Endophytic fungus Perconia macrospinosa F35 of Artemisia macrorrhiza, and fermentation product and application of endophytic fungus Perconia macrospinosa F35 of Artemisia macrorrhiza
The fermentation of unsaturated cyclic compounds by the endophytic fungus Periconia macrospinosa F35 solves the problems of limited types of existing anti-inflammatory drugs and high energy consumption in chemical synthesis, and realizes low-cost, environmentally friendly production of anti-inflammatory drugs with significant anti-inflammatory effects.
Patent Information
- Application Number
- CN202511412289.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2026-01-13
AI Technical Summary
The types of existing anti-inflammatory drugs are limited, and their chemical synthesis is energy-intensive and highly polluting, making it difficult to meet the treatment needs of different types of inflammation.
Unsaturated cyclic compounds dichloroisocoumarin and dichlorocyclopentene derivatives were produced by fermentation using the endophytic fungus Periconia macrospinosa F35. The target compounds were obtained by fermentation in liquid or solid culture media, extraction with organic solvents, and separation and purification by high performance liquid chromatography.
Low-cost and environmentally friendly compound production has been achieved. The compound exhibits significant anti-inflammatory activity and can effectively reduce the expression of the inflammatory factor NO, showing broad application prospects as an anti-inflammatory drug.
Smart Images
Figure CN121320106A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biotechnology, and in particular to an endophytic fungus, Periconia macrospinosa F35, of the halophila fern, its fermentation products, and its applications. Background Technology
[0002] Inflammation is a core pathological link in the development of many diseases, representing a defensive response of the body's tissues to various damaging factors, including physical, chemical, and biological agents. This process relies on the coordinated participation of vasodilation, fluid exudation, and immune cells (such as macrophages and neutrophils). On the one hand, it can maintain homeostasis by clearing inflammatory factors and promoting damage repair. On the other hand, if the inflammatory response becomes uncontrolled (e.g., due to the continuous accumulation of inflammatory factors or an imbalance in repair mechanisms), it can lead to cell degeneration, tissue necrosis, and even organ dysfunction. This uncontrolled inflammatory response not only severely disrupts people's normal lives but can also pose a threat to life.
[0003] However, the current selection of commonly used anti-inflammatory drugs in clinical practice is limited, making it difficult to fully meet the treatment needs of different types of inflammation. There is an urgent need to develop more types of anti-inflammatory drugs to enrich clinical treatment options. In the preparation of active ingredients in anti-inflammatory drugs, the fermentation production of compounds by bacterial strains is gradually becoming an important direction. This is related to the limitations of traditional chemical synthesis: chemical synthesis processes often require harsh reaction conditions such as high temperature, high pressure, or strong acids and alkalis, which are not only energy-intensive and polluting, but may also produce cytotoxic byproducts, increasing the difficulty and safety risks of subsequent drug purification. In contrast, bacterial strains can efficiently synthesize target compounds under mild culture conditions, which is not only energy-efficient and environmentally friendly, but also reduces byproduct formation and improves product purity and activity. In addition, bacterial strains have short culture cycles and can be used for large-scale fermentation production, effectively reducing drug production costs and making it easier to meet the large-scale clinical demand for anti-inflammatory drugs. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to overcome the shortcomings and deficiencies of the limited types of existing anti-inflammatory drugs and the high energy consumption and pollution of chemical synthesis, and to provide an endophytic fungus of *Pteris vittata*.
[0005] Another object of the present invention is to provide the application of the aforementioned endophytic fungus of *Haloxylon ammodendron* in the preparation of anti-inflammatory compounds.
[0006] Another object of the present invention is to provide a class of unsaturated cyclic compounds.
[0007] Another object of the present invention is to provide a method for preparing the aforementioned unsaturated cyclic compounds.
[0008] Another object of the present invention is to provide the use of the aforementioned unsaturated cyclic compounds in the preparation of anti-inflammatory drugs.
[0009] Another object of the present invention is to provide a pharmaceutical composition.
