Phellinus igniarius strain rich in polysaccharide and general flavone as well as cultivation method and application of phellinus igniarius strain

By selecting and breeding the Sanghuang strain Hasan No. 1 and optimizing cultivation conditions, the problems of low yield and low polysaccharide and total flavonoid content of Sanghuang varieties have been solved, achieving high-efficiency yield increase and cost control, expanding the adaptability of fruiting environment, and improving planting income.

CN121320114APending Publication Date: 2026-01-13HARBIN CITY ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511863070.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-01-15
Filing Date
2025-12-11
Publication Date
2026-01-13

AI Technical Summary

Technical Problem

Existing technologies lack high-yield Sanghuang varieties with high polysaccharide and total flavonoid content, and existing cultivation methods are difficult to achieve high yield and increased income. Sanghuang has high requirements for the fruiting environment, low survival rate of wild domestication, and high production costs.

Method used

A strain of Sanghuang porus, Hasang No. 1, was selected and bred. By optimizing the culture medium formula, opening method and cultivation facility conditions, using Sophora japonica cultivation material instead of traditional mulberry sawdust, and using rice seedling sheds for mushroom cultivation management, the adaptability to the mushroom growing environment and yield were improved.

Benefits of technology

It increased the polysaccharide and total flavonoid content of the Sanghuang strain, reduced production costs, expanded the range of environments suitable for fruiting, enhanced the utilization rate of fruiting area, and improved planting income.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320114A_ABST
    Figure CN121320114A_ABST
Patent Text Reader

Abstract

The invention provides a phellinus igniarius strain rich in polysaccharide and general flavone as well as a cultivation method and application thereof, relates to the technical field of biology, and aims to solve the problems that a phellinus igniarius variety which is high in yield, high in fruiting environment adaptability and high in polysaccharide and general flavone content is lacked in the prior art, and an existing cultivation method is difficult to meet the effects of high yield and income increase. The phellinus linteus strain is phellinus linteus spp, is named as Harmulberry No.1, and is preserved in the China General Microbiological Culture Collection Center on October 31, 2024, the preservation address is Institute of Microbiology, Chinese Academy of Sciences, No.3, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC No.41588. In the cultivation process of the phellinus igniarius sporocarp, a cultivar culture medium is prepared from, by mass, 78% of oak sawdust, 15% of trametes robiniophila cultivation waste, 5% of corn flour, 1% of gypsum powder and 1% of cane sugar. The phellinus igniarius variety disclosed by the invention has potential development and application values and can be used for preparing health-care foods or medicines.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] With respect to this application, the applicant claims priority to the prior Chinese invention patent application number CN 2025100604832, which was filed with the State Intellectual Property Office of the People's Republic of China on January 15, 2025. Technical Field

[0002] This invention relates to the field of biotechnology, specifically to a strain of Phellinus linteus rich in polysaccharides and total flavonoids, its cultivation method, and its applications. Background Technology

[0003] Sanghuang (Sanghuangporus spp.), belonging to the phylum Basidiomycota, class Agaricales, order Phyllostachyales, family Phyllostachyaceae, and genus Sanghuang, is also known as Sanghuang Gu or Sanghuang Gu. Sanghuang has a long history of medicinal use, having been applied in traditional Chinese medicine for over two thousand years. It possesses extensive physiological activity and medicinal value, earning it the title of "forest gold." Currently, Sanghuang pills and oral liquids are available on the market, demonstrating its high health and medicinal value.

[0004] With the rapid development of the Sanghuang industry in recent years, the requirements for the quality and grade of Sanghuang strains have become increasingly stringent. Current technologies lack high-yield, high-polysaccharide, and high-total-flavonoid high-quality Sanghuang varieties. During cultivation, existing Sanghuang varieties have high requirements for the fruiting environment, greatly limiting the facilities available for fruiting. Furthermore, the survival rate of wild-caught Sanghuang is low, and the harvesting process is prone to contamination, causing inconvenience for its domestication. Moreover, existing Sanghuang cultivation materials are mainly composed of mulberry sawdust, along with relatively expensive auxiliary materials such as wheat bran and corn flour, increasing production costs. Summary of the Invention

[0005] The problem that this invention aims to solve is:

[0006] Existing technologies lack high-yield Sanghuang varieties with high polysaccharide and total flavonoid content, and existing cultivation methods are insufficient to achieve high yield and increased income.

