Small extracellular vesicle membrane protein PD-L1 and miRNA-21 synchronous detection sensor based on aptamer mediated membrane fusion and application thereof

Abstract

The invention belongs to the technical field of biological detection, and relates to a synchronous detection sensor for small extracellular vesicle membrane proteins PD-L1 and miRNA-21 based on aptamer mediated membrane fusion and application of the synchronous detection sensor. The sensor comprises (1) a multifunctional liposome, a hairpin probe H1 and a hairpin probe H2 are encapsulated in the liposome, the surface of a liposome membrane is modified with an EpCAM nucleic acid aptamer and an auxiliary chain, and miRNA-21 in small extracellular vesicles, the hairpin probe H1 and the hairpin probe H2 form a first catalytic hairpin self-assembly system; (2) AptPD-L1-L with a hairpin structure, the AptPD-L1-L comprises a PD-L1 nucleic acid aptamer, a connecting arm, an auxiliary chain hybridization region and a partial excitation chain sequence which are sequentially connected from the 5'end to the 3 'end, and the partial excitation chain sequence and the 5' end of the auxiliary chain jointly form an excitation chain; and (3) a hairpin probe H3, a hairpin probe H4, the AptPD-L1-L, the auxiliary chain, the hairpin probe H3 and the hairpin probe H4 form a second catalytic hairpin self-assembly system. According to the invention, synchronous detection of miRNA-21 and membrane protein PD-L1 in sEVs is realized, and a new technical platform is provided for lung cancer liquid biopsy.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a sensor for the simultaneous detection of small extracellular vesicle membrane proteins PD-L1 and miRNA-21 based on aptamer-mediated membrane fusion and its application. Background Technology

[0002] Liquid biopsy is a non-invasive detection technique with advantages such as minimal invasiveness, ease of operation, and the ability to obtain samples repeatedly, making it highly advantageous in lung cancer screening and auxiliary diagnosis. The three main branches of liquid biopsy are circulating tumor cells (CTCs), circulating tumor DNA (ctDNA), and small extracellular vesicles (sEVs). Targeting sEVs for lung cancer detection offers advantages such as high sensitivity, strong specificity, simple sample collection, and the ability to dynamically monitor tumor progression.

[0003] Lung cancer-related biomarkers in sEVs mainly include sEV membrane proteins and membrane miRNAs. Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein with a relative molecular weight of 40 kDa, widely involved in various biological processes such as signal transduction and cell proliferation. It is a recognized tumor marker and is highly expressed in patients with lung cancer and other tumors, often used as a capture marker for sEVs. Programmed cell death ligand 1 (PD-L1) is a transmembrane glycoprotein with a relative molecular weight of 20–30 kDa. It is a conjugate factor for immune responses. The concentration of PD-L1 in sEV membrane proteins is significantly higher in lung cancer patients than in healthy individuals and is closely related to TNM stage and prognosis. The expression level of PD-L1 in sEVs is significantly higher in patients with advanced NSCLC than in early-stage patients, and patients with high expression have shorter overall survival. The miRNAs within sEVs are highly stable and can be used as diagnostic biomarkers for various cancers, such as lung cancer, pancreatic cancer, breast cancer, prostate cancer, and colon cancer. Unlike proteins, miRNAs primarily participate in tumor cell generation, proliferation, differentiation, metastasis, and immune responses through post-transcriptional regulation. Abnormal expression of miRNAs can reflect the disease status of tumors and the prognosis and outcome of cancer patients. miRNA-21 in sEVs is significantly highly expressed in the body fluids of lung cancer patients, and its expression level is positively correlated with TNM stage; that is, as the disease progresses, the expression level of miRNA-21 gradually increases, suggesting that it can serve as an important indicator for lung cancer screening and auxiliary diagnosis.