[0010] The above-mentioned objective of this invention is achieved through the following technical solution:
[0011] This invention protects an endophytic fungus of *Periconia macrospinosa*, named *Periconia macrospinosa* F53, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on December 16, 2024, with accession number GDMCC No. 65649.
[0012] This invention protects the use of the aforementioned endophytic fungus *Haloxylon ammodendron* in the preparation of anti-inflammatory compounds.
[0013] Furthermore, the anti-inflammatory compound has one or two of the following structures:
[0014]
[0015] This invention provides an endophytic fungus, Periconia macrospinosa F35, which can ferment to produce compounds with unique structures, namely dichloroisocoumarin and dichlorocyclopentene derivatives, making it an ideal carrier for developing novel natural drugs.
[0016] This invention protects a class of unsaturated cyclic compounds having any of the following structures:
[0017]
[0018] The present invention protects the preparation method of the aforementioned unsaturated cyclic compound, which isolates and purifies the target compound, namely dichloroisocoumarin and / or dichlorocyclopentene derivative, from the fermentation product of the aforementioned endophytic fungus Periconia macrospinosa F35.
[0019] Furthermore, the preparation method specifically includes the following steps:
[0020] The aforementioned endophytic fungus Periconia macrospinosa F53 was cultured on a large scale to obtain fermentation products. The obtained fermentation products were extracted with organic solvents to obtain extracts. The extracts were then separated and purified by silica gel column chromatography and high performance liquid chromatography to obtain the target compounds, namely dichloroisocoumarin and / or dichlorocycloolefin derivatives.
[0021] The present invention provides a simple and quick method for producing dichloroisocoumarin and dichlorocyclopentene derivatives by fermentation with the endophytic fungus Periconia macrospinosa F35. The method is derived from metabolites of natural drugs, is low-cost, energy-saving, and environmentally friendly, and is suitable for large-scale production of dichloroisocoumarin and dichlorocyclopentene derivatives.
[0022] Furthermore, the expanded culture is a liquid culture or a solid culture.
[0023] Furthermore, the culture medium for liquid culture is potato glucose liquid medium.
[0024] Preferably, the potato glucose liquid culture medium can be obtained commercially or homemade.
[0025] More preferably, the potato glucose liquid culture medium comprises 100 g / L potato, 20 g / L glucose, 25 g / L crude sea salt and water.
[0026] Furthermore, as a preferred embodiment, the method for preparing the potato glucose liquid culture medium includes the following steps:
[0027] Take 100g of commercially available potatoes, peel and cut them into chunks. Add 1000mL of water and boil for 30 minutes. Filter through 8 layers of gauze to obtain the supernatant. Add 20g of glucose and 25g of coarse sea salt to the supernatant, stir until completely dissolved, and then bring the volume to 1000mL. Dispense 500mL into 1000mL Erlenmeyer flasks, plug each flask with cotton, and seal the mouth of the flask with kraft paper. Sterilize in an autoclave at 115℃ for 30 minutes, and then cool to obtain the potato glucose liquid culture medium.
[0028] Furthermore, the culture medium for the solid culture is rice solid culture medium.
[0029] Preferably, the rice solid culture medium can be obtained commercially or homemade.
[0030] More preferably, the rice solid culture medium comprises 50g / 60mL of rice, 1.5g / 60mL of crude sea salt, and water.
[0031] Furthermore, as a preferred embodiment, the method for preparing the rice solid culture medium includes the following steps:
[0032] Using 480mL tissue culture glass bottles, add 50g of rice and 60mL of 2.5% crude sea salt solution to each bottle, shake until level, add the bottle cap (leaving a 2-3cm breathable membrane on the cap), sterilize in an autoclave at 121℃ for 20 minutes, and cool to obtain the rice solid culture medium.
