Application of rice phosphatase PP2A-A and coding gene thereof in rice disease-resistant breeding

By overexpressing the phosphatase PP2A-A gene in rice, the problems of pesticide resistance and resource scarcity in the control of rice blast by chemical pesticides have been solved, achieving efficient regulation of rice resistance to rice blast and promoting the breeding of disease-resistant varieties and food security.

CN121344059APending Publication Date: 2026-01-16SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511670833.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-14
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

Current technologies rely on chemical pesticides to control rice blast, which pose risks such as pathogen resistance evolution and environmental impact. Furthermore, the scarcity of resistance gene resources makes it difficult to cultivate highly efficient disease-resistant rice varieties.

Method used

A new method for breeding disease-resistant rice was developed by using rice phosphatase PP2A-A and its encoding gene to regulate rice blast resistance through overexpression vectors.

Benefits of technology

It significantly improves rice resistance to rice blast, provides novel molecular breeding targets, lays the foundation for breeding high-quality, multi-resistant rice varieties, and ensures food security.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344059A_ABST
    Figure CN121344059A_ABST
Patent Text Reader

Abstract

The invention discloses application of rice phosphatase PP2A-A and a coding gene thereof in rice disease-resistant breeding, and belongs to the technical field of gene engineering. According to the invention, an overexpression vector of the rice phosphatase PP2A-A gene is constructed, the vector is transferred into a Kitaake receptor material to obtain a PP2A-A overexpression plant, and the obtained transgenic plant is subjected to disease resistance analysis, and the result shows that the overexpression PP2A-A gene significantly improves the resistance level of rice to rice blast, which indicates that the PP2A-A positively regulates the disease resistance of the plant, and the rice blast resistance is significantly improved. The coding gene PP2A-A can be used as a target gene for improving plant disease resistance, has a good application prospect in cultivation of disease-resistant rice varieties, and lays an important foundation for rice resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of rice phosphatase PP2A-A and its encoding gene in rice disease resistance breeding. Background Technology

[0002] Rice, as the world's most important staple crop, is directly related to global food security and the sustainable development of the agricultural economy due to its stable and high yields. However, rice blast, known as "rice cancer," is the most devastating fungal disease, causing up to 30% yield loss annually and seriously threatening my country's food security system. While the current control model relying on chemical pesticides can be effective in the short term, long-term use can easily lead to the evolution of pesticide resistance in pathogens and cause environmental risks such as soil microecological imbalance. In contrast, breeding disease-resistant varieties, as a core control strategy that combines environmental friendliness and economic benefits, can not only reduce pesticide use but is also a key breakthrough in building a green control system and promoting sustainable agricultural development.

[0003] Based on this, this invention focuses on rice germplasm resource innovation, systematically mining disease-resistant genetic genes with independent intellectual property rights to overcome the technical bottleneck of scarce existing resistance gene resources. The results not only provide novel molecular breeding targets for the control of rice blast and other fungi, but also lay the theoretical foundation and technical reserves for cultivating a new generation of high-quality, multi-resistant rice varieties, which has significant practical value for ensuring national food security. Summary of the Invention

[0004] The purpose of this invention is to provide the application of rice phosphatase PP2A-A and its encoding gene in rice disease resistance breeding, so as to solve the problems existing in the prior art. PP2A-A positively regulates rice blast resistance, and this invention lays an important foundation for rice resistance breeding.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides the application of rice phosphatase PP2A-A in any of the following:

[0007] (1) Application in regulating rice blast resistance;

[0008] (2) Application in the preparation of products that regulate rice blast resistance;

[0009] (3) Application in rice breeding for resistance to rice blast;

[0010] (4) Application in the cultivation of rice resistant to rice blast;

[0011] The amino acid sequence of the rice phosphatase PP2A-A is shown in SEQ ID NO.2.

[0012] This invention also provides the application of the gene encoding rice phosphatase PP2A-A in any of the following:

[0013] (1) Application in regulating rice blast resistance;

[0014] (2) Application in the preparation of products that regulate rice blast resistance;

[0015] (3) Application in rice breeding for resistance to rice blast;

[0016] (4) Application in the cultivation of rice resistant to rice blast;

[0017] The nucleotide sequence of the encoding gene PP2A-A is shown in SEQ ID NO.1.

[0018] This invention also provides the use of recombinant vectors containing the encoding gene PP2A-A in any of the following:

[0019] (1) Application in regulating rice blast resistance;

[0020] (2) Application in the preparation of products that regulate rice blast resistance;

[0021] (3) Application in rice breeding for resistance to rice blast;

[0022] (4) Application in the cultivation of rice resistant to rice blast;

[0023] The nucleotide sequence of the encoding gene PP2A-A is shown in SEQ ID NO.1.

