Application of pepper loc107841648 gene in improving plant waterlogging tolerance
By introducing the LOC107841648 gene from chili pepper into Arabidopsis thaliana, constructing an overexpression vector and infecting it, the problem of chili pepper's intolerance to waterlogging was solved, and the waterlogging tolerance of Arabidopsis thaliana plants under flood stress was improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GUIZHOU UNIV
- Filing Date
- 2025-11-25
- Publication Date
- 2026-04-10
AI Technical Summary
As a waterlogging-sensitive crop, chili peppers' intolerance to waterlogging has become a core bottleneck restricting their high-quality and high-yield production. Especially against the backdrop of global climate change, the risk of waterlogging has intensified, affecting the development of the industry.
The waterlogging tolerance of plants can be improved by introducing the LOC107841648 gene from pepper. The specific method involves constructing a plant overexpression vector containing the LOC107841648 gene from pepper, introducing it into Arabidopsis thaliana, infecting it using the flower immersion method, and screening to obtain transgenic plants with improved waterlogging tolerance.
Arabidopsis plants transgenic with the LOC107841648 gene exhibited lower relative electrical conductivity and higher relative chlorophyll content under flood stress, significantly improving the plant's flood tolerance and demonstrating stronger flood resistance.
Smart Images

Figure CN121344065B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and more particularly to chili peppers. LOC107841648 Application of genes in improving plant waterlogging tolerance. Background Technology
[0002] chili( Capsicum annuum Capsicum annuum (L.) is a representative crop of the Solanaceae family and the Capsicum genus. It has become one of the most widely cultivated and consumed spicy crops in the world, occupying an irreplaceable position in agricultural economy and food industry. Its fruit is rich in vitamin C (up to 144.6mg per 100g of fresh pepper), carotenoids, capsaicin, and other nutrients and bioactive substances. It is not only a key ingredient in regulating the flavor of food, but also shows broad application prospects in health fields such as anti-oxidation, anti-inflammation, and metabolic regulation. At the same time, it supports the development of a diversified product system such as hot sauce and functional foods.
[0003] Chili peppers are not only a pillar of the local economy but also an important link connecting different culinary cultures. Their industrial development directly impacts regional agricultural efficiency and farmers' income. However, the inherent characteristics of chili peppers—shallow roots and limited root volume—make them a typical waterlogging-sensitive crop, and their intolerance to waterlogging has become a core bottleneck restricting their high-quality and high-yield production. Against the backdrop of global climate change, the annual frequency of rain and flooding in chili pepper producing areas has exceeded 30%. In some areas, heavy clay soils and salinization caused by continuous cropping further exacerbate the risk of waterlogging. Under waterlogging stress, the gaseous phase of the soil is replaced by the liquid phase, causing chili pepper roots to rapidly fall into a state of oxygen deficiency. This forces them to initiate anaerobic respiration, producing toxic substances such as ethanol, leading to root rot and wilting within hours, and in severe cases, widespread death.
[0004] Systematic research on the response characteristics of chili peppers to flooding stress, screening and cloning flood-tolerant genes and clarifying their mechanisms of action can not only improve the molecular theory of chili pepper stress resistance, but also provide key technical support for the breeding of new flood-tolerant chili pepper varieties, which is of great practical significance for promoting the upgrading of stress-resistant cultivation in the chili pepper industry. Summary of the Invention
[0005] The purpose of this invention is to provide chili peppers LOC107841648 Application of genes in improving plant waterlogging tolerance.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] This invention provides chili peppers LOC107841648 The application of genes in improving the waterlogging tolerance of plants, specifically the pepper. LOC107841648 The CDS sequence of the gene is shown in SEQ ID NO.2.
[0008] Preferably, the chili pepper LOC107841648The nucleotide sequence of the gene is shown as SEQ ID NO. 1.
[0009] Preferably, the plants include Arabidopsis thaliana and Capsicum annuum.