[0033] Furthermore, when the expanded culture is a liquid culture, the preparation method specifically includes the following steps:
[0034] S1. The endophytic fungus Periconia macrospinosa F53 of the halophila fern was cultured on a large scale to obtain the fermentation product;
[0035] S2. The fermentation product obtained in step S1 is subjected to solid-liquid separation. The liquid phase is extracted with a first organic solvent, and the solid phase is extracted with a second organic solvent. The extract and the extract are collected separately. The extract and the extract are combined after removing the organic solvent to obtain the extract. The obtained extract is separated by gradient elution using silica gel column chromatography. The eluent is an ethyl acetate-petroleum ether solution with a volume ratio of 1:20. The eluted components are collected and purified by high performance liquid chromatography to obtain the target compound, namely dichloroisocoumarin and / or dichlorocycloolefin derivatives.
[0036] Preferably, the first organic solvent is ethyl acetate and / or chloroform;
[0037] Preferably, the second organic solvent is methanol and / or chloroform.
[0038] Furthermore, the preparation method of the present invention can distinguish between two unsaturated cyclic compounds with different structures by the elution order of chromatographic peaks. Since the elution times are different, the components corresponding to each chromatographic peak can be collected separately within a certain retention time range, and then the structure of the obtained components can be confirmed by nuclear magnetic resonance technology.
[0039] Furthermore, the silicone column is a regular glass column.
[0040] Furthermore, the specifications of the ordinary glass column are: inner diameter 60mm and length 1000mm.
[0041] Preferably, the silica gel column has a silica gel mesh size of 200 to 300 mesh.
[0042] Furthermore, the chromatographic column used in the high-performance liquid chromatography is a semi-preparative C-18 reversed silica column.
[0043] Furthermore, the semi-prepared C-18 reverse silicone column has dimensions of 250mm × 10mm and 5μm.
[0044] Preferably, the detection wavelength for the semi-prepared C-18 reverse silicone column is 254nm or 365nm.
[0045] Preferably, the expanded culture is a static culture or a shaking culture.
[0046] More preferably, the temperature for static culture and shaking culture is 25–28°C.
[0047] More preferably, the static culture time is 25 to 35 days.
[0048] More preferably, the shaking culture time is 10 to 20 days.
[0049] More preferably, the shaking rotation speed is 150-250 rpm.
[0050] Preferably, the volume ratio of the liquid phase to the first organic solvent is 1:(1-3).
[0051] Preferably, the mass-to-volume ratio of the solid phase and the second organic solvent is 1 g: (1-3) mL.
[0052] Furthermore, the solvent system for the high-performance liquid chromatography is acetonitrile and water.
[0053] Furthermore, the volume ratio of acetonitrile to water is 1:(0.1 to 0.2).
[0054] Furthermore, when the expanded culture is a solid culture, the preparation method specifically includes the following steps:
[0055] Si. The endophytic fungus Periconia macrospinosa F53 of the halophila was cultured on a large scale to obtain the fermentation product;
[0056] Sii. The fermentation product obtained in step Si is extracted with a second organic solvent. After removing the organic solvent from the extract, an extract is obtained. The extract is separated by gradient elution using silica gel column chromatography. The eluent is an ethyl acetate-petroleum ether solution with a volume ratio of 1:20. The eluted components are collected and purified by high performance liquid chromatography to obtain dichloroisocoumarin and dichlorocycloolefin derivatives.
[0057] The second organic solvent is the same as defined above.
[0058] Preferably, in step Sii, the mass-to-volume ratio of the fermentation product to the second organic solvent is 1 g: (1-3) mL.
[0059] This invention protects the use of the aforementioned unsaturated cyclic compounds in the preparation of anti-inflammatory drugs.
[0060] This invention protects a pharmaceutical composition comprising one or two of the aforementioned unsaturated cyclic compounds.
