MRNA (messenger ribonucleic acid) and preparation method, application and vaccine thereof

Abstract

The invention belongs to the field of biology, and discloses an mRNA (messenger ribonucleic acid) with a nucleotide sequence as shown in SEQ ID NO.3. Antiserum of a strain (A / chick / Gansuu / 28 / 2024) corresponding to the mRNA has relatively good reactivity with other strains and poorer reaction with a current vaccine strain RE-13, the branched strain is a current epidemic strain, and the mRNA prepared from the HA gene of the strain has the advantage of strong protection; the invention also aims to provide the mRNA, application thereof and a vaccine.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biology, in particular to an mRNA, a preparation method, application and vaccine thereof. BACKGROUND

[0002] Avian influenza virus poses a significant threat to the poultry industry due to its high pathogenicity and genetic diversity. Currently, the most widely used vaccine strain for H5 subtype of 2.3.4.4h clade is H5-Re-13 (2.3.4.4h), which was selected from H5 subtype strains in 2020. The continuous genetic evolution of the virus may lead to a decrease in antigenic response between the long-outdated vaccine strain and newly isolated viruses. According to literature reports (doi:10.1016 / S2666-5247(22)00148-3), the vaccine strain has already shown some differences in antigenicity from the currently prevalent strains. Moreover, migratory birds further evolve the prevalent strains into new prevalent strains through migration, making the previously applied inactivated vaccine less effective. The above studies show that the currently prevalent 2.3.4.4h clade H5 subtype virus has evolved to some extent and poses a potential threat to human public health safety. Moreover, the current vaccine still needs to be improved in terms of delivery efficiency, immunogenicity and response spectrum. Therefore, there is an urgent need for a new vaccine strain to cope with this ongoing evolution. SUMMARY

[0003] Unless otherwise specified in the present application: nM represents nanomoles per liter, uM represents micromoles per liter, mM represents millimoles per liter, and M represents moles per liter.

[0004] The purpose of the present application is to provide an mRNA, the antiserum of the strain (A / chicken / Gansu / 28 / 2024) corresponding to the mRNA has relatively good reactivity with other strains and relatively poor reactivity with the current vaccine strain RE-13, and the branch strain is the currently prevalent strain, and the mRNA prepared by using the HA gene of the strain has the advantage of strong protection;

[0005] Another purpose of the present application is to provide the above mRNA and use thereof and a vaccine.

[0006] To achieve the above purpose, the present application discloses an mRNA, the nucleotide sequence of which is shown in SEQ ID NO. 3.

[0007] Meanwhile, the present application also discloses a preparation method for preparing the mRNA as described above, comprising the following steps:

[0008] Step 1: Clone the codon-optimized HA gene into a vector to obtain a plasmid;

[0009] Step 2: linearizing the plasmid to obtain a linearized plasmid;

[0010] Step 3: transcribing and purifying the linearized plasmid to obtain mRNA; the nucleotide sequence of the codon-optimized HA gene is shown in SEQ ID NO. 2.

[0011] In addition, the application also discloses the use of the mRNA in the preparation of a vaccine, which is an avian vaccine.

[0012] In the use of the mRNA in the preparation of a vaccine, the vaccine is an avian influenza H5N6 virus vaccine.

[0013] In the use of the mRNA in the preparation of a vaccine, the avian is a chicken, a duck, a goose, a goose, a quail, a pigeon or a turkey.

[0014] Finally, the application also discloses a vaccine containing the mRNA.

[0015] In the vaccine, a liposome is further included, and the mRNA is encapsulated in the liposome.

[0016] The application has the following beneficial effects:

[0017] The application isolates and obtains a 2.3.4.4h branch H5N6 subtype avian influenza virus (AIV) strain through epidemiological monitoring and sample collection of live poultry markets in multiple regions of the country. Through sequence analysis and phylogenetic tree construction, it is identified that it belongs to the 2.3.4.4h branch, and by preparing antisera of representative strains of different branches and analyzing the antigenic variation of H5N6 subtype, it can be concluded that the antisera of the isolated strain (A / chicken / Gansu / 28 / 2024) has relatively good reactivity with other strains, and has poor reactivity with the current vaccine strain RE-13, and the branch strain is the current epidemic strain, so CK / GS / 28 / 24 can be selected as a candidate strain for preparing a 2.3.4.4h branch H5N6 subtype vaccine.