[0007] The technical solution adopted by the present invention to solve the above-mentioned technical problems is as follows:

[0008] This invention provides a strain of *Sanghuangporus*, named Hasang No. 1, with the preservation number CGMCC No. 41588. It is characterized by high yield, wide tolerance for various fruiting environments, and high polysaccharide and total flavonoid content, making it a high-quality *Sanghuangporus* variety. By optimizing the appropriate culture medium formula, inoculation method, and cultivation facilities, the advantages of this variety can be fully demonstrated, achieving increased yield and income.

[0009] The present invention also provides a fruiting body of *Sanghuang* fungus for cultivating the *Sanghuang* strain.

[0010] The present invention also provides a method for cultivating the fruiting bodies of the *Phellinus linteus*, comprising the following steps:

[0011] (1) The mother culture of Phellinus linteus according to claim 1 is inoculated into a liquid culture medium and cultured to obtain a liquid culture;

[0012] (2) Sterilize the culture medium, inoculate the liquid spawn into the culture medium for mycelial growth, open the bag when the mycelium has grown, then manage the fruiting period, and finally harvest the fruiting bodies of Sanghuang fungus.

[0013] The culture medium for the cultivation of cultivars comprises, by mass ratio: 78% oak sawdust, 15% waste material from Sophora japonica cultivation, 5% corn flour, 1% gypsum powder, and 1% sucrose.

[0014] Furthermore, in step (2), the opening of the mushroom bag is made by making a circular opening around the mushroom bag.

[0015] Furthermore, in step (2), the cultivar is placed in a rice seedling shed for mushroom cultivation management. The temperature for mushroom cultivation management is 24~28℃, the relative humidity is 85%~95%, and sufficient diffused light and oxygen are provided.

[0016] The present invention also provides the application of the fruiting body of the Phellinus linteus in the preparation of health food or medicine.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] This invention yields the *Phellinus linteus* strain Hasan No. 1 through wild domestication. This strain exhibits robust mycelial growth, good growth pattern, and high fruiting body yield; the polysaccharide and total flavonoid content of the fruiting bodies reaches 6.72% and 8.69%, respectively. This *Phellinus linteus* strain demonstrates strong ability to synthesize polysaccharides and total flavonoids, possessing potential development and application value, and can be used in the preparation of health foods or pharmaceuticals.

[0019] This invention yields the *Sanghuang* strain Hasan No. 1 through wild domestication. This strain exhibits strong adaptability to fruiting environments, producing fruit in normal quantities at temperatures of 22-32℃ and humidity of 60-90%. Furthermore, compared to other strains, the fruiting bodies of this *Sanghuang* strain are generally larger and thicker, resulting in higher yields. Therefore, the *Sanghuang* strain bred in this invention has significant cultivation potential.

[0020] This invention utilizes waste fungal residue from *Sanghuang* (a type of fungus) by adding it to the culture medium during cultivation. This not only makes use of waste but also significantly reduces production costs and helps to further increase the polysaccharide content of *Sanghuang*. Furthermore, the use of a ring-shaped opening around the fungus bag, compared to the traditional crescent-shaped opening, expands the fruiting area and facilitates the effective utilization of nutrients in the cultivation medium. Additionally, the invention reuses rice seedling sheds during cultivation, increasing the variety of rice seedlings that can be planted and significantly increasing planting profits. Attached Figure Description

[0021] Figure 1 This is an image of Hassan-1 sub-entity in an embodiment of the present invention;

[0022] Figure 2 This is a schematic diagram of the sterile box structure in an embodiment of the present invention;

[0023] Figure 3 This is a schematic diagram of a simplified opening device structure in an embodiment of the present invention. Detailed Implementation