[0010] The application provides a method for improving the waterlogging tolerance of plants, which comprises introducing a gene into Capsicum annuum. LOC107841648 The gene is introduced into target plants to obtain plants with improved waterlogging tolerance. LOC107841648 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the CDS sequence is shown as SEQ ID NO. 2.
[0011] Preferably, the plants include Arabidopsis thaliana and Capsicum annuum.
[0012] Preferably, the gene is introduced into the plants in the form of a plant overexpression vector. LOC107841648 The plant overexpression vector containing the gene of Capsicum annuum is introduced into target plants.
[0013] Preferably, the method for introducing is a flower dipping method.
[0014]
[0015] SEQ ID NO. 2: ATGGAAAGAAAAACAATGATCAGTACCAAGAAACTTATCAAAATGGCTAGGAGATGGCAGAAGTTTGCAGCCATGCAGAGGAAGAGGATCTCACTTACAAGAAATGGTAGTGATGCAGACAGTTGTAGTACGTCTTCACCCTCTATAGTCGGAAAAGGTCATTTTGTAGTATATACAATTGATCAAACACGCTTTGGGATTCCCTTGGAGTATCTTGAAAATGAGGTCATCAGGCAACTTCTAATCATATCCGAACAAGAGTTTGGCCTGTCAAGTGCTGGCCTCATTACATTACCCTGCGATTCATCCTTCATGGACTATATAATTTCACTTATCAAAAAAGGTGTAGCTGCAAGAGATCTTCACAAGGCGTTGCTCCTCTCAATTCCTTCATGTTGCTGTTCAATTTCTTCTTTGCAGCAAGAAAGTCAAAACCAGCAACTTCTTGTTTAT
[0016] Compared with the prior art, the present application has the following beneficial effects:
[0017] Through the waterlogging stress experiment, it is found that the Arabidopsis thaliana plant with the overexpressed Capsicum annuum gene can reduce the relative conductivity and improve the relative chlorophyll content after waterlogging stress, which shows that the overexpressed Capsicum annuum gene can obviously improve the waterlogging tolerance of the plant, and is an excellent gene for plant waterlogging tolerance genetic breeding. LOC107841648 LOC107841648 BRIEF DESCRIPTION OF DRAWINGS
[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced below. Obviously, the drawings in the following description are only embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of the provided drawings.
[0019] Figure 1 Figure 1 is a structural map of the pEGOEPubi-H-LOC107841648-GFP vector.
[0020] Figure 2 Enzyme cutting map of pEGOEPubi-H-LOC107841648-GFP vector;
[0021] Figure 3 Expression detection results of LOC107841648 in wild type Arabidopsis and transgenic Arabidopsis L1, L2 and L3 plants;
[0022] Figure 4 State diagrams of transgenic Arabidopsis and wild type Arabidopsis before flooding, 2 days after flooding and 1 day after recovery;
[0023] Figure 5 Relative conductivity of transgenic Arabidopsis and wild type Arabidopsis before flooding, 2 days after flooding and 1 day after recovery;
[0024] Figure 6 Relative chlorophyll content of transgenic Arabidopsis and wild type Arabidopsis before flooding, 2 days after flooding and 1 day after recovery;
[0025] Figure 7 Soluble sugar content of transgenic Arabidopsis and wild type Arabidopsis before flooding, 2 days after flooding and 1 day after recovery;
[0026] Figure 8 POD activity of transgenic Arabidopsis and wild type Arabidopsis before flooding, 2 days after flooding and 1 day after recovery. DETAILED DESCRIPTION
[0027] The technical solutions provided by the present application will be described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.