[0018] The mRNA vaccine prepared in the application has better protection effect than the same kind of vaccine on the market in the challenge protection experiment, and the lung virus titer is significantly lower than that of the positive control group on the third day after challenge. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 It is a genetic evolution diagram of the HA gene of the 2.3.4.4h branch H5N6 subtype influenza virus.

[0020] Figure 2 It is an antigenicity result of the 2.3.4.4h branch H5N6 subtype virus, which verifies the antigenicity of A / chicken / Gansu / 28 / 2024 and Re13 vaccine strains, respectively.

[0021] Figure 3 is the antigenic profile of the 2.3.4.4h branch H5N6 subtype virus, which is plotted based on the hemagglutination inhibition (HI) test data in Figure 2

[0022] Figure 4 is the plasmid map of the mRNA template plasmid;

[0023] Figure 5 is the column chart of antibody titers of immunized chickens;

[0024] Figure 6 is the column chart of ELISpot detection of the level of cellular immunity induced by the mRNA vaccine;

[0025] Figure 7 is the survival rate result chart of the challenge experiment chickens;

[0026] Figure 8 is the lung virus titer detection result chart on the 3rd day after challenge. DETAILED DESCRIPTION

[0027] The advantages and features of the present application will become more apparent with the description. However, these examples are only exemplary and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that the details and forms of the technical solutions of the present application can be modified or replaced without departing from the spirit and scope of the present application, and such modifications and replacements all fall within the protection scope of the present application.

[0028] Example 1 Strain screening and HA gene acquisition

[0029] (1) Strain collection and screening

[0030] Through epidemiological monitoring and sample collection in multiple regions of the country, 2.3.4.4h branch H5N6 subtype avian influenza virus (AIV) strains were isolated and obtained. At the same time, the HA gene sequences of the 2.3.4.4h branch H5N6 subtype viruses prevalent in recent years were obtained from the GISAID database for subsequent research.

[0031] (2) Virus amplification and total RNA extraction

[0032] Each isolated strain was inoculated into the allantoic cavity of 10-11 day old SPF chicken embryos, and after 48-72 h, the supernatant of the chicken embryo allantoic fluid was collected. The total RNA of the virus was extracted by using an RNA extraction kit, and the RNA purity (A260 / A280 value controlled at 1.8-2.1) and concentration were detected by NanoDrop TM

[0033] ​​(3) HA gene fragment amplification and cloning sequencing

[0034] Specific primer pairs were designed based on conserved regions of the HA gene in the target subtype, and the full-length or key functional fragments of the HA gene were amplified using a one-step RT-PCR system. The amplified products were identified by 1.0% agarose gel electrophoresis, purified by gel recovery, cloned into the pMD-19T vector or a similar cloning vector, and sent to a commercial sequencing platform for sequencing of the HA gene of the self-isolated strain using the Sanger dideoxy chain termination method.

[0035] (4) Sequence analysis and phylogenetic tree construction

[0036] Using the MAFFT online bioinformatics software, the nucleotide sequence of the HA gene of the obtained self-isolated strains was integrated and analyzed with reference sequences of the same subtype in databases such as GenBank. Multiple sequence alignment was performed using the Clustal W algorithm, and the best alternative model (such as GTR+G+I) was determined through model selection. A phylogenetic tree was constructed using Bayesian methods (100,000,000 iterations) to achieve genetic evolutionary grouping of different strains.

[0037] For details, please refer to [link / reference]. Figure 1 , Figure 1 This is a genetic evolution diagram of the HA gene of the H5N6 subtype influenza virus in the 2.3.4.4h branch; the red triangles represent the currently used inactivated vaccine strains Re-13 (2.3.4.4h branch) and Re-14 (2.3.4.4b branch), and laboratory-isolated strains are represented by red strain names, with human-shaped icons representing strains isolated that have infected humans.

[0038] After comparison, the HA gene of the strain (A / chicken / Gansu / 28 / 2024) of this invention is consistent with the appendix. Figure 1 The HA gene of the human-infecting strains in 2.3.4.4h.2 shows mutations at position 59 (arginine R to glycine G), position 238 (arginine R to serine S), and position 323 (alanine A to serine S), suggesting that it may have undergone certain antigenic changes compared to the human-infecting strains. The HA gene of the present invention and the currently popular 2.3.4.4h.2 branch strains differ to some extent from the HA gene of the RE-13 virus of the 2.3.4.4h.1 branch of the vaccine strain introduced in 2021, suggesting that its antigenicity may have undergone significant variations.