[0004] Although sEVs are promising biomarkers for lung cancer, no single molecular marker has yet been found that can accurately screen for lung cancer. Combining multiple sEV biomarkers, especially different types of sEV biomarkers, can provide comprehensive information on disease progression and improve the accuracy of lung cancer screening and auxiliary diagnosis. However, when detecting sEV biomarkers in actual samples, sEVs need to be isolated and purified first, followed by the detection of sEV-related proteins and miRNAs. Commonly used sEV membrane protein detection methods, such as Western blotting (WB) and ELISA, have limitations in terms of low detection sensitivity and difficulty in analyzing low levels of sEVs in the early stages of the disease (Wu X, Zhao H, Natalia A, et al. Exosome-templated nanoplasmonics for multiparametric molecular profiling[J]. Sci Adv, 2020, 6(19): eaba2556.). Unlike sEVs membrane proteins, miRNAs are distributed inside sEVs. The commonly used detection method is RT-PCR. The detection requires cleavage and nucleic acid extraction of sEVs extracted from actual samples. This is not only cumbersome but also causes degradation of miRNAs (Xie M, Wang F, Yang J, et al. DNA zipper mediated membrane fusion for rapide xosomal miRNA detection[J]. Anal Chem, 2022, 94(38): 13043-13051.;Zhao J, Zhang Y, Zhang X, et al. Mimicking cellular metabolism in artificial cells: Universal molecule transport across the membrane through vesicle fusion[J]. Anal Chem, 2022, 94(9): 3811-3818.). Given the heterogeneity and complexity of diseases, multiplex detection of different types of biomarkers in sEVs (such as simultaneous analysis of sEV proteins and miRNAs) can reveal the biological information of sEVs more comprehensively from different levels, thereby providing more comprehensive information on disease progression and improving the accuracy and specificity of disease diagnosis. In summary, there is an urgent need to develop new methods for the simultaneous detection of sEV membrane proteins and miRNAs with high sensitivity and specificity. Summary of the Invention

[0005] To achieve highly sensitive and specific simultaneous detection of sEV membrane proteins and miRNAs, this invention provides a sensor for the simultaneous detection of small extracellular vesicle membrane proteins PD-L1 and miRNA-21 based on aptamer-mediated membrane fusion and its applications. This invention utilizes liposome-encapsulated hairpin probe technology and an aptamer-mediated membrane fusion strategy to achieve simultaneous detection of miRNA-21 and membrane protein PD-L1 in sEVs, providing a new technological platform for liquid biopsy in lung cancer.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a sensor for the simultaneous detection of small extracellular vesicle membrane proteins PD-L1 and miRNA-21 based on aptamer-mediated membrane fusion, comprising:

[0008] (1) Multifunctional liposomes, wherein the multifunctional liposomes are obtained by encapsulating hairpin probes H1 and H2 inside the liposomes and modifying the EpCAM nucleic acid aptamer and auxiliary strand on the surface of the liposome membrane. The EpCAM nucleic acid aptamer can specifically bind to EpCAM on the surface of small extracellular vesicles. miRNA-21, hairpin probes H1 and H2 in the small extracellular vesicles form the first catalytic hairpin self-assembly (CHA) system.

[0009] In a further embodiment, the two ends of the hairpin probe H1 or hairpin probe H2 are connected to a fluorescent group and a fluorescence quenching group. Specifically, the two ends of the hairpin probe H1 are connected to a fluorescent group and a fluorescence quenching group, and its sequence is shown in SEQ ID NO:5; the sequence of the hairpin probe H2 is shown in SEQ ID NO:6.

[0010] The 5' end of the EpCAM aptamer is attached to cholesterol. Furthermore, the sequence of the EpCAM aptamer is shown in SEQ ID NO:7.

[0011] The 3' end of the auxiliary chain is attached to cholesterol, and its sequence is shown in SEQ ID NO:10.

[0012] The method for preparing the multifunctional liposomes includes:

[0013] Step 1: Liposomes were prepared by thin-film dispersion using 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine, cholesterol, distearate phosphatidylethanolamine-polyethylene glycol as raw materials.