[0061] Compared with the prior art, the present invention has the following beneficial effects:
[0062] This invention discloses a strain of *Periconia macrospinosa*, a symbiotic fungus of *Pteris vittata*, classified as *Periconia macrospinosa* F35. Experimental verification shows that this strain can synthesize unsaturated cyclic compounds, namely dichloroisocoumarin and dichlorocyclopentene derivatives, via metabolic pathways. Further functional verification results show that these unsaturated cyclic compounds can significantly reduce the expression of the inflammatory factor NO in macrophages under inflammatory conditions, exhibiting significant anti-inflammatory activity. Based on this, this strain and its metabolites have important application prospects in the preparation of anti-inflammatory drugs. Attached Figure Description
[0063] Figure 1 This is a morphological diagram of the endophytic fungus Periconia macrospinosa F35 from Example 1.
[0064] Figure 2 The diagram shown in Example 1 is a neighbor-joining phylogenetic tree of the endophytic fungus Periconia macrospinosa F35, constructed using Mega 7.0 software.
[0065] Figure 3 The image shows the ESI high-resolution mass spectrum of dichloroisocoumarin, a compound prepared in Example 2.
[0066] Figure 4 The compound dichloroisocoumarin prepared in Example 2 1 H-NMR spectrum (CDCl3).
[0067] Figure 5 The compound dichloroisocoumarin prepared in Example 2 13 C-NMR spectrum (CDCl3).
[0068] Figure 6 The image shows the ESI high-resolution mass spectrum of the dichlorocyclopentene derivative prepared in Example 2.
[0069] Figure 7 The dichlorocyclopentene derivative of the compound prepared in Example 2 1 H-NMR spectrum (CDCl3).
[0070] Figure 8 The dichlorocyclopentene derivative of the compound prepared in Example 2 13 C-NMR spectrum (CDCl3). Detailed Implementation
[0071] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.
[0072] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0073] Potato glucose liquid culture medium: Take 100g of commercially available potatoes, peel and cut them into pieces, add 1000mL of water, boil for 30 minutes, filter through 8 layers of gauze to obtain the supernatant. Add 20g of glucose and 25g of coarse sea salt to the supernatant, stir until completely dissolved, and then bring the volume to 1000mL. Dispense into 1000mL Erlenmeyer flasks, 500mL per flask, stopper with cotton and wrap the mouth of the flask with kraft paper, sterilize in an autoclave at 115℃ for 30 minutes, and cool for later use.
[0074] Rice solid culture medium: Use 480mL tissue culture glass bottles, add 50g of rice and 60mL of 2.5% crude sea salt solution to each bottle, shake until level, put on the cap (leaving a 2-3cm breathable membrane on the cap), sterilize in an autoclave at 121℃ for 20 minutes, and cool for later use.
[0075] Example 1: Isolation, identification, and preservation of the endophytic fungus Periconia macrospinosa F35 from the halophila fern.
[0076] 1. Isolation of strains
[0077] (1) Experimental sample: Root of Acrostichum aureum L., a mangrove-associated plant in Qi'ao Island Mangrove Nature Reserve, Xiangzhou District, Zhuhai City, Guangdong Province.
[0078] (2) Experimental methods
[0079] Fresh Periconia macrospinosa roots were sterilized, the outer root bark was removed, and the roots were cut into small sections. These sections were then inoculated onto PDA medium under aseptic conditions and cultured at 20–25°C for 5–15 days to obtain a single strain, Periconia macrospinosa F35.
[0080] Periconia macrospinosa F35 was stored on ordinary PDA medium slant at 4°C.
[0081] 2. Identification of strains
[0082] (1) Morphological and physiological biochemical identification
[0083] like Figure 1As shown, when the above-obtained single strain Periconia macrospinosa F35 was cultured in PDA medium at a constant temperature of 28°C, the colony surface was grayish-white with short, fluffy hyphae, and the back was reddish-brown, with spores generated.