[0024] The present invention also provides the use of a host bacterium containing a recombinant vector in any of the following:

[0025] (1) Application in regulating rice blast resistance;

[0026] (2) Application in the preparation of products that regulate rice blast resistance;

[0027] (3) Application in rice breeding for resistance to rice blast;

[0028] (4) Application in the cultivation of rice resistant to rice blast;

[0029] The recombinant vector is a vector that integrates the coding gene PP2A-A into the genome, and the nucleotide sequence of the coding gene PP2A-A is shown in SEQ ID NO.1.

[0030] Preferably, the regulation is positive regulation.

[0031] The present invention also provides a method for regulating rice blast resistance, comprising the step of overexpressing the PP2A-A gene in rice to improve the rice's resistance to rice blast;

[0032] The nucleotide sequence of the PP2A-A gene is shown in SEQ ID NO.1.

[0033] The present invention also provides a method for breeding rice resistant to rice blast, comprising the steps of overexpressing the PP2A-A gene in rice, increasing the expression level of the PP2A-A gene, and obtaining rice resistant to rice blast.

[0034] The nucleotide sequence of the PP2A-A gene is shown in SEQ ID NO.1.

[0035] The present invention discloses the following technical effects:

[0036] This invention constructs an overexpression vector for the rice phosphatase PP2A-A gene, transfers the vector into Kitaake recipient material, and obtains PP2A-A overexpressing plants. Disease resistance analysis of the obtained transgenic plants shows that overexpression of the PP2A-A gene significantly improves the resistance level of rice to rice blast, indicating that PP2A-A positively regulates plant disease resistance. The encoding gene PP2A-A can be used as a target gene to improve plant disease resistance, showing good application prospects in breeding disease-resistant rice varieties and laying an important foundation for rice resistance breeding. Attached Figure Description

[0037] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0038] Figure 1 The image shows the results of PP2A-A expression level detection in control and PP2A-A overexpressing plants.

[0039] Figure 2 The images show representative leaf pictures (A) and statistical results of lesion length (B) of the control and PP2A-A overexpressing plants 5 days after puncture and inoculation. Detailed Implementation

[0040] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0041] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0042] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0043] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0044] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0045] The rice variety Kitaake (a variety susceptible to rice blast) and the plant binary expression vector pRHVc-3×Myc used in this invention were provided by Professor Chen Xuewei of the State Key Laboratory of Sichuan Agricultural University.

[0046] The PP2A-A overexpression transgenic rice was developed by Boyuan Biotechnology Co., Ltd.

[0047] Total RNA Extraction Kit: Purchased from Invitrogen's TRIzol (catalog number 15596026).

[0048] Reverse transcription kit: HiScript III RT SuperMix for qPCR (+gDNA wiper) purchased from Vazyme (China), catalog number R323-01.

[0049] Homologous recombination kit: ClonExpress II One StepCloning Kit, catalog number C112-01, purchased from Vazyme (China).

[0050] The research of this invention shows that plants overexpressing PP2A-A are more resistant to rice blast, indicating that PP2A-A positively regulates rice resistance to rice blast and can be used as a target gene for molecular breeding to improve plant disease resistance. Specific research is illustrated in the following examples.

[0051] Example 1 Rice phosphatase PP2A-A and its clone

[0052] This invention screened a phosphatase PP2A-A in rice and designed amplification primers according to the reference gene sequence of the rice Nip (Nipponbare) genome: PP2A-AF: 5'-ATGGCTTCGATGGATGAGCC-3' (SEQ ID NO.3); PP2A-AR: 5'-TCAGCTTGACATCATGATTT-3' (SEQ ID NO.4).

[0053] Total RNA was extracted from Kitaake according to the instructions of the Total RNA Extraction Kit, and the total RNA was reverse transcribed into total cDNA using a reverse transcription kit.

[0054] Using total Kitaake cDNA as a template, a DNA band of approximately 1.76 kb was amplified using the primers described above. Sequencing confirmed that the band belonged to the transcription factor PP2A-A gene. The nucleotide sequence of the PP2A-A gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded PP2A-A protein is shown in SEQ ID NO.2.

[0055] SEQ ID NO.1:

[0056]

[0057] SEQ ID NO.2:

[0058] *

[0059] Example 2: Construction of PP2A-A overexpression transgenic rice

[0060] Using cDNA obtained by reverse transcription of total RNA from rice Nip as a template, the cloning primers were:

[0061] F: 5'-ATCCAGATCCAGTGGGATCC ATGGCTTCGATGGATGAGCCT -3' (SEQ ID NO.7);

[0062] R: 5'-GTAAGCTTGGTACCGAGCTC GCTTGACATCATGATTTGAT -3' (SEQ ID NO.8).

[0063] PCR reactions were performed on a PE9600 PCR instrument. The program was as follows: 95℃ pre-denaturation for 3 min; then 95℃ denaturation for 30 s, 58℃ annealing for 1 min, 72℃ extension for 2 min, for a total of 30-32 cycles; followed by 72℃ extension for 10 min; and storage at 4℃. PCR amplification yielded full-length PP2A-A cDNA.