[0039] Cross-HI test to verify antigen representativeness

[0040] Representative strains from each genetic group were selected, and high-titer whole-virus inactivated antigens were prepared. These antigens were then subjected to a cross-hemagglutination inhibition (HI) test with corresponding subtype reference sera, and the geometric mean titer (GMT) of the cross-reactivity HI was calculated. Based on the phylogenetic grouping results and antigen cross-reactivity characteristics, strains with representative antigenicity were screened and identified as the target strains used in this invention.

[0041] For details, please refer to [link / reference]. Figure 2 and Figure 3 ;

[0042] Figure 2 The antigenicity results of the H5N6 subtype virus of the 2.3.4.4h branch were used to verify the antigenicity of the A / chicken / Gansu / 28 / 2024 and Re13 vaccine strains, respectively.

[0043] Figure 3 This is the antigenic profile of the H5N6 subtype virus from branch 2.3.4.4h. This profile is based on... Figure 2 This graph was plotted based on hemagglutination inhibition (HI) assay data. Each coordinate unit in the graph represents a 2-fold difference in HI titer, which represents the antigenic distance. Boxes represent antiserum, and circles represent the detection virus used for antigen analysis.

[0044] (6) Representative strains from different branches were selected to prepare antiserum for analysis of antigenic changes in the H5N6 subtype. Based on... Figure 1 The 2.3.4.4h branch of the H5N6 subtype avian influenza virus gradually evolved into two sub-branches. From the phylogenetic tree, it can be seen that the currently prevalent 2.3.4.4h branch of the H5N6 subtype avian influenza virus has gradually evolved into the 2.3.4.4h.2 branch, which has a certain genetic evolutionary distance from the currently widely used RE-13 vaccine strain.

[0045] according to Figure 2 The antiserum of the isolated strain (A / chicken / Gansu / 28 / 2024) showed relatively good reactivity with other strains, but poor reactivity with the current vaccine strain RE-13. Furthermore, this branch strain is the currently circulating strain. Therefore, CK / GS / 28 / 24 can be selected as a candidate strain for the H5N6 subtype of the 2.3.4.4h branch for vaccine preparation.

[0046] The final representative strain was identified as: H5N6 (A / chicken / Gansu / 28 / 2024).

[0047] Example 2: HA gene optimization and mRNA template construction

[0048] (1) The codons of the above HA gene sequence were optimized using software such as GeneOptimizer or GenSmart. The HA gene sequence of H5N6 (A / chicken / Gansu / 28 / 2024) is shown in SEQ ID NO.1, and the codon-optimized HA gene sequence is shown in SEQ ID NO.2.

[0049] SEQ ID NO.1:

[0050] ATGGAGAAAATAGTACTTCTTCTTTCAGTGGTGAACCTTGTCAAAAGTGATCAGATTTGCATTGGTTACCATGCAAACAACTCGACAGAGCAGGTTGACACAATAATGGAAAAAAACGTCACTGTTACGCATGCTCAAGACATACTGGAAAAGACACACAACGGGAAGCTCTGCGGTTTGAATGGAGTGAAACCTTTGATTTTAAAGGATTGTAGTGTAGCTGGATGGCTTCTTGGAAACCCAATGTGCGACGAGTTCATCAGTGTGCCAGAATGGTCCTATATAGTGGAGAGGGTTAACCCAGCAAATGACCTCTGTTACCCAGGGAATCTCAATGACTATGAAGAGCTGAAACACCTATTGAGCAGGATAAATCATTTTGAGAAGACCCGGATCATCCCCAAGAATTCTTGGTCCAATCAT---ACATCATCCGGGGTGAGCGCAGCATGTCCATACCAAGGAAATGCCTCCTTTTTTAGAAACGTGGTGTGGCTTACCAAAAAGAATGATGCATACCCGACAATAAAGATGAGCTACAATAATACCAATAAAGAAGATCTTTTGATACTGTGGGGAATCCATCATTCCAACAGTGCAGAGGAGCAGACAAAACTCTACAAGAACCTAATCACTTATGTCTCTGTTGGGACATCAACATTAAACCAGAGGTTGGTGCCAAAAATAGCTACTAGGTCCCAAGTAAATGGGCAAAGTGGAAGAATGGATTTCTTCTGGACAATGTTGAAACCGAATGATGCAATCCACTTCGAGAGCAATGGAAATTTTATCGCCCCAGAATATGCATACAAAATTATCAAGACTGGAGACTCAACAATTATGAAAAGTGAAATAGAATATGGTCACTGCAACACCAAGTGTCAAACTCCAATAGGGGCGATAAACTCTAGTATGCCATTCCACAATATACATCCTCTCACTATCGGGGAGTGCCCCAAATATGTGAAATCAAACAAATTAGTCCTTGCAACTGGGCTCAGAAATAGTCCTCTAAGAGAAAGAAGAAGGAAAAGAGGACTGTTTGGAGCTATAGCAGGATTTATAGAGGGAGGATGGCAAGGAATGGTAGATGGTTGGTATGGGTACCACCATAGTAATGAACAGGGAAGTGGGTATGCTGCAGACAGAGAATCCACCCAAAAGGCAATAGATGGAGTCACT;