[0024] To enable those skilled in the art to better understand the present invention, exemplary embodiments or examples of the present invention will be described below in conjunction with the accompanying drawings. Obviously, the described embodiments or examples are merely some, not all, of the embodiments or examples of the present invention. All other embodiments or examples obtained by those skilled in the art based on the embodiments or examples of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0025] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

[0026] Example 1:

[0027] 1. Strains Collection

[0028] The fungal strain was collected from Laoye Ridge in Shangzhi County. Ten wild Sanghuang strains were collected, and through isolation and domestication, a strain with robust mycelial growth, good growth, and high content of active ingredients was obtained and named Hasan No. 1. The specific methods are as follows:

[0029] After collecting the wild Phellinus linteus fruiting bodies, the surface is simply disinfected. Impurities are brushed away with a clean brush, and the outer surface is wiped five times with 75% alcohol for further disinfection. The fruiting bodies are then longitudinally cut open with a scalpel, placed in a simple sterile box, and transported back to the laboratory for subsequent wild fruiting body extraction. Figure 2As shown, the sterile box is a square, sealed container containing fixing posts. The fruiting bodies of *Sanghuang* are secured within the sterile box by piercing them with these posts. This method allows the cross-section of the *Sanghuang* fruiting bodies to continue growing during transport, reducing contamination and increasing the survival rate.

[0030] This invention improves the tools for collecting wild resources, allowing the fruiting bodies to continue growing during transport, thus rejuvenating the mycelium, reducing the pollution rate of wild resources, and increasing the survival rate of wild domestication.

[0031] 2. Strains Isolation

[0032] 2.1. Culture medium preparation

[0033] Culture medium formula: 200g potato (peeled), 20g glucose, 2g peptone, 2g yeast powder, 20g agar and 1000ml water, pH natural.

[0034] Weigh 200g of peeled potatoes, slice them thinly, wash them, add 1000ml of water and boil. After boiling, boil for another 20 minutes. Then filter with gauze and collect the filtrate. If the filtrate is less than 1000ml, add more to make up to 1000ml. Then add 20g of agar and boil until dissolved. Then add 20g of glucose, 2g of peptone and 2g of yeast powder and dissolve. While still hot, dispense into test tubes for sterilization. Fill the test tubes to about one-fifth to one-quarter of their height. Seal the test tubes with cotton plugs and autoclave at 121℃ for 20 minutes. After sterilization, place on a slant for later use.

[0035] 2.2. Tissue Separation

[0036] The rejuvenated wild Sanghuang fruiting bodies were removed from their cross-sections, rinsed several times with sterile water in a sterile room, and thoroughly dried with sterile paper. They were then soaked in 0.1% mercuric chloride solution for 5 minutes. After removal, they were rinsed several times with sterile water (or the surface of the fruiting body could be directly wiped with 75% alcohol) for surface disinfection. Then, using an inoculation needle, approximately 0.5 cm of the wild Sanghuang fruiting body was quickly picked up above the flame of an alcohol lamp. 2 The fruiting body tissue blocks were inoculated onto test tube slant culture medium, and each fruiting body was separated into 5 test tubes.

[0037] 2.3. Cultivation

[0038] After inoculation, the test tubes were placed in a constant temperature incubator at 25°C and numbered SH-1 to SH-10.

[0039] 3. Mycelial growth test

[0040] 3.1. Culture medium preparation

[0041] Plate culture medium formula: 200g potato, 20g glucose, 20g agar and 1000ml water.

[0042] Weigh 200g of peeled potatoes, slice them thinly, wash them, add 1000ml of water and boil. After boiling, boil for another 20 minutes. Then filter with gauze and collect the filtrate. If the filtrate is less than 1000ml, add more to make up to 1000ml. Then add 20g of agar and boil until dissolved. Then add 20g of glucose and dissolve. Autoclave at 121℃ for 20 minutes. After sterilization, pour the mixture into a 9cm diameter sterile plate in a laminar flow hood for later use.

[0043] 3.2. Inoculation and Culture

[0044] Take a 0.5cm sample from the slant of the test tube. 2 The mother culture blocks were inoculated onto agar plates (d=9cm) and incubated at a constant temperature of 25℃. Once the mycelium had fully grown onto the plates, a 0.7cm diameter punch was used to take mycelial blocks of uniform age, size, and without contamination and transfer them to the center of the agar plate (d=9cm). The plates were then incubated at a constant temperature of 25℃. After mycelial germination, the mycelial growth, uniformity, and color were observed. The results are shown in Table 1.