[0014] Step 2: Anneal the hairpin probe H1 solution and hairpin probe H2 solution, then incubate them with the liposome solution and extrude them;

[0015] Step 3: Add EpCAM nucleic acid aptamer solution and auxiliary strand solution and incubate to obtain the final product.

[0016] In a further embodiment, the system for preparing multifunctional liposomes has an EpCAM nucleic acid aptamer concentration of 0.8 μmol / L, an auxiliary chain concentration of 1.2 μmol / L, and hairpin probes H1 and H2 concentrations of 6 μmol / L.

[0017] (2) Apt with hairpin structure PD-L1 -L, the Apt PD-L1 -L includes a PD-L1 nucleic acid aptamer, a linker arm, a helper strand hybridization region, and a partial excitation strand sequence connected sequentially from the 5′ end to the 3′ end. The PD-L1 nucleic acid aptamer can specifically bind to PD-L1 on the surface of small extracellular vesicles. The helper strand hybridization region can specifically bind to the helper strand through base complementary pairing. The partial excitation strand sequence and the 5′ end of the helper strand together form the excitation strand of the second catalytic hairpin self-assembly system.

[0018] The sequence of the PD-L1 aptamer is ACAGGTTCTGGGGGGTGGGGGGAACCTG. The linker arm consists of 15-25 T bases; in this embodiment, the number of T bases is 20. The sequence of the auxiliary strand hybridization region is AGGTTCC; the sequence of the partially excited strand sequence is CCGGAGAC. The Apt... PD-L1 The -L sequence is shown in SEQ ID NO:11.

[0019] The sequence of the excitation chain is CGATAGATGATTGACTCCGGAGAC.

[0020] (3) Hairpin probes H3 and H4. The Apt... PD-L1 -L, auxiliary chain, hairpin probe H3 and hairpin probe H4 form a second catalytic hairpin self-assembly system.

[0021] The hairpin probe H3 or hairpin probe H4 has a fluorescent group and a fluorescence quenching group connected to both ends. Specifically, the hairpin probe H3 has a fluorescent group and a fluorescence quenching group connected to both ends, and its sequence is shown in SEQ ID NO:12; the sequence of the hairpin probe H4 is shown in SEQ ID NO:13.

[0022] Secondly, the present invention provides the application of the above-mentioned sensor in the preparation of lung cancer detection kits.

[0023] The application includes the following steps:

[0024] Step 1: Introduce multifunctional liposomes and Apt... PD-L1- Add the extracted extracellular vesicles of the sample to be tested to the premixed solution of L, hairpin probe H3 and hairpin probe H4, and incubate;

[0025] Step 2: Fluorescence detection.

[0026] In a further solution, Apt is applied. PD-L1 The concentration of -L was 200 nmol / L, the concentrations of hairpin probes H3 and H4 were 400 nmol / L, and the concentration of multifunctional liposomes was 1.4 × 10⁻⁶. 7 particles / μL.

[0027] The beneficial effects of this invention are as follows:

[0028] 1. This invention prepares internally encapsulated hairpin probes and membrane-modified EpCAM nucleic acid aptamers (Apt). EpCAM A multifunctional liposome with a C-chol (sEV) and a C-chol (auxiliary chain) is developed. The EpCAM aptamer specifically recognizes target small extracellular vesicles (sEVs); an aptamer-mediated membrane fusion strategy balances the spatial distribution differences between sEV membrane proteins and miRNAs; the efficient signal amplification advantage of catalytic hairpin self-assembly enhances detection sensitivity; and a dual-fluorescence signal response system is designed to distinguish detection signals. This invention establishes a novel method for the simultaneous detection of sEV membrane proteins PD-L1 and miRNA-21, characterized by high sensitivity, strong specificity, and good accuracy. This method offers advantages such as one-step detection, no need for pre-extraction and lysis of sEVs, and avoidance of interference from free proteins and miRNAs in body fluids, demonstrating potential application value in lung cancer screening and auxiliary diagnosis.