[0028] Example 1
[0029] 1. Construction of plant overexpression vector containing pepper LOC107841648 gene and transformation of Agrobacterium
[0030] 1.1 Primer design
[0031] LOC107841648-F (SEQ ID NO. 3): Actagggtctc Gcacc ATGGAAAGAAAAACAATGATCAGTACCAAGAAAC
[0032] LOC107841648-R (SEQ ID NO. 4): Actagggtctc Tcgcc ATAAACAAGAAGTTGCTGGTTTTGACTTTCT
[0033] UBI-F (SEQ ID NO. 5): TTAGCCCTGCCTTCATACGC
[0034] eGFP-cx (SEQ ID NO. 6): GACACGCTGAACTTGTGG
[0035] 1.2 Purpose fragment amplification and recovery
[0036] PCR amplification of the gene using primers as described in SEQ ID NO. 3 and SEQ ID NO. 4, the PCR reaction system is shown in Table 1, and the reaction conditions are shown in Table 2. LOC107841648
[0037] Table 1 PCR reaction system
[0038]
[0039] Table 2 PCR reaction conditions
[0040]
[0041] 1.3 Gel recovery
[0042] The PCR product was detected by agarose gel electrophoresis, and the correct electrophoretic fragment was cut off and recovered by using the agarose gel DNA recovery kit (DP209-03) of Tiangen Biochemical Technology Co., Ltd. The operation was carried out according to the instructions of the kit. The enzyme digestion and ligation reaction system used is shown in Table 3, and the reaction conditions are shown in Table 4.
[0043] Table 3 Enzyme digestion and ligation reaction
[0044]
[0045] Table 4 Enzyme digestion and ligation reaction parameters
[0046]
[0047] 1.4 Recombinant plasmid transformation
[0048] (1) Take a tube of 100 μL DH5a E. coli competent cells and mix with 2-5 μL ligation product, ice bath for 30 min;
[0049] (2) quickly put into 42℃ constant temperature water bath, heat shock for 90 s, ice bath for 2 min;
[0050] (3) add 500 μL LB liquid medium, mix well;
[0051] (4) 37℃, 200 rpm, cultivate for 45 min, so that the cells restore normal growth state;
[0052] (5) Spread the bacteria evenly on the Kana-resistant LB solid medium plate;
[0053] (6) After 30 min, place in a 37℃ constant temperature incubator and incubate overnight.
[0054] 1.5 Bacterial detection
[0055] Colony PCR detection was performed using UBI-F / eGFP-cx primers. The positive bacterial colonies were picked and shaken. The colony PCR detection system is shown in Table 5, and the colony PCR reaction conditions are shown in Table 6.
[0056] Table 5 Colony PCR amplification system
[0057]
[0058] Table 6 Colony PCR reaction conditions
[0059]
[0060] 1.6 Plasmid extraction:
[0061] (1) Single colonies were picked from the LB solid medium plate and inoculated into kanamycin-resistant LB liquid medium with a final concentration of 50 μg / mL, and incubated at 37℃ overnight;
[0062] (2) Take 4 mL of activated bacteria and centrifuge at 10000 rpm for 2 min at room temperature, and completely discard the supernatant;
[0063] (3) Take 250 μL of Solution I reagent containing ribonuclease A to completely resuspend the bacterial pellet;
[0064] (4) Take 250 μL of Solution II reagent to lyse the bacterial pellet, and gently invert several times until the bacterial body is transparent;
[0065] (5) Take 350 μL of Solution III reagent and invert several times until a white compact flocculent material is formed;
[0066] (6) Centrifuge at 12000 rpm for 10 min at room temperature, and take the supernatant;
[0067] (7) Take the nucleic acid purification column from the kit and place it on the collection tube;
[0068] (8) Take the clear supernatant from the above operation step (6) and centrifuge at 12000 rpm for 1 min at room temperature, and discard the filtrate;
[0069] (9) Take 500 μL of Buffer W1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;
[0070] (10) Take 700 μL of Buffer W2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;
[0071] (11) Repeat the above operation step (10);
[0072] (12) Place the nucleic acid purification column on the collection tube, centrifuge at 12000 rpm for 2 min at room temperature, and remove as much residual liquid as possible;
[0073] (13) Discard the collection tube, place the nucleic acid purification column in a 1.5 mL EP tube, and add 50 μL of elution buffer to elute the DNA attached to the nucleic acid purification column membrane (the elution buffer is preheated in a 65 ℃ constant temperature water bath to help elute the DNA), and stand at room temperature for 2 min;
[0074] (14) Centrifuge at 12000 rpm for 2 min at room temperature to elute the DNA attached to the nucleic acid purification column membrane, and store in a -40 ℃ low-temperature refrigerator for standby;
[0075] (15) Take a small amount of the recovered product and use a 1% agarose gel electrophoresis to detect the quality of the plasmid extraction.