[0051] SEQ ID NO.2:

[0052] ATGGAAAAAATAGTATTATTGCTATCAGTTGTCAACCTGGTCAAGAGCGATCAGATTTGTATTGGCTATCACGCCAACAACTCGACCGAACAAGTTGATACCATCATGGAAAAAAATGTAACTGTTACACATGCACAGGATATTCTTGAGAAGACCCACAACGGCAAATTATGCGGTTTGAACGGTGTGAAGCCGCTGATTTTGAAGGACTGCAGCGTAGCTGGCTGGCTGCTTGGTAACCCGATGTGTGATGAATTCATCTCCGTGCCGGAATGGTCATACATTGTGGAGCGTGTTAATCCGGCAAACGACCTGTGTTATCCGGGTAACCTTAACGACTACGAAGAGCTGAAGCACCTGCTGTCCCGTATTAACCATTTCGAGAAAACCAGAATCATTCCAAAAAATTCCTGGAGCAACCACACTAGCTCCGGCGTTAGCGCCGCGTGCCCGTATCAAGGCAACGCCAGCTTTTTCCGCAACGTGGTGTGGCTGACCAAAAAAAACGACGCTTACCCGACCATCAAAATGAGCTACAACAATACGAATAAGGAGGACCTGCTGATCTTATGGGGTATTCACCACAGCAATTCCGCGGAAGAGCAAACGAAGTTGTACAAAAATCTAATCACCTACGTTTCCGTGGGTACGAGCACGCTGAACCAGCGTTTGGTGCCTAAAATTGCGACCCGTAGCCAGGTGAACGGCCAGAGCGGCCGTATGGATTTTTTCTGGACCATGCTGAAGCCGAATGACGCGATCCACTTTGAGTCGAACGGTAATTTTATCGCTCCGGAATATGCATATAAAATCATCAAGACCGGTGATTCTACGATCATGAAAAGCGAAATTGAGTATGGCCATTGTAACACCAAGTGCCAGACCCCGATTGGAGCCATCAATAGTTCTATGCCGTTTCATAACATTCATCCGCTCACGATCGGTGAATGCCCGAAATACGTGAAGAGCAACAAGTTGGTTCTGGCAACCGGTTTAAGAAACTCACCGCTGCGTGAACGCCGTCGCAAGCGTGGTCTGTTTGGTGCGATTGCGGGTTTCATCGAAGGTGGTTGGCAGGGTATGGTTGATGGTTGGTATGGCTACCATCACTCTAACGAGCAAGGCTCTGGTTACGCTGCGGACCGTGAGTCGACCCAGAAGGCGATCGACGGCGTGACCAATAAGGTTAATTCTATTATCGACAAAATGAACACCCAATTCGAGGCGGTTGGTCGTGAGTTTAATAATTTAGAACGCCGTATCGAGAACTTGAATAAAAAAATGGAGGACGGCTTCCTGGATGTCTGGACGTACAACGCGGAATTGCTGGTGCTGATGGAAAACGAGCGCACCTTGGACTTCCACGATTCTAACGTTAAGAACCTGTACGACAAAGTTCGTCTGCAACTGCGTGATAACGCTAAAGAACTGGGTAATGGCTGCTTTGAGTTCTATCATAAATGCGACAATGAGTGCATGGAGTCTGTCCGCAATGGCACTTACGATTATCCACAGTATAGCGAAGAAGCACGTCTCAAGCGCGAGGAGATCAGCGGTGTTAAACTGGAGTCGATCGGCACCTACCAAATTTTGTCTATTTATAGCACCGTGGCGAGCTCCCTGGTGCTGGCGATTATCGTGGCGGGCCTGAGCCTGTGGATGTGCAGCAACGGTAGCCTCCAGTGTCGTATCTGCATTTAA

[0053] (2) Link the T7 promoter and the optimized 5′ untranslated region (5′UTR) to the 5′ end of the codon-optimized HA gene sequence, link the 3′ untranslated region (3′UTR) to its 3′ end and add a poly(A) tail of no less than 100 nucleotides.