[0029] 2. The method of this invention can be effectively used for lung cancer detection. Correlation analysis of the detection results of miRNA-21 and PD-L1 in plasma sEVs showed a moderate positive correlation between their expression (r = 0.413, P < 0.001), indicating that there may be a synergistic regulatory mechanism between the two in the lung cancer microenvironment, which can improve the reliability of liquid biopsy. ROC curve analysis of the application value of plasma sEVs biomarkers in lung cancer screening and auxiliary diagnosis showed that the area under the ROC curve (AUC) (95% CI) of individual sEVs miRNA-21 and PD-L1 detections were 0.909 (0.852-0.966) and 0.830 (0.763-0.897), respectively, both showing good distinguishing ability between lung cancer and non-lung cancer groups. The AUC (95% CI) of combined detection significantly increased to 0.931 (0.886-0.977), confirming that the combined detection strategy can effectively enhance the accuracy of lung cancer screening and auxiliary diagnosis. The above results confirm that quantitative analysis based on sEVs PD-L1 can assist in lung cancer screening, and its combined detection with miRNA-21 is expected to optimize diagnostic efficacy through cross-validation, providing new strategies and ideas for lung cancer screening and assisted diagnosis. Attached Figure Description

[0030] Figure 1 A schematic diagram illustrating the principle of simultaneous detection of sEVs membrane proteins PD-L1 and miRNA-21 based on aptamer-mediated membrane fusion.

[0031] Figure 2 sEVs characterization results: (A) TEM image of sEVs, with a scale bar of 100 nm; (B) NTA measurement results, with concentration on the vertical axis and size on the horizontal axis; (C) WB characterization results; (D) Laser confocal microscopy (CLSM) characterization results.

[0032] Figure 3 Liposome characterization results. Note: Figure (A) Tyndall effect characterization results; (B) TEM image of liposomes, scale bar is 100nm; (C) NTA measurement results, vertical axis is concentration, horizontal axis is particle size. Figure 4 Hydrated particle size and TEM characterization results of membrane fusion between Lip@H1 / H2-Apt / C and sEVs. Note: Figure (A) shows the hydrated particle size of the membrane fusion; (B) shows the TEM image of the membrane fusion, with a scale bar of 100 nm.

[0033] Figure 5FRET characterization results of membrane fusion between Lip-Apt / C and sEVs. Note: The vertical axis represents fluorescence intensity (FL), and the horizontal axis represents wavelength.

[0034] Figure 6 CLSM characterization results of membrane fusion. Note: (A, D) Laser confocal microscopy images of DiO-stained sEVs under DiO excitation; (B) Laser confocal microscopy image of DiI-labeled Lip-C under DiI excitation; (C) Overlay image of A and B; (E) Laser confocal microscopy image of DiI-labeled Lip-Apt / C under DiI excitation; (F) Overlay image of D and E. Scale bar is 5 μm.

[0035] Figure 7 Gel electrophoresis and fluorescence spectroscopy characterization of CHA-1. Note: Figure (A) Gel electrophoresis diagram of CHA-1: Lane 1: miRNA-21; Lane 2: H1; Lane 3: H2; Lane 4: H1+H2; Lane 5: miRNA-21+H1; Lane 6: miRNA-21+H2; Lane 7: miRNA-21+H1+H2; Lane 8: Marker. (B) Fluorescence spectrum of CHA-1, with the vertical axis representing fluorescence intensity (FL) and the horizontal axis representing wavelength (Wavelength).

[0036] Figure 8 CLSM characterization results of membrane fusion between Lip@H1 / H2-Apt / C and sEVs. Note: (A, B) Laser confocal microscopy images of DiI-stained Lip@H1 / H2-Apt / C under DiI and Atto 425 excitation; (C) Overlay image of A and B; (D, E) Laser confocal microscopy images of DiI-stained Lip@H1 / H2-Apt / C and sEVs under DiI and Atto 425 excitation; (F) Overlay image of D and E. Scale bar is 5 μm.