[0076] 1.7 Sequencing
[0077] The plasmid extracted from the above positive plaque was subjected to Sanger sequencing using the sequencing primer UBI-F / eGFP-cx, and the sequencing result sequence was consistent with the sequence of the target fragment, indicating that the overexpression vector was successfully constructed.
[0078] The vector map of pEGOEPubi-H-LOC107841648-GFP constructed is shown in Figure 1 , and the enzyme digestion map of the vector is shown in Figure 2 (EcoRI / HindIII digestion: 8906 bp, 1524 bp, 2103 bp; Marker: 5000 bp, 3000 bp, 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp).
[0079] 1.8 Transformation of Agrobacterium
[0080] The constructed pEGOEPubi-H-LOC107841648-GFP vector was transformed into Agrobacterium GV3101 competent cells by freeze-thaw method, and the recombinant Agrobacterium was obtained.
[0081] 2. Infection of Arabidopsis thaliana
[0082] Arabidopsis thaliana was infected using the flower-dipping method. Arabidopsis thaliana The Colombian wild-type (Col-0) was obtained using the following method: 800 μL of antibiotic-free LB medium was added to a centrifuge tube containing recombinant Agrobacterium, and the tube was incubated at 28°C and 180 rpm for 2–3 h. The tube was then centrifuged at 5,000 rpm for 1 min to collect the bacterial cells. Approximately 700 μL of the supernatant was discarded, and the bacterial cells were gently resuspended using a pipette. Subsequently, the bacterial suspension was evenly spread on the surface of LB medium containing Rif and Kan. Invert the plates and incubate at 28℃ for 2-3 days. Single colonies are picked from the plates and transferred to LB liquid medium containing Rif and Kan resistance. After incubation at 28℃ and 180 rpm for 2-3 days, single colonies are picked and cultured. After PCR identification, bacteria are selected and propagated in LB liquid medium containing both Rif and Kan resistance until OD600 = 1.0-1.4. The bacterial weight is collected and placed in a 5% sucrose solution (prepared immediately). 0.01% of the surfactant Silwet L-77 is added, and the bacterial solution is adjusted to OD600 = 0.6-0.8. Healthy 4-week-old Arabidopsis plants are selected, and the pods are removed. The inflorescences are infected in the dark for 60 seconds, followed by 24 hours of dark treatment and then light cultivation. The plants are reinfected after one week, and the inflorescences are harvested when the pods mature.
[0083] T0 generation seeds were collected in dry centrifuge tubes, dried, and stored for later use. After soaking in 5% sodium hypochlorite for 5 minutes and rinsing 5 times with sterile water, they were sown on 1 / 2 MS solid medium containing hygromycin resistance for selection and cultured for approximately 10 days. Healthy, sterile seedlings were selected and transplanted into nutrient soil for cultivation to collect T1 generation seeds. These were then further selected using hygromycin resistance and planted to collect T2 generation seeds. Finally, homozygous T3 generation seeds were collected.