[0054] (3) After synthesizing the above sequence, clone it into the pUC57 vector to construct the mRNA template plasmid; refer to the plasmid map of the mRNA template plasmid. Figure 4 .

[0055] (4) After the plasmid is transformed and amplified by the strain, it is linearized by restriction enzyme and purified and recovered by agarose gel electrophoresis to obtain the linearized plasmid.

[0056] Example 3: Preparation of mRNA through in vitro transcription

[0057] (1) Using linearized plasmids as templates, an in vitro transcription reaction system was prepared:

[0058] Template DNA: 1 μg

[0059] T7 RNA polymerase: 2 μL

[0060] NTP mixture (containing pseudouridine): 4 μL

[0061] 10× reaction buffer: 2 μL

[0062] RNase inhibitor: 0.5 μL

[0063] RNase-free water: Add to a final volume of 20 μL;

[0064] (2) After incubating at 37℃ for 2-4 hours, add DNase I and react for 30 minutes to digest the template DNA.

[0065] (3) Purify mRNA using silica membrane method or LiCl precipitation method.

[0066] (4) Purified mRNA concentration and quality detection (Nanodrop 2000 and agarose gel electrophoresis to detect integrity).

[0067] The nucleotide sequence of the mRNA is shown in SEQ ID NO.3.

[0068] SEQ ID NO.3:

[0069]

[0070] Example 4: Preparation of lipid nanoparticles (LNPs) and mRNA encapsulation

[0071] (1) Liposome allocation method:

[0072] Ionized lipids (DLin-MC3-DMA, Aivitol (Shanghai) Pharmaceutical Technology Co., Ltd.): 50 mol%

[0073] DOPC (Xi'an Ruixi Biotechnology): 10 mol%

[0074] Cholesterol: 38.5 mol%

[0075] PEG2000-C-DMG (Aivert (Shanghai) Pharmaceutical Technology Co., Ltd.): 1.5 mol%; dissolved in anhydrous ethanol to prepare the lipid phase.

[0076] (2) Mix the above-mentioned 2.3.4.4h branch H5N6 subtype mRNA in citrate buffer (pH=4.0) to prepare an aqueous phase.

[0077] (3) Microfluidic mixing preparation of LNP:

[0078] Microfluidic devices: NanoAssemblr TM system

[0079] The flow rate ratio (aqueous phase: lipid phase) was 3:1, and the total flow rate was approximately 12 mL / min.

[0080] Ethanol was removed immediately by dialysis to obtain the initial LNP suspension.

[0081] (4) Concentrate LNP to the target concentration by ultrafiltration and sterilize and filter (0.22μm filter membrane) to obtain the final product.

[0082] (5) Quality control: Particle size and PDI detection (target: particle size 60–120 nm, PDI < 0.15); mRNA encapsulation rate (target ≥ 90%); store the vaccine final product at -80℃ for later use.

[0083] Performance testing

[0084] Immunization and immunogenicity verification of mRNA vaccines

[0085] (1) Laboratory animals and grouping

[0086] Fifteen 4-week-old SPF chicks were selected and randomly divided into 3 groups of 5 chicks each, as follows:

[0087] Vaccine group: vaccinated with the 2, 3, 4, and 4h branch H5N6 subtype mRNA-LNP vaccine of this invention;

[0088] Negative control group: Inoculated with an equal amount of empty vector LNP (without mRNA);

[0089] Positive control group: vaccinated with commercially available inactivated vaccines.

[0090] (2) Immunization schedule

[0091] The vaccine group was immunized via intramuscular injection (leg muscle), with each chick receiving a dose of 100μL (containing a total of 2μg of mRNA from each subtype);

[0092] The first immunization was given on day 14, followed by a booster immunization 21 days later, with the same dosage and route of administration as the first immunization.

[0093] Both the negative and positive control groups were simultaneously inoculated with the corresponding reagents and treated in the same manner.