[0045] Table 1

[0046]

[0047] Among them, "+" indicates sparse and weak hyphae, "++" indicates relatively sparse hyphae with good growth, "+++" indicates dense hyphae with vigorous growth, and "++++" indicates dense and robust hyphae.

[0048] Example 2:

[0049] 1. Optimization of culture medium

[0050] 1.1 Preparation of liquid bacterial cultures

[0051] Liquid culture medium formula: 100g potato, 50g cottonseed hulls, 15g glucose, 2g potassium dihydrogen phosphate, 0.5g magnesium sulfate, 0.3ml glycerol and 1000ml water; pH 5-6.

[0052] Weigh 100g of peeled potatoes, slice them thinly, wash them, add 1000ml of water and boil for 5 minutes after the water boils. Add 50g of cottonseed hulls and boil for another 15 minutes. Then filter with gauze and collect the filtrate. If the filtrate is less than 1000ml, add more to make up to 1000ml. Then add 15g of glucose, 2g of potassium dihydrogen phosphate, 0.5g of magnesium sulfate and 0.3ml of glycerol and dissolve them. While still hot, dispense the solution into Erlenmeyer flasks, filling them to about two-fifths of their volume. Autoclave at 121℃ for 20 minutes to obtain the liquid culture medium.

[0053] Use a hole punch to take 5-8 pieces of 0.5cm material. 2The mother culture block was inoculated into liquid culture medium and cultured with shaking at 20-25℃ and 140-160r / min to obtain liquid culture.

[0054] 1.2 Preparation of Cultivation Varieties

[0055] Culture medium A for cultivation: 78% mulberry sawdust, 15% wheat bran, 5% corn flour, 1% gypsum powder, and 1% sucrose.

[0056] Select fresh, mold-free culture medium, mix wheat bran, corn flour and gypsum powder together in proportion, then add mulberry sawdust in proportion, dissolve sucrose in water, mix the dry mixture with the sucrose water evenly to prepare the inoculum (moisture content 60wt%), pack it into 17x35cm bags, each bag contains 1.5kg of inoculum, sterilize at normal pressure for 12 hours, and let stand until the temperature drops to 25℃.

[0057] Culture medium B for cultivation: 78% oak sawdust, 15% Sophora japonica cultivation substrate, 5% corn flour, 1% gypsum powder, and 1% sucrose.

[0058] Select fresh, mold-free culture medium. Mix the Sophora japonica cultivation medium, corn flour, and gypsum powder together in a certain proportion. Then add oak sawdust in a certain proportion. Dissolve sucrose in water. Mix the dry mixture with the sucrose water evenly to prepare the cultivation substrate (moisture content 60wt%). Pack the substrate into 17x35cm bags, with 1.5kg of substrate in each bag. Sterilize under normal pressure for 12 hours and let stand until the temperature drops to 25℃.

[0059] Among them, the Sophora japonica cultivation medium B formula is made from the waste mycelial residue of Sophora japonica AS-7. Sophora japonica AS-7 (deposited at the China General Microbiological Culture Collection Center on April 24, 2022, with accession number CGMCC No. 40140) has a high polysaccharide content. During the cultivation of Sophora japonica AS-7, the mycelium grows vigorously, and the nutrients in the mycelial bag are not completely consumed after the fruiting bodies grow. By grinding and fermenting the waste mycelial residue of Sophora japonica AS-7, it can be prepared into Sophora japonica cultivation medium, which can replace traditional mulberry sawdust and effectively reduce production costs.

[0060] Liquid inoculum was inoculated into culture media A and B under aseptic conditions, and then transferred to a greenhouse for uniform cultivation. The cultivation conditions were: temperature 22-28℃, relative humidity 50-60%, with good ventilation and protection from light. The results of the time to full coverage, mycelial growth, and contamination rate of the three strains are shown in Table 2.