[0084] 3. Obtaining Arabidopsis thaliana plants
[0085] The obtained T3 generation Arabidopsis seeds were placed in 1.5 mL centrifuge tubes with 1 mL of distilled water, and then vernalized at 4℃ for 3 days before being planted. The planted Arabidopsis were then placed in a long-day culture chamber (16 h light / 8 h dark, 22℃), and watered every 2 days. After 30 days, the sequence number of each Arabidopsis plant was marked, and leaf DNA was extracted from each plant for PCR detection. A total of 10 transgenic lines were obtained. qRT-PCR was used to detect and analyze the homozygous T3 generation transgenic lines. LOC107841648 Expression levels in each strain were determined, and three plants with high expression (L1, L2, L3) were selected for later analysis.
[0086] The method used for extracting DNA is CTAB method, the specific steps are as follows: ① take 2-3 fresh Arabidopsis thaliana leaves, quickly put into 2mL centrifuge tube containing steel beads which is frozen by liquid nitrogen, after grinding by ball mill, add mixed solution (1mL CTAB and 200μL β-mercaptoethanol) which is preheated (65℃) into each tube, 65℃ water bath for 45min, mix once every 5min, 12000rpm, centrifuge for 10min. ② take supernatant, add equal volume of chloroform, mix and stand for 12min, 12000rpm, centrifuge for 10min. ③ repeat step ②, take supernatant, add 2 times volume of anhydrous ethanol, mix and put in-20℃, precipitate for 45min, the white solid at the bottom of the centrifuge tube is the genomic DNA precipitate, 12000rpm, centrifuge for 10min, discard the supernatant. ④ wash the DNA precipitate with 1mL 75% ethanol for 3 times, 12000rpm, centrifuge for 5min, discard the supernatant, and dry the precipitate at room temperature until it is translucent. ⑤ add 40μL ddH2O to dissolve the precipitate, and add 0.5μL RNase, stand at room temperature for 30min. ⑥ agarose gel electrophoresis, observe the band, detect the genomic DNA, and store the DNA at-20℃ for standby.
[0087] The primer UBI-F and eGFP-cx are used for PCR detection, the detection system is shown in table 7, and the detection procedure is shown in table 8.
[0088] Table 7 PCR detection system
[0089]
[0090] Table 8 PCR detection procedure
[0091]
[0092] The primers used for qRT-PCR detection are as follows:
[0093] F: CCTGTCAAGTGCTGGCCTCATTAC (SEQ ID NO. 7)
[0094] R: GAGAGGAGCAACGCCTTGTGAAG (SEQ ID NO. 8)
[0095] The primer for internal reference gene is as follows:
[0096] F: CTCCTTTGTTGCTGTTGACTAC (SEQ ID NO. 9)
[0097] R: GCACAATGTTACCGTACAGATC (SEQ ID NO. 10)
[0098] RNA was first extracted using the EZNA® Plant RNA Kit, and then reverse transcribed into cDNA using the Novizan kit before qRT-PCR detection. The detection system and procedure are shown in Tables 9-10.
[0099] Table 9 qRT-PCR detection system
[0100]
[0101] Table 10 qRT-PCR detection procedure
[0102]
[0103] qRT-PCR test results are as follows Figure 3 As shown, compared with wild-type Arabidopsis, L1, L2, and L3 plants... LOC107841648 The expression level in it increased significantly.
[0104] Example 2
[0105] Transgenic Arabidopsis thaliana (L1, L2, L3) and wild-type (WT) Arabidopsis thaliana seedlings were used as experimental materials. Arabidopsis thaliana seedlings with uniform growth were selected and submerged in water, with the water level reaching the boundary between the seedlings and the soil surface. After two days of submersion, the seedlings were removed and allowed to recover. Samples were taken at three time points: before submersion (0d, CK), two days after submersion (2d, T1), and one day after recovery (R1d, T2). 0.1g of sample was taken in each 2mL centrifuge tube. Photos were taken daily for observation. The experiment was repeated three times, with six seedlings measured in each replicate. Relevant growth and physiological indicators were measured.