[0037] Figure 9 Fluorescence spectrum and gel electrophoresis characterization of CHA-2. Note: Figures (A, B) show the fluorescence spectra of CHA-2, with the vertical axis representing fluorescence intensity (FL) and the horizontal axis representing wavelength (Wavelength); Figures (C, D) show the gel electrophoresis diagrams of CHA-2. Figure C: Lane 1: Marker; Lane 2: Trigger; Lane 3: H3; Lane 4: H4; Lane 5: H3+H4; Lane 6: Trigger+H3; Lane 7: Trigger+H4; Lane 8: Trigger+H3+H4. Figure D: Lane 1: Marker; Lane 2: Apt PD-L1-L; Lane 3: C-chol; Lane 4: H3; Lane 5: H4; Lane 6: Apt PD-L1 -L+C-chol; Lane 7: Apt PD-L1 -L+H3; Lane 8: Apt PD-L1 -L+H4; Lane 9: Apt PD-L1 -L+H3+H4; Lane 10: C-chol+H3; Lane 11: C-chol+H4; Lane 12: C-chol+H3+H4; Lane 13: Apt PD-L1 -L+C-chol+H3; Lane 14: Apt PD-L1 -L+C-chol+H4; Lane 15: Apt PD-L1 -L+C-chol+H3+H4.

[0038] Figure 10 CLSM characterization of CHA-2 results. Note: (A, B) Laser confocal microscopy images of DiO-stained Lip-Apt / C under DiO and Cy5 excitation; (C) Overlay image of A and B; (D, E) Laser confocal microscopy images of DiO-stained Lip-Apt / C and sEVs under DiO and Cy5 excitation; (F) Overlay image of D and E. Scale bar is 5 μm.

[0039] Figure 11 Comparison of fluorescence signals between different experimental groups. (a): H1, (b): H3. Group 1: Apt PD-L1 -L+H3+H4, Group 2: Apt PD-L1 -L+H3+H4+Lip-C, Group 3: Apt PD-L1 -L+H3+H4+Lip@H1 / H2-Apt / C, Group 4: Apt PD-L1 -L+H3+H4+Lip@H1 / H2-Apt / C+sEVs. (A, B, C, D) The vertical axis represents fluorescence intensity (FL), and the horizontal axis represents wavelength (Wavelength).

[0040] Figure 12 CLSM characterization was used to simultaneously detect intracellular miRNA-21 and PD-L1 on the membrane surface of sEVs. Note: (A, D, G) Laser confocal microscopy images of Lip@H1 / H2-Apt / C, sEVs, and Lip@H1 / H2-Apt / C+sEVs groups under Atto 425 excitation; (B, E, H) Laser confocal microscopy images of Lip@H1 / H2-Apt / C, sEVs, and Lip@H1 / H2-Apt / C+sEVs groups under Cy5 excitation; (C, F, I) are superimposed images of A and B, D and E, and G and H, respectively. Scale bars are all 5 μm.

[0041] Figure 13 Standard curves for simultaneous detection of sEVs membrane proteins and miRNAs based on aptamer-mediated membrane fusion. Note: (A) is based on C. sEVs (A) Detection results of miRNA-21 in sEVs as the independent variable; (B) Standard curve for the detection of miRNA-21 in sEVs; (C) Using C as the independent variable. sEVs (A) Detection results of PD-L1 in sEVs (independent variable); (D) Standard curve for PD-L1 detection in sEVs. (A, B, C, D) The ordinate is fluorescence intensity (FL), and (A, C) The abscissa is sEVs concentration (C). sEVs (B, D) The horizontal axis represents the wavelength.

[0042] Figure 14 Specificity of beacon molecule H1 / H2 detection. Note: The vertical axis represents fluorescence intensity (FL), and the horizontal axis represents wavelength (Wavelength). Figure 15 Specificity assessment. Note: The concentrations of miRNA-21, miRNA-155, miRNA-486, Random, Albumin, GAPDH, CD146, SAA1, EpCAM, PD-L1, Liposomes, and sEVs were 500 nmol / L, 500 nmol / L, 500 nmol / L, 500 nmol / L, 1 μg / mL, 1 μg / mL, 400 nmol / L, 200 ng / mL, 1 μg / mL, 1 μg / mL, and 1.4 × 10⁻⁶, respectively. 7 particles / μL and 4×10 4 particles / μL. The left and right ordinates represent fluorescence intensity (FL).