[0061] Table 2

[0062]

[0063] Among them, "+" indicates sparse and weak hyphae, "++" indicates relatively sparse hyphae with good growth, "+++" indicates dense hyphae with vigorous growth, and "++++" indicates dense and robust hyphae.

[0064] Table 2 shows that adding *Auricularia auricula-judae* AS-7 waste substrate to the cultivation medium resulted in shorter bag filling time and better, denser, and more robust mycelial growth in *Sanghuang* cultivation. Furthermore, using oak sawdust instead of mulberry sawdust reduced cultivation costs. Among these, the SH-1 bags containing *Auricularia auricula-judae* substrate showed a significantly lower contamination rate compared to other varieties.

[0065] 2. Optimization of opening method

[0066] Method 1: Once the mycelium has fully grown, use a blade (sterilized by boiling in water for 30 minutes before use) to make a crescent-shaped cut on one side of the bag covered with mycelium, and place it upright in the mushroom growing greenhouse.

[0067] Method 2: Once the mycelium has fully colonized the bag, use a simple opening tool to make a circular cut around the bag, then place it upright in the fruiting greenhouse. Figure 3 As shown, the simple opening device has parallel double blades spaced 3-5cm apart. Make a cut around the top third of the mushroom bag to achieve ring-shaped mushroom growth.

[0068] Different opening methods were used to manage the fruiting of *Sanghuang* spawn bags, maintaining a temperature of 24–28℃, a relative humidity of 85%–95%, and providing ample diffused light and oxygen. Harvesting was carried out when the caps began to leathery and yellowish-brown, mist-like spores were ejected from the back. The results are shown in Table 3.

[0069] Table 3

[0070]

[0071] The results in Table 3 show that the fruiting body yield increased significantly after the bags of Sanghuang mushroom were ring-cut at the outlet. Ring-cutting at the outlet allows the nutrients in the substrate in the Sanghuang mushroom bags to be fully utilized, thereby increasing the yield.

[0072] Example 3:

[0073] 1. Preparation of Cultivation Seeds

[0074] Using SH-1, SH-4, SH-5 and existing varieties SH-BJ (Beijing Jixunyuan Edible Fungus Research Institute) and SH-DB (Northeast Edible Fungus Research Institute) as experimental materials, cultivars were prepared according to the cultivar preparation method in Example 2. Cultivar culture medium B was selected for the cultivar culture medium, and the opening method was opening method 1.

[0075] 2. Fruiting Environment Experiment

[0076] 2.1 Fruiting temperature

[0077] Five cultivars of *Sanghuang* were placed in different temperature treatment environments, with all other cultivation conditions remaining the same: relative humidity of 95%, light intensity of 300 Lux, and carbon dioxide concentration not exceeding 0.1%. During the fruiting stage, the fruiting performance of different *Sanghuang* varieties under each temperature treatment environment was statistically analyzed. The experimental results are shown in Table 4.

[0078] Table 4

[0079]

[0080] The results of the temperature range test showed that the Sanghuang variety SH-1 produced fruiting products in environments ranging from 22-32℃ with normal fruiting yield, but hardly produced any fruiting products at 20℃ and 32℃; while other varieties had fruiting temperatures concentrated in environments ranging from 24-28℃. This Sanghuang variety SH-1 has a wider fruiting temperature range.

[0081] 2.2 Mushroom Growing Moisture

[0082] Five cultivars of *Sanghuang* were placed in different humidity treatment environments, with all other cultivation conditions remaining the same: temperature 26-28℃, light intensity 300 Lux, and air carbon dioxide concentration not exceeding 0.1%. During the fruiting stage, the number of bags that normally formed fruiting bodies was statistically analyzed under each humidity treatment environment for different *Sanghuang* varieties. The results are expressed as the normal proportion, which is the ratio of the number of bags that did not normally form fruiting bodies to the total number of bags. The experimental results are shown in Table 5.