[0106] 1. Phenotypic observation
[0107] like Figure 4 As shown, after flooding treatment, compared with WT, L1, L2, and L3 exhibited higher tiller numbers and plant height. Before flooding, both transgenic and wild-type Arabidopsis thaliana had green leaves, sturdy plants, and generally healthy growth. Two days after flooding, most of the leaves of wild-type Arabidopsis thaliana turned purple, became thinner, and began to curl, while transgenic Arabidopsis thaliana showed no significant changes. One day after recovery, the purple color of wild-type Arabidopsis thaliana faded, and the leaves turned yellow and wilted, while only a very few leaves of transgenic Arabidopsis thaliana turned yellow and curled. This indicates that transgenic Arabidopsis thaliana is more tolerant to flooding stress.
[0108] 2. Relative conductivity content
[0109] Relative conductivity content is an important bioelectrical indicator for assessing plant cell membrane damage, reflecting the integrity and permeability of the cell membrane. For example... Figure 5As shown, the relative conductivity content of WT was significantly higher than that of L1, L2 and L3 during T1 and T2 periods, indicating that the cell damage of WT after flooding treatment was significantly higher than that of transgenic material, suggesting that transgenic material has the ability to withstand flooding stress.
[0110] 3. Relative chlorophyll content
[0111] like Figure 6 As shown, there was no significant difference in chlorophyll content between transgenic and wild-type Arabidopsis thaliana before flooding stress treatment. However, after flooding stress, the chlorophyll content of both transgenic and wild-type plants showed a decreasing trend, with the decrease in wild-type plants being significantly greater than that in transgenic plants. After one day of recovery culture, the chlorophyll content of both transgenic and wild-type plants rebounded, with the chlorophyll content of transgenic plants being significantly higher than that of wild-type plants. This indicates that overexpression... LOC107841648 The genes enhanced the plant's ability to scavenge reactive oxygen species and accumulated higher chlorophyll content to resist flooding stress.
[0112] 4. Soluble sugar content
[0113] like Figure 7 As shown, there was no significant difference in soluble sugar content between transgenic and wild-type Arabidopsis thaliana before flooding stress treatment. After flooding stress, the soluble sugar content of both transgenic and wild-type plants showed an increasing trend, with the increase in transgenic plants being significantly greater than that in wild-type plants. One day after recovery culture, the soluble sugar content of both transgenic and wild-type plants continued to increase, and the soluble sugar content of transgenic plants was significantly higher than that of wild-type plants. This indicates that overexpression... LOC107841648 Genes can enable plants to accumulate more soluble sugars to resist flooding stress.
[0114] 5. Peroxidase (POD) activity
[0115] like Figure 8 As shown, there was no significant difference in POD activity between transgenic and wild-type Arabidopsis thaliana before flooding stress treatment. After flooding stress, the POD activity of both transgenic and wild-type plants showed an increasing trend, with the increase in transgenic plants being significantly greater than that in wild-type plants. One day after recovery culture, the POD activity of both transgenic and wild-type plants continued to increase, with the POD activity of transgenic plants being significantly higher than that of wild-type plants. This indicates that overexpression... LOC107841648 Genes can enable plants to increase POD activity to resist flooding stress.
[0116] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Overexpressing chili peppers LOC107841648 The application of genes in improving plant waterlogging tolerance is characterized by, The chili pepper LOC107841648 The gene sequence is shown in SEQ ID NO.2; the plant is Arabidopsis thaliana or pepper.
2. A method for improving the waterlogging tolerance of plants, characterized in that, chili peppers LOC107841648 Genes were introduced into the target plant to obtain plants with improved waterlogging tolerance; the pepper... LOC107841648 The gene sequence is shown in SEQ ID NO.2; the plant is Arabidopsis thaliana or pepper.
3. The method according to claim 2, characterized in that, The import will contain the chili peppers mentioned above. LOC107841648 Gene overexpression vectors are introduced into target plants.
4. The method according to claim 2, characterized in that, The method for importing the flowers is the flower immersion method.