[0084] (2) Molecular identification
[0085] DNA was extracted from pure culture of the epiphytic fungus *Periconia macrospinosa* F35 using the CTAB method. The ITS-rRNA gene fragment was amplified by PCR using a pair of primers, ITS1F and ITS4, for the ITS spacer region. The reaction volume was 50 μL, and the reaction conditions were: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 40 s, 52℃ annealing for 40 s, and 72℃ extension for 1 min. These three steps were repeated for 30 cycles, with a final extension at 72℃ for 10 min to complete the process. Dextran gel electrophoresis confirmed the target fragment was approximately 600 bp. Sequencing yielded the ITS-rRNA gene fragment sequence of this strain (as shown in SEQ ID NO.1), the specific sequence of which is as follows:
[0086] TCGGGCGCGGCTCTTTTACACACCCACCCCCTGCCTATGCGTACCTCGAATCAGCTTCC
[0087] TCGGCGGGCTCGCCCGCCGCCAGGAGCCCCATCCACCCCTTGCATGCTACACGAAAAC
[0088] TTCTGATTGTAACCACAAAATTATCACAACTTTCAACAACGGATCTCTTGGTTCTGGCA
[0089] TCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATC
[0090] ATCGAATCTTTGAACGCACATTGCGGCCATAGGTATTCCTTTGGCCATGCCTGTTCGAG
[0091] CGTCATTTACACCCTCAAGCCCCGCTTGGTGTTGGGCGTCTGTCCCGCCGCGTCCGCGC
[0092] GCGGACTCGCCTCAAAGTCATTGGCGGCGGTCGCGCCGGCCCCCTCGCGCAGCACATT
[0093] TGCGCTTCTCGGGAGGCCTGGCCGATCCGCGCTCCAGCAAGGACCTTTCTTATGACTT
[0094] GACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATC.
[0095] Sequence similarity analysis was performed on GenBank using the BLAST online alignment search engine, yielding strains with a maximum similarity of 89%. A neighbor-joining phylogenetic tree was constructed using Mega 7.0 software, and the phylogenetic analysis results are shown below. Figure 2 The strain was identified as Periconia macrospinosa.
[0096] 3. Preservation of bacterial strains
[0097] The endophytic fungus of the halophila fern of the present invention is Periconia macrospinosa, named Periconia macrospinosa F53, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on December 16, 2024, with accession number GDMCC No. 65649.
[0098] Example 2: Isolation and identification of compounds dichloroisocoumarin and dichlorocyclopentene derivatives
[0099] 1. The separation of dichloroisocoumarin and dichlorocyclopentene derivatives includes the following steps:
[0100] S1. Inoculate the endophytic fungus Periconia macrospinosa F35 into an Erlenmeyer flask containing sterilized potato glucose liquid culture medium, and incubate statically for 35 days under fluctuating temperature conditions of 25-28℃ to obtain the fermentation product.
[0101] S2. Add 200 mL of ethyl acetate to the fermentation product obtained in step S1 to kill the bacteria, then filter with gauze to separate the bacteria and fermentation broth.
[0102] S3. Extract the fermentation broth obtained in step S2 three times with ethyl acetate (ethyl acetate to fermentation broth volume ratio of 2:1), concentrate by rotary evaporation, dry the cells, and then extract four times with methanol (dry cells to methanol mass-volume ratio of 1g:2mL). After rotary evaporation and concentration, combine the extract with the concentrated extract and perform chromatography using ordinary silica gel column (ordinary glass column, specifications: inner diameter 60mm, length 1000mm, silica gel mesh size 200-300 mesh) system (v / v = 1:20). Elution was performed, and the eluted fractions were collected. These fractions were then separated and purified by high-performance liquid chromatography (HPLC) using an acetonitrile-water system (v / v = 1:0.15) (semi-preparative C-18 reversed silica column, 250 mm × 10 mm, 5 μm). Based on the different separation times (i.e., different elution times), the compounds corresponding to each chromatographic peak were collected separately. The structures of the obtained fractions were then confirmed by nuclear magnetic resonance (NMR), yielding 0.05 g of dichloroisocoumarin and 0.12 g of a dichlorocyclopentene derivative, with the structural formulas shown below:
[0103]
[0104] 2. Identification of compounds dichloroisocoumarin and dichlorocyclopentene derivatives
[0105] High-resolution mass spectrometry (HR-ESI-MS) analysis revealed that the quasi-molecular ion peak of the compound dichloroisocoumarin described in step 1 was 272.9722 [MH]. - This is basically consistent with the theoretical calculation value of 272.98. Figure 3 ); and in combination with its 1 H and 13 CNMR spectrum ( Figures 4-5 The characteristic signal of the compound can be used to clearly identify its molecular structure. High-resolution mass spectrometry (HR-ESI-MS) analysis showed that the quasi-molecular ion peak of the dichlorocyclopentene derivative described in step 1 was 283.0143 [MH]. - This is basically consistent with the theoretical calculation value of 283.0218. Figure 6 ); and in combination with its 1 H and 13 CNMR spectrum ( Figures 7-8 The characteristic signals of the compound can clearly identify its molecular structure. The detection results of HR-ESI-MS and NMR above together prove that the compound dichloroisocoumarin and the dichlorocyclopentene derivative in step 1 have been successfully separated.