[0083] Table 5

[0084]

[0085] The results of the wide range of relative humidity tests show that the Sanghuang variety SH-1 can form normal fruiting bodies under humidity conditions of 60-90%, but the proportion of normal fruiting bodies formed under humidity conditions of 50% and 100% is relatively low; while the relative humidity for the formation of normal fruiting bodies for other varieties is concentrated at 70-80%. The Sanghuang variety SH-1 of this invention has a wider range of requirements for relative humidity during the fruiting body formation stage.

[0086] 2.3 Comparison Test of Growth Conditions

[0087] Five different cultivars of *Sanghuang* with uniformly sized openings were placed in the same treatment environment: a temperature of 24–28℃, a relative humidity of 85%–95%, and sufficient diffused light and oxygen. A comparative growth experiment was conducted on the different *Sanghuang* cultivars during the fruiting stage. The experimental results are shown in Table 6.

[0088] Table 6

[0089]

[0090] The results of the growth comparison test show that, compared with other varieties, the fruiting bodies of the SH-1 variety of Sanghuang of this invention are larger, thicker, and have a higher yield.

[0091] 3. Rice seedling shed cultivation experiment

[0092] Cultivation spawn was prepared from SH-1, SH-4, and SH-5, along with existing varieties SH-BJ and SH-DB. These spawn were placed in unused sheds after rice seedling cultivation for fruiting period management, using spawn method 2. During cultivation in the rice seedling sheds, the temperature was maintained at 24–28℃, the relative humidity at 85%–95%, and sufficient diffused light and oxygen were provided. Humidification was achieved by drip irrigation to moisten the ground, utilizing transpiration to increase air humidity; this reduced pollution from direct water humidification and saved on labor and humidification equipment costs, thus lowering overall costs.

[0093] Harvesting was carried out when the cap began to leathery and yellowish-brown, mist-like spores were ejected from the back. The yield, fruiting body color, and contamination rate of SH-1, SH-4, and SH-5, compared with existing varieties SH-BJ and SH-DB, were tested, and the results are shown in Table 7.

[0094] Table 7

[0095]

[0096] In the mushroom uniformity rating, "+" indicates uneven mushroom growth, "++" indicates relatively uniform mushroom growth, and "+++" indicates very uniform mushroom growth.

[0097] Table 7 shows that, compared with the mainstream varieties SH-BJ and SH-DB in the existing technology, the Sanghuang variety SH-1 has more uniform fruiting, lower contamination rate, and significantly higher yield in rice seedling shed cultivation.

[0098] 4. Active ingredient content determination test

[0099] The contents of secondary metabolites of SH-1, SH-4, and SH-5, along with the existing varieties SH-BJ and SH-DB, were determined. The contents of polysaccharides, total flavonoids, and triterpenes in the samples were determined according to the method of Wang Weike et al. (Wang Weike, Lu Na, Yan Jing, et al. Effects of growth years on the nutrition, active ingredients, and antioxidant activity of fruiting bodies of *Sanguisorba officinalis* grown on logs [J]. *Acta Mycologica Sinica*, 2021, 40(03):668-680.). A standard curve for glucose was plotted with glucose concentration (μg / mL) as the x-axis and absorbance as the y-axis. The equation was γ1 = 0.0101χ1 - 0.0042 (R0). 2=0.9973); Plotting rutin concentration (μg / mL) on the x-axis and absorbance on the y-axis, the equation for the rutin standard curve is γ2 = 0.0032χ2 - 0.0163 (R = 0.9973). 2 =0.9970); Plotting the oleanolic acid mass concentration (μg / mL) on the x-axis and absorbance on the y-axis, the equation for the oleanolic acid standard curve is γ4 = 0.0075χ4 - 0.0049 (R = 0.9970). 2 =0.9979). The test results are shown in Table 8.

[0100] Table 8

[0101]

[0102] As shown in Table 8, the polysaccharide, total flavonoid, and triterpenoid contents of the Sanghuang variety SH-1 are significantly higher than those of SH-4, SH-5, and the existing varieties SH-BJ and SH-DB, which is more outstanding compared to the existing technology.

[0103] 5. Identification and Preservation

[0104] Morphological identification

[0105] The fruiting body of the Sanghuang variety SH-1 is sessile, smooth, and covered with short yellow hairs; it is bright yellow during the growing season and darkens to yellowish-brown when mature. Figure 1 ).