[0043] Figure 16 , 4 Results of cell supernatant analysis. Note: The left and right vertical axes represent fluorescence intensity (FL).

[0044] Figure 17 Detection results of miRNA-21 and PD-L1 in plasma sEVs. Note: (A) Heatmap results of miRNA-21 detection in sEVs; (B) Heatmap results of PD-L1 detection in sEVs; (C) Comparison of miRNA-21 detection results in sEVs of the LC, NC, and BLD groups; (D) Comparison of PD-L1 detection results in sEVs of the LC, NC, and BLD groups. *** indicates P < 0.001 between the two groups; * indicates P < 0.05 between the two groups; ns indicates no significant difference between the two groups. (C, D) The vertical axis represents fluorescence intensity (FL).

[0045] Figure 18 ROC curves of the effects of miRNA-21 and PD-L1 in plasma sEVs on lung cancer and non-lung cancer classification. Detailed Implementation

[0046] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of the embodiments of this invention will be clearly described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0047] Example 1

[0048] 1. Test materials

[0049] 1,2-Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), cholesterol, and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DSPE-PEG) were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.; red fluorescent staining kit (DiI) and green fluorescent staining kit (DiO) for cell membranes were purchased from Shanghai Beyotime Biotechnology Co., Ltd.; reaction buffer (PBS-Mg) was used. 2+ Weigh 2.033g of MgCl2·6H2O, dissolve and mix it in 1L of 1×PBS, so that the Mg... 2+ The concentration was 10 mmol / L, and the cells were autoclaved and stored at 4°C. The lung adenocarcinoma cell line A549, lung squamous cell carcinoma cell line H520, large cell lung cancer cell line H460, and normal bronchial epithelial cell line BEAS-2B were all purchased from the Cell Bank of the Chinese Academy of Sciences.

[0050] Table 1. Nucleic Acid Names and Base Sequences

[0051]

[0052]

[0053] 2. Detection principle of this invention

[0054] The targeted multifunctional liposome (Lip@H1 / H2-Apt / C) constructed in this invention, consisting of a surface-modified nucleic acid aptamer and auxiliary strand, and an internally encapsulated hairpin probe, is first prepared by thin-film dispersion, and then the hairpin probes H1 and H2 are encapsulated within the liposomes. Simultaneously, the EpCAM nucleic acid aptamer Apt is modified on the surface of the liposome membrane. EpCAM -chol was used to specifically capture EpCAM on the surface of sEVs, and C-chol was modified into the auxiliary chain to obtain targeted multifunctional liposomes. Subsequently, hairpin probes H3 and H4 and Apt containing the PD-L1 aptamer were introduced into the targeted multifunctional liposome system. PD-L1 -L. When the target sEVs are EpCAM-positive, the EpCAM on their surface specifically binds to the EpCAM nucleic acid aptamer on the liposome surface, thereby initiating membrane fusion and forming a new vesicle structure. This process causes the contents of the liposomes to enter the sEVs, and under the activation of the target miRNA, the CHA-1 reaction (the first catalytic hairpin self-assembly system) is initiated, restoring the Atto425 fluorescence signal on H1. To avoid the influence of free proteins in body fluids, a hairpin-shaped Apt was designed. PD-L1 -L is used to detect the surface PD-L1 protein in sEVs, Apt PD-L1 -L consists, from the 5′ end to the 3′ end, a nucleic acid aptamer targeting PD-L1 (ACAGGTTCTGGGGGGTGGGGGGAACCTG), a 20-T linker arm, a C-chol hybridization region (AGGTTCC), and a portion of the excitation strand sequence of CHA-2 (the second catalytic hairpin self-assembly system). In its pristine state, Apt... PD-L1 -L exhibits a hairpin structure, with its C-chol hybridization region enclosed within the stem structure. Upon membrane fusion, the aptamer targeting PD-L1 specifically binds to the PD-L1 protein on the surface of sEVs, triggering the hairpin structure to unfold and exposing the C-chol hybridization region and part of the excitation strand sequence (CCGGAGAC). PD-L1 The -L C-chol hybridization region specifically binds to the auxiliary chain C-chol modified on the liposome surface through base complementary pairing. At this point, Apt... PD-L1 The 3' end of -L can form a CHA-2 excitation chain trigger with the 5' end of C-chol modified on the liposome surface, thereby activating the CHA-2 reaction of H3 and H4 probes, restoring the Cy5 fluorescence signal. By detecting the two fluorescence signals in the system, the method proposed in this invention can perform highly sensitive and specific analysis of the membrane protein PD-L1 and intramembrane miRNA-21 of sEVs. The detection principle is as follows: Figure 1 As shown.