[0106] Example 3: Isolation and identification of compounds dichloroisocoumarin and dichlorocyclopentene derivatives
[0107] 1. The separation of dichloroisocoumarin and dichlorocyclopentene derivatives includes the following steps:
[0108] S1. Using rice solid culture medium, the endophytic fungus Periconia macrospinosa strain F35 was inoculated into an Erlenmeyer flask containing rice solid culture medium and cultured statically for 30 days under fluctuating temperature conditions of 25-28℃ to obtain the fermentation product.
[0109] S2. The fermentation product obtained in step S1 was added to a methanol-chloroform (v / v = 1:1) mixed solvent at a mass-to-volume ratio of 1 g: 2 mL, and extracted four times. The extract was concentrated by rotary evaporation. The resulting extract was subjected to chromatography using a conventional silica gel column (ordinary glass column, specifications: inner diameter 60 mm, length 1000 mm, silica gel mesh size 200-300 mesh). Elution was performed using an ethyl acetate-petroleum ether system (v / v = 1:20). The eluted fractions were collected and purified by high performance liquid chromatography (HPLC) using an acetonitrile-water system (acetonitrile and water volume ratio 1:0.15) (semi-preparative C-18 reversed silica gel column, specifications: 250 mm × 10 mm, 5 μm). According to different separation times, the compound components corresponding to each chromatographic peak were collected separately, yielding 0.28 g of dichloroisocoumarin and 0.44 g of dichlorocyclopentene derivative.
[0110] 2. Identification of compounds dichloroisocoumarin and dichlorocyclopentene derivatives
[0111] The identification results of the compounds dichloroisocoumarin and dichlorocyclopentene derivatives obtained in Example 3 were basically consistent with those in Example 2, and will not be repeated here.
[0112] Example 4: Anti-inflammatory activity test of compounds dichloroisocoumarin and dichlorocyclopentene derivatives
[0113] 1. Experimental Methods
[0114] A mouse monocyte / macrophage RAW264.7 model induced by lipopolysaccharide (LPS) was used, with 100 μM indomethacin as a positive control. The inhibition rate of nitric oxide (NO) release from LPS-induced mouse monocyte / macrophage RAW264.7 cells by dichloroisocoumarin and dichlorocyclopentene derivatives, secondary metabolites of the endophytic fungus Periconia macrospinosa F35, was determined, and the cell viability was measured by MTT assay.
[0115] 2. Experimental Results
[0116] Table 1. Results of anti-inflammatory activity tests on compounds dichloroisocoumarin and dichlorocyclopentene derivatives.
[0117]
[0118] Note: "---" indicates no inhibition rate; "ND" indicates not tested.
