parallel wells were set up for each concentration. The solutions were incubated in a CO2 incubator at 37 °C with 5% CO2.
[0034] After culturing cells for 24 hours, remove the culture plate, discard the drug solution, and then use 1 After washing twice with PBS, 100 μL of maintenance medium containing 10% CCK-8 solution was added to each well. The culture plate was placed in a CO2 incubator and cultured for another 2 h. The absorbance of each well under 450 nm excitation light was measured using a microplate reader. Cell viability was calculated according to the CCK-8 kit instructions. The calculation method was: Cell viability (%) = Absorbance value of drug group cells / Absorbance value of blank control group cells. 100%.
[0035] Figure 2 This diagram illustrates the cytopathic effects of PEDV infection on Vero cells and the effects of isocoridine hydrochloride on cell lesions. The results show: In the Ctrl group (control group): cells exhibited epithelial-like morphology, growing in a dense, reticular pattern, with regular morphology and uniform distribution, representing a normal, undisturbed cell state. In the PEDV group (swine epidemic diarrhea virus infection group): cells showed significant cytopathic effects, specifically localized fusion of cells to form syncytiomes, partial cell detachment, and morphological disorder, indicating that viral infection severely damaged cell structure and growth. Icd HCl (50 μM) group (isoclidine hydrochloride treatment group): The cell morphology was similar to that of the Ctrl group, with reticular adherent growth and significantly reduced disorder and shedding, suggesting that 50 μM isocoridine hydrochloride has an inhibitory effect on PEDV infection and can alleviate viral damage to cells.
[0036] Figure 3 The study investigated the effect of different concentrations of isocoridine hydrochloride on the survival rate of Vero cells. The results showed that the cell survival rate in each concentration group was close to 100%, and there was no significant difference compared with the control group. This indicates that the drug has no obvious toxicity to cells in the concentration range of 3.13~100 μM and has good cell compatibility.
[0037] Example 2: Half-maximal inhibitory concentration (IC50) of isocoridine hydrochloride against PEDV in Vero cells 50 ) Measurement
[0038] 2.1 Vero cells were loaded with 1 10 4 The cells were seeded at a density of 100 μL per well in a 96-well plate and cultured until the cell density reached 80% before starting the experiment.
[0039] 2.2 Discard the cell culture supernatant and use 1 Wash twice with PBS solution, add 150 μL of maintenance medium containing live PEDV virus (MOI = 0.1), then add 50 μL of drug solutions of different concentrations. At the same time, uninfected normal cells are set up as blank control group and virus control group without drug treatment. Five parallel wells are set up for each concentration. Infect the cells in a CO2 constant temperature incubator at 37 ℃ with 5% CO2.
[0040] 2.3 When the virus-producing cells showed large-scale confluence or detachment, the culture medium was aspirated, and 100 μL of maintenance medium containing 10% CCK-8 solution was added to each well. The culture plate was then placed in a CO2 incubator and cultured for another 2 h. The absorbance of each well under 450 nm excitation light was measured using a microplate reader. The cell viability of each group was calculated according to the CCK-8 kit instructions. Simultaneously, the IC50 of the drug was calculated using Graphpad 8.0 software. 50 .
[0041] Figure 4 It is the half-maximal inhibitory concentration (IC50) of isocoridine hydrochloride for inhibiting PEDV infection. 50 The curve shows the IC. 50 The value is 6.78 μM.
[0042] Example 3: Immunofluorescence detection of PEDV inhibition by isocoridine hydrochloride in Vero cells
[0043] 3.2 Vero cells were loaded at 5 10 5 The cells were seeded at a density of 1 mL per well into 12-well plates containing the spreader and cultured until the cell density reached 80% before starting the experiment.
[0044] 3.2 Perform virus inoculation and drug treatment according to the method described in 2.2 above, with three parallel wells in each group;
[0045] 3.3 After culturing cells for 12 h, discard the culture medium and use 1 Cells were washed twice with PBS. A suitable amount of 4% paraformaldehyde solution was added for fixation at room temperature for 15 min. Cells were washed three more times with PBS. Cells were permeabilized and blocked at 37°C for 1.5 h with 3% BSA solution containing 0.1% Triton X-100. Then, primary antibody (anti-PEDV N protein monoclonal antibody, 1:500) diluted with 3% BSA / PBS was added and incubated overnight in a humidified chamber at 4°C. The next day, after returning to room temperature, cells were washed three times with PBS, and then fluorescent secondary antibody (Alexa Fluor 488-labeled goat anti-mouse IgG, 1:500) was added and incubated at room temperature for 1 hour in the dark. After washing three times with PBS, cells were incubated with DAPI solution in the dark. The slides were then removed, mounted with anti-quenching mounting medium, and images were acquired using a fluorescence microscope within 24 hours.
[0046] Figure 5 This is an immunofluorescence verification of the anti-PEDV effect of isocoridine hydrochloride in Vero cells. This set of experiments, through immunofluorescence and quantitative analysis, showed that isocoridine hydrochloride (Icd) has anti-PEDV activity. HCl can dose-dependently inhibit the expression of porcine epidemic diarrhea virus (PEDV) N protein. As the drug concentration increases from 5 μM to 80 μM, the fluorescence intensity of the viral N protein decreases significantly.
[0047] Example 4: Real-time quantitative PCR (qPCR) detection of the inhibitory effect of isocoridine hydrochloride on PEDV replication and proliferation in IPEC-LD cells.
[0048] 4.1 IPEC-LD cells were prepared at 2... 10 5 The cells were seeded at a density of 1 mL per well in a 12-well plate and cultured until the cell density reached 80% before starting the experiment.
[0049] 4.2 Discard the cell culture supernatant and use 1 Wash twice with PBS solution, add 500 μL of maintenance medium containing live PEDV virus (MOI = 50) to infect cells, and after 2 h of infection, discard the virus solution and wash twice with PBS solution. Unadsorbed virus was washed away with PBS, and then drug solutions of different concentrations (80 μM, 40 μM, 20 μM, 10 μM and 5 μM) were added. Uninfected normal cells were set up as a blank control group and a virus control group without drug treatment. Each concentration was set up in 6 replicates. The culture plate was placed in an incubator of 5% CO2 at 37 ℃ for further culture.
[0050] 4.3 After culturing for another 12 hours, remove the culture plate, add 1 mL of trizol reagent to each well, and extract total RNA from the cells according to the trizol method.
[0051] 4.4 After determining the RNA concentration, reverse the RNA sample according to the instructions of the reverse transcription reagent to obtain cDNA solution, and store it at -20 ℃ for later use.
[0052] 4.5 The expression levels of PEDV N gene and internal reference gene GAPDH were detected and calculated by qPCR to investigate the inhibitory effect of the drug on PEDV replication and proliferation.
[0053] Figure 6 The study investigated the effect of different concentrations of isocoridine hydrochloride on the survival rate of IPEC-LD cells. The results showed that within the concentration range of 6.25–100 μM, the drug had no significant toxicity to the cells, and the cell survival rate was close to 100%. When the concentration reached 200 μM, the cell survival rate decreased slightly, indicating that the drug has good cell compatibility in the 6.25–100 μM range.
[0054] Figure 7The inhibitory effect of isocoridine hydrochloride on PEDV replication and proliferation in IPEC-LD cells was detected by qPCR. As the drug concentration increased from 5 μM to 80 μM, the relative expression level of PEDV-N mRNA decreased significantly in a dose-dependent manner, and there were highly statistically significant differences between each drug concentration group and the PEDV infection group. The concentration of PEDV N gene is <0.0001, indicating that the drug can effectively inhibit the transcription of PEDV N gene, thereby hindering viral replication, and the inhibitory effect increases with increasing concentration.
[0055] Example 5: Western Blot analysis of the effect of isocoridine hydrochloride on PEDV protein expression in IPEC-LD cells
[0056] 5.1 IPEC-LD cells were loaded at 5... 10 6 Seeds were placed at a density of 3 mL per well into 6 cm culture dishes. Experiments were started when the cell density reached 80%.
[0057] 5.2 Perform virus inoculation and drug treatment according to the method described in 4.2 above;
[0058] 5.3 After culturing cells for 12 h, discard the culture medium and use 1 Wash the cells twice with PBS. Then, add 1... PBS was used to collect cells using a cell scraper, and the cell suspension was transferred to centrifuge tubes and incubated at 4°C for 1000 ml. Centrifuge for 5 min at 50°C and discard the supernatant. Add RIPA lysis buffer containing protease inhibitors to the cell pellet and lyse on ice for 30 min. After lysis, centrifuge and collect the supernatant. Determine protein concentration using the BCA method. Based on the results, equalize the protein concentration of each sample using lysis buffer. Then add 5g of RIPA lysis buffer. After mixing the SDS-PAGE protein loading buffer, boil at 100°C for 10 min to denature the protein. The prepared protein sample can be stored at -80°C or directly analyzed by Western blotting.
[0059] Figure 8 This refers to the inhibitory effect of isocoridine hydrochloride on PEDV N protein expression in IPEC-LD cells. (Icd) Isocoridine hydrochloride (HCl) can inhibit the expression of porcine epidemic diarrhea virus (PEDV) N protein in a concentration-dependent manner. As the drug concentration increased from 5 μM to 80 μM, the PEDV-N protein band gradually became lighter and the relative expression level decreased significantly, thus demonstrating the inhibitory activity of isocoridine hydrochloride on PEDV replication at the protein level.
[0060] Example 6: Immunofluorescence detection of PEDV inhibition in IPEC-LD cells by isocoridine hydrochloride
[0061] 6.1 IPEC-LD cells were prepared at 2... 10 5 The cells were seeded at a density of 1 mL / well into 12-well plates containing the spreader slides. The experiment was started when the cell density reached 80%.
[0062] 6.2 Perform virus inoculation and drug treatment according to the method described in 4.2 above;
[0063] 6.3 After culturing cells for 24 h, discard the culture medium and use 1 Cells were washed twice with PBS. A suitable amount of 4% paraformaldehyde solution was added for fixation at room temperature for 15 min. Cells were washed three more times with PBS. Cells were permeabilized and blocked at 37°C for 1.5 h with 3% BSA solution containing 0.1% Triton X-100. Then, primary antibody (anti-PEDV N protein monoclonal antibody, 1:500) diluted with 3% BSA / PBS was added and incubated overnight in a humidified chamber at 4°C. The next day, after returning to room temperature, cells were washed three times with PBS, and then fluorescent secondary antibody (Alexa Fluor 488-labeled goat anti-mouse IgG, 1:500) was added and incubated at room temperature for 1 hour in the dark. After washing three times with PBS, cells were incubated with DAPI solution in the dark. The slides were then removed, mounted with anti-quenching mounting medium, and images were acquired using a fluorescence microscope within 24 hours.
[0064] This is an immunofluorescence assay of the anti-PEDV effect of isocoridine hydrochloride in IPEC-LD cells. The results show that isocoridine hydrochloride (Icd) has the following effect: Isoclamide hydrochloride (HCl) can dose-dependently inhibit the expression of porcine epidemic diarrhea virus (PEDV) N protein. As the drug concentration increased from 5 μM to 80 μM, the fluorescence intensity of the viral N protein decreased significantly, thus providing intuitive and quantitative evidence at the protein level of the inhibitory activity of isocoridine hydrochloride on PEDV replication.
[0065] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. The application of isocoridine hydrochloride in the preparation of antiviral drugs, characterized in that: The structural formula of isocoridine hydrochloride is as follows: 。 2. The application according to claim 1, characterized in that: The drug is used to treat and / or prevent porcine epidemic diarrhea caused by viral infection.
3. The application according to claim 1 or 2, characterized in that: The virus in question is porcine epidemic diarrhea virus.