[0055] 3. sEVs extraction

[0056] Lung adenocarcinoma cell line A549 was cultured using RPMI-1640 complete cell culture medium at a temperature of 37°C and a CO2 concentration of 5%. When the A549 cell density reached approximately 70%–80%, the RPMI-1640 cell culture medium supernatant was discarded, and the cells were washed three times with PBS. Then, FBS-free RPMI-1640 cell culture medium was added, and the cells were incubated for another 48–72 hours. After culture, differential centrifugation was used to remove impurities from the cell supernatant, yielding a sEVs solution.

[0057] Characterization of sEVs by TEM (transmission electron microscopy), NTA (particle concentration), WB (Western immunoblotting), and CLSM (confocal microscopy) is as follows: Figure 2 As shown, under TEM, cup-shaped vesicles with a particle size of 30–150 nm can be clearly observed; NTA results show that the particle concentration of the extracted sEVs is 1.25 × 10⁻⁶. 8 particles / μL; Western blotting results showed that the extracted sEVs contained sEV-specific marker proteins such as CD63, TSG101, HSP70, and Alix, as well as lung cancer-related proteins EpCAM and PD-L1. The rabbit anti-human CD63 antibody and rabbit anti-human EpCAM antibody used were purchased from Abcam; the mouse anti-human Alix antibody was purchased from Wuhan Sanying Biotechnology Co., Ltd.; and the mouse anti-human HSP70 antibody, mouse anti-human TSG101 antibody, and mouse anti-human PD-L1 antibody were purchased from Chengdu Zhengneng Biotechnology Co., Ltd. CLSM co-localization results showed that sEVs expressed EpCAM and PD-L1 proteins on their surface. The fluorescent probes Apt targeting EpCAM and PD-L1 used were... PD-L1 -TAMRA, Apt EpCAM -FAM is shown in Table 1. In summary, sEVs were successfully extracted from the supernatant of A549 cells using ultracentrifugation.

[0058] 4. Liposome preparation

[0059] 4.1 Preparation of blank liposomes

[0060] Liposomes were prepared using a thin-film dispersion method. 8.9 mg of 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 2.9 mg of cholesterol, and 1.7 mg of disteaaroyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DSPE-PEG) were accurately weighed and added to 1 mL of anhydrous ethanol. After sonication for 10 minutes, the mixture was transferred to a 100 mL flask. Anhydrous ethanol was removed using a rotary evaporator under reduced pressure and a water bath at 40–45 °C, forming a homogeneous, milky-white lipid film. After film formation, evaporation was continued under reduced pressure for 30 minutes to ensure complete removal of the organic solvent. The flask was then removed, and reaction buffer (PBS-MgCl₂) was added. 2+ 1 mL of the solution was used to thoroughly wash the membrane by rotating it under normal pressure, and then hydrated at 37°C for 2 hours to obtain a blank liposome Lip solution. The Lip solution was then squeezed back and forth 10 times using a liposome extruder and finally dispersed in 1 mL of reaction buffer and stored at 4°C for later use.