[0064] The pRHVc-3×Myc vector was double-digested with BamHI and SacI to obtain a linearized vector. The recovered PCR product PP2A-A full-length cDNA was mixed with the linearized vector in the following mixture (2 μL DNA fragment, 2 μL linearized vector, 2 μL 5×CE II Buffer, 1 μL Exnase II, and 3 μL ddH2O, total volume 10 μL) and incubated at 37°C for 30 min for homologous recombination to obtain the pRHVc-PP2A-A-3×Myc recombinant vector.

[0065] The pRHVc-PP2A-A-3×Myc recombinant vector was transformed into DH5α competent cells. After kanamycin selection, single clones were picked for colony PCR identification. Plasmids were extracted from positive colonies and sequenced to confirm that pRHVc-PP2A-A-3×Myc was correct and could be genetically transformed.

[0066] The PP2A-A overexpression transgenic rice was developed by Boyuan Biotechnology Co., Ltd. The expression level of the target gene was detected (primers used were: F: 5'-TCATGGGTGCCGAAATCACT-3', SEQ ID NO.5; R: 5'-GAGGCATGGTTTCACGTTCT-3', SEQ ID NO.6), and genetically stable overexpression plants PP2A-A-OE1 and PP2A-A-OE2 were screened. The results showed that the expression of the target gene in the overexpression plants was significantly increased compared to the wild-type plants. Figure 1 ).

[0067] Example 3: PP2A-A participates in regulating plant disease resistance

[0068] In plants, PP2A-A primarily functions in plant responses to abiotic stress. This invention reveals that PP2A-A plays a crucial role in regulating plant disease resistance. Therefore, the effect of the PP2A-A gene on disease resistance in rice was tested.

[0069] Treatment of seedlings by puncture and inoculation

[0070] The test materials were Kitaake and the genetically stable PP2A-A overexpression lines PP2A-A-OE1 and PP2A-A-OE2, which were based on Kitaake and were genetically stable.

[0071] Select plump seeds and place them in conical flasks filled with tap water. Germinate these in a 37°C dark incubator, changing the tap water daily. After two days, select seeds that have sprouted white leaves and place them in 96-well seedling trays. Place the trays on floats and grow them in Hoagland nutrient solution. After 21 days, select the second-to-last rice leaf that is of uniform growth and size, puncture it, and inoculate with 5 μL of a 3×10⁻⁶ concentration. 5 ml -1 The spores of *Strombus haematous* (Zhong10-8-14) were observed and the length of the lesions was counted after 5 days.

[0072] Statistical results show ( Figure 2 After inoculation with puncture wounds, compared with Kitaake, the lesion length of PP2A-A-OE1 and PP2A-A-OE2 plants under the Kitaake background was significantly reduced, and the disease resistance of the plants was enhanced. This indicates that PP2A-A positively regulates plant disease resistance, and its encoding gene PP2A-A can be used as a target gene for molecular breeding to improve plant disease resistance.

[0073] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Rice phosphatase PP2A-A is applied in any one of the following: (1) in the application of regulating rice blast resistance; (2) in the preparation of products for regulating rice blast resistance; (3) in the application of breeding rice resistant to blast; (4) in the application of cultivating rice resistant to blast; The amino acid sequence of the rice phosphatase PP2A-A is shown in SEQ ID NO.

2.

2. The coding gene PP2A-A of rice phosphatase PP2A-A is applied in any one of the following: (1) in the application of regulating rice blast resistance; (2) in the preparation of products for regulating rice blast resistance; (3) in the application of breeding rice resistant to blast; (4) in the application of cultivating rice resistant to blast; The nucleotide sequence of the coding gene PP2A-A is shown in SEQ ID NO.

1.

3. The recombinant vector containing the coding gene PP2A-A is applied in any one of the following: (1) in the application of regulating rice blast resistance; (2) in the preparation of products for regulating rice blast resistance; (3) in the application of breeding rice resistant to blast; (4) in the application of cultivating rice resistant to blast; The nucleotide sequence of the coding gene PP2A-A is shown in SEQ ID NO.

1.

4. The host bacteria containing the recombinant vector is applied in any one of the following: (1) in the application of regulating rice blast resistance; (2) in the preparation of products for regulating rice blast resistance; (3) in the application of breeding rice resistant to blast; (4) in the application of cultivating rice resistant to blast; The recombinant vector is a vector integrated in the genome of the coding gene PP2A-A, and the nucleotide sequence of the coding gene PP2A-A is shown in SEQ ID NO.

1.

5. Use according to any one of claims 1 to 4, wherein The regulation is positive regulation.

6. A method of modulating rice blast resistance, comprising, Including the step of overexpressing PP2A-A gene in rice to improve the resistance of the rice to blast; The nucleotide sequence of the PP2A-A gene is shown in SEQ ID NO.

1.

7. A method of breeding rice resistant to rice blast, characterized by, Including the step of overexpressing PP2A-A gene in rice to improve the expression of the PP2A-A and obtain rice resistant to blast; The nucleotide sequence of the PP2A-A gene is shown in SEQ ID NO. 1.