[0106] Molecular biological identification

[0107] ITS sequencing was performed on SH-1 strain. Through amplification and DNA sequencing, the nucleotide sequence of SH-1 strain is shown in SEQ ID NO:1. Molecular biological identification confirmed that SH-1 strain belongs to the phylum Basidiomycota, class Agaricales, order Phyllostachyales, family Phyllostachyaceae, and genus *Sanghuangporus*. Based on comprehensive morphological identification, SH-1 strain belongs to *Sanghuangporus* spp.

[0108] On October 31, 2024, the strain SH-1 of *Sanghuang* was deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. It was classified and named *Sanghuang*, and named Hasan No. 1. The accession number is CGMCC No. 41588.

[0109] While the present invention has been disclosed above, its scope of protection is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention, and all such changes and modifications will fall within the scope of protection of the present invention.

[0110] ITS sequence:

[0111] ACCTGCGGAAGGATCATTATCGAGTTCAGAAGCGAGGTTGTAGCTGGCCT

[0112] TCTCGGAGGCATCGTGCACGCCCTGCCCGTCCCATATCATACCTGTGAAC

[0113] TTTTTGGTAGGCGGGTTTGTGTCGGCCCCGAAAGGGGTCGACCGGCCCTC

[0114] CGGCCGTCTTTATATACACACCATACGAGTCTTTAGAATGTTTGTGCGTC

[0115] TCGACGCATCTTATATATAACTTTCAGCGACGGATCTCTTGGCTCTCGCA

[0116] TCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATTC

[0117] AGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTCGGTATTCCGAG

[0118] GAGCATGCCTGTTTGAGTGTCATGAAATTATCAACCCCTCCTCCTTCATC

[0119] GGCGGTGGGGCTTGGACTTGGAGGCTTTGCGGGCTTTTAACGAGTCGGCT

[0120] CCTCTCAAATGCATTAGCTCGAACCCCTGCGGATCGGCCGTCGGTGTGAT

[0121] ATAATGTCTACGTCGTGGTCGTGAGCGTCGGATCGGCTTCTAATGGTCCC

[0122] CTTTCGGAGGCGGAATTTGAACTTGTGACCTCAAATCAGGTAGGACTACC

[0123] CGCTGAACTTAAGCAT。

Claims

1. A strain of Phellinus sp., characterized in that, The strain is Sanghuangporus sp., named Hassan No. 1, and was preserved in the China General Microbiological Culture Collection Center on October 31, 2024, at the address of No. 1, Beichen West Road, Yard 3, Institute of Microbiology, Chinese Academy of Sciences, Beijing, with the preservation number of CGMCC No. 41588.

2. A Sanghuangporus sp. fruiting body cultivated from the Sanghuangporus sp. strain of claim 1.

3. A method for cultivating the fruiting body of the Phellinus linteus according to claim 2, characterized in that, The method comprises the following steps: (1) inoculating the mother culture of the Sanghuangporus sp. strain of claim 1 in a liquid culture medium to obtain a liquid culture; (2) sterilizing a cultivation medium, inoculating the liquid culture in the cultivation medium to grow the fungus, opening the bag when the mycelium is full, then managing the fruiting period, and finally harvesting the Sanghuangporus sp. fruiting body product; The cultivation medium comprises, by mass ratio, 78% oak sawdust, 15% wattle ear cultivation waste, 5% corn flour, 1% gypsum powder, and 1% sucrose; The wattle ear cultivation waste is the cultivation waste of wattle ear AS-7, which was preserved in the China General Microbiological Culture Collection Center on April 24, 2022, with the preservation number of CGMCC No. 40140; In step (2), the opening of the bag is performed in a ring-shaped opening manner around the bag; In step (2), the cultivation medium is placed in a rice seedling raising shed for fruiting management, the temperature for fruiting management is 24-28℃, the air relative humidity is 85%-95%, and sufficient scattered light and oxygen are provided.

4. Use of the Sanghuangporus sp. fruiting body of claim 2 in the preparation of health food or medicine.