[0061] Characterization results of blank liposomes prepared by thin-film dispersion method are as follows: Figure 3 As shown. Figure 3 In section A, under red laser irradiation, compared with the reaction buffer solution on the upper right, the liposome solution exhibits the Tyndall effect characteristic of colloids, indicating that it is in good condition. Figure 3 TEM images of liposomes B show that they are relatively round, spherical in shape, and uniform in size. Figure 3 NTA analysis of C showed that the prepared liposomes had a particle size of around 100 nm and a particle concentration of 1.36 × 10⁻⁶. 9 particles / μL. In summary, blank liposomes were successfully prepared using the thin-film dispersion method.

[0062] The liposome solution was serially diluted 2, 5, 10, 20, 40, and 80 times using reaction buffer, and its particle size and PDI were measured using a nanoparticle size and Zeta potential analyzer to characterize the dilution stability of the liposomes. The liposome solution was then incubated at 4°C for two months. On days 5, 10, 15, 30, 45, and 60, the particle size and PDI of the liposomes were measured using a nanoparticle size and Zeta potential analyzer to characterize the storage stability of the liposomes.

[0063] The dilution stability results of liposomes showed that after dilution with reaction buffer, the particle size of the liposomes did not change significantly, and the PDI was less than 0.2, indicating that they have good homogeneity and dispersibility. After 60 days of storage at 4°C, the particle size of the liposomes remained at around 90–100 nm, and the PDI fluctuated around 0.15, indicating that the particles inside the liposome solution did not undergo significant aggregation or agglomeration, demonstrating that the prepared liposomes have good stability within 60 days.

[0064] 4.2 Preparation of Lip@H1 / H2-Apt / C

[0065] Multifunctional liposomes Lip@H1 / H2-Apt / C were prepared using a thin-film dispersion method. The specific preparation process is as follows:

[0066] (1) Preparation of Lip@H1 / H2 with internal encapsulation of H1 / H2, the experimental steps are as follows:

[0067] The hairpin probe solutions H1 and H2, prepared using reaction buffer, were annealed at 95°C for 5 minutes and then slowly cooled to room temperature to allow the probes to form a stable secondary structure. Equal volumes of 12 μmol / L H1 and H2 solutions (500 μL each) were mixed to prepare an H1 / H2 buffer solution with a final concentration of 6 μmol / L (total volume 1 mL). Following the method and dosage in section 4.1, a lipid film was prepared. 1 mL of H1 / H2 buffer was added for hydration, and the film was rotary evaporated at room temperature for 2 hours. The film was then extruded using a liposome extruder to obtain liposomes with uniform particle size. The extruded sample was redispersed in 1 mL of reaction buffer and incubated at 4°C for 12 hours to stabilize the membrane structure, yielding the Lip@H1 / H2 solution.

[0068] (2) Prepare 20 μmol / L Apt using reaction buffer. EpCAM -chol solution, 20 μmol / L C-chol solution. Take 10 μL of 20 μmol / L Apt / C solution (4 μL of Apt... EpCAM The solution (6 μL of C-chol solution and 6 μL of C-chol solution) was incubated with 100 μL of Lip@H1 / H2 solution prepared in step (1) at 37 °C for 1 hour; centrifuged at 10000 r / min for 5 minutes, ultrafiltered 3 times, and dispersed in 1 mL of reaction buffer to obtain Lip@H1 / H2-Apt / C solution.

[0069] The encapsulation efficiency and binding rate of Lip@H1 / H2-Apt / C were determined using an ultra-micro UV spectrophotometer. It should be noted that, to reduce interference from H1 / H2, intact liposomes (Lip@H1 / H2-Apt / C) were not used in the encapsulation and binding rate tests; instead, Lip@H1 / H2 was used. That is, the encapsulation efficiency experiment calculated the efficiency of blank liposomes encapsulating H1 