[0094] (3) Immunogenicity test

[0095] Blood samples were collected weekly after immunization to measure HI (humoral immunity), and peripheral blood lymphocytes were isolated from chickens two weeks after booster immunization to detect ELISpot (cellular immunity).

[0096] refer to Figure 5 and Figure 6 , Figure 5 A bar chart showing the antibody titers of immunized chickens; Figure 6 A bar chart for ELISpot to detect the level of cellular immunity induced by mRNA vaccines.

[0097] Vaccine efficacy verification

[0098] (1) Design of challenge experiment

[0099] Twenty-one days (35 days) after booster immunization, chickens in the vaccine group, negative control group, and positive control group were challenged with homologous virus strains:

[0100] H5N6 strain (A / chicken / Gansu / 28 / 2024): Intranasal challenge, dose 10 6 EID50 / each;

[0101] The blank control group was not challenged with the virus and served as a healthy control.

[0102] (2) Monitoring of indicators after challenge

[0103] Clinical symptom observation: Observe continuously for 14 days, record the mental state, appetite, respiratory symptoms and mortality of chickens, and calculate the protection rate of each group (protection rate = number of survivors / total number of challenges × 100%).

[0104] Figure 7The image shows the survival rate of chickens in the challenge experiment. Viral load was measured by taking samples of the chickens' lung tissue on the 3rd day after challenge and determining the TCID50.

[0105] Figure 8 This is a graph showing the results of viral titer testing in the lungs on the 3rd day after infection.

[0106] Results and Discussion: Based on nationwide multi-regional epidemiological surveillance, this invention isolated and identified the H5N6 subtype strain A / chicken / Gansu / 28 / 2024 from live poultry markets (branch 2.3.4.4h). Phylogenetic analysis showed that this strain has a significant genetic distance from the current vaccine strain Re-13 and has gradually evolved into new subbranchs; its antigenic characteristics are more representative of the current mainstream circulating strain. Cross-HI assays further showed that the cross-reactivity of this strain with Re-13 was significantly low, suggesting that the protective range and efficacy of the existing vaccine strain are insufficient.

[0107] This invention also compared this strain with human infection strains from Fujian Province in recent years, and the results showed that the two strains differ at key amino acid sites, which may lead to changes in antigenic epitope conformation and thus affect antibody recognition. At the same time, this strain and the Re-13 vaccine strain showed differences at multiple amino acid sites in the HA protein, further confirming the inadequacy of existing vaccine strains in antigen matching.

[0108] In immunogenicity validation, the mRNA-LNP vaccine constructed based on the A / chicken / Gansu / 28 / 2024HA gene provided by this invention can simultaneously activate humoral and cellular immune responses. ELISA test results showed that the T-cell response induced by this vaccine was significantly higher than that of the inactivated vaccine group; the HI titer was maintained for a longer time and at a higher level. Challenge experiments showed that the vaccine described in this invention can significantly reduce viral load in the lungs and exhibits superior protective efficacy compared to commercially available inactivated vaccines.

[0109] In summary, the mRNA vaccine of this invention solves the technical problems of existing vaccines, such as insufficient antigen matching, single immune type, and limited protective effect. It has a broader spectrum of antigen representativeness and a superior protective effect, providing a new and feasible technical solution for the effective prevention and control of highly pathogenic avian influenza of the 2, 3, 4, and 4h branches of the H5N6 subtype.

Claims

1. An mRNA, characterized in that, The nucleotide sequence is shown as SEQ ID NO.

3.

2. A production method for producing the mRNA according to claim 1, characterized in that The method comprises the following steps: Step 1: cloning the codon-optimized HA gene into a vector to obtain a plasmid; Step 2: linearizing the plasmid to obtain a linearized plasmid; Step 3: transcribing and purifying the linearized plasmid to obtain mRNA; the nucleotide sequence of the codon-optimized HA gene is shown as SEQ ID NO.

2.

3. Use of the mRNA of claim 1 in the preparation of a vaccine, wherein the vaccine is an avian vaccine.

4. Use of the mRNA of claim 3 in the preparation of a vaccine, wherein the vaccine is an avian influenza H5N6 virus vaccine.

5. Use according to claim 3, characterized in that, The avian is a chicken, a duck, a goose, a goose, a quail, a pigeon or a turkey.

6. A vaccine comprising a polynucleotide of claim 1. The mRNA comprises the mRNA of claim 1.

7. The vaccine of claim 6, characterized in that, The mRNA is further encapsulated in a liposome.

Images