[0119] The results are shown in Table 1. Both dichloroisocoumarin and dichlorocyclopentene derivative (GA) inhibited NO release from LPS-induced mouse RAW264.7 monocytes and macrophages. Furthermore, at a concentration of 50 μM, the inhibition rate of both compounds on NO was superior to that of the positive control indomethacin at a concentration of 100 μM. The IC50 values of dichloroisocoumarin and dichlorocyclopentene derivative in inhibiting NO release from these cells were also measured. 50 The values were 35.85±3.50 μM and 51.38±5.0 μM, respectively, indicating that it had a significant inhibitory effect on the inflammation-related mediator NO. In addition, at a concentration of 50 μM, dichloroisocoumarin showed an MTT survival rate of 65.62%, and combined with its NO inhibition rate of 72.88%, it can effectively resist inflammation and regulate cell viability. The above results together confirm that dichloroisocoumarin and dichlorocyclopentene derivatives have good anti-inflammatory activity and can be developed into anti-inflammatory drugs.
[0120] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. An endophytic fungus of *Hydracaena halosa*, characterized in that, The endophytic fungus of the halophila is Periconia macrospinosa, named Periconia macrospinosa F53, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on December 16, 2024, with accession number GDMCC No. 65649.
2. The use of the endophytic fungus of Haloxylon ammodendron as described in claim 1 in the preparation of anti-inflammatory compounds.
3. The application according to claim 2, characterized in that, The anti-inflammatory compound has one or two of the following structures:
4. A class of unsaturated cyclic compounds, characterized in that, The unsaturated cyclic compound has any of the following structures:
5. The method for preparing the unsaturated cyclic compound according to claim 4, characterized in that, The target compound, namely dichloroisocoumarin and / or dichlorocyclopentene derivative, was isolated and purified from the fermentation product of the endophytic fungus Periconia macrospinosa F35 as described in claim 1. Furthermore, the preparation method specifically includes the following steps: The endophytic fungus Periconia macrospinosa F53 of claim 1 was cultured in an expanded manner to obtain a fermentation product. The obtained fermentation product was extracted with an organic solvent to obtain an extract. The obtained extract was then separated and purified by silica gel column chromatography and high performance liquid chromatography to obtain the target compound, namely dichloroisocoumarin and / or dichlorocycloolefin derivative.
6. The preparation method according to claim 5, characterized in that, The expanded culture can be a liquid culture or a solid culture.
7. The preparation method according to claim 5, characterized in that, When the expanded culture is a liquid culture, the preparation method specifically includes the following steps: S1. The endophytic fungus Periconia macrospinosa F53 of the halophila fern was cultured on a large scale to obtain the fermentation product; S2. The fermentation product obtained in step S1 is subjected to solid-liquid separation. The liquid phase is extracted with a first organic solvent, and the solid phase is extracted with a second organic solvent. The extract and the extract are collected separately. After removing the organic solvent from the extract and the extract, they are combined to obtain the extract. The obtained extract is separated by gradient elution using silica gel column chromatography. The eluent is an ethyl acetate-petroleum ether solution with a volume ratio of 1:
20. The eluted components are collected and purified by high performance liquid chromatography to obtain the target compound, namely dichloroisocoumarin and / or dichlorocycloolefin derivatives. Preferably, the first organic solvent is ethyl acetate and / or chloroform; Preferably, the second organic solvent is methanol and / or chloroform.
8. The preparation method according to claim 5, characterized in that, When the expanded culture is a solid culture, the preparation method specifically includes the following steps: Si. The endophytic fungus Periconia macrospinosa F53 of the halophila was cultured on a large scale to obtain the fermentation product; Sii. The fermentation product obtained in step Si is extracted with a second organic solvent. After removing the organic solvent from the extract, an extract is obtained. The extract is separated by gradient elution using silica gel column chromatography. The eluent is an ethyl acetate-petroleum ether solution with a volume ratio of 1:
20. The eluted components are collected and purified by high performance liquid chromatography to obtain dichloroisocoumarin and dichlorocycloolefin derivatives. Wherein, the second organic solvent is the same as that defined in claim 7.
9. The use of the unsaturated cyclic compound of claim 4 in the preparation of anti-inflammatory drugs.
10. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises one or two of the unsaturated cyclic compounds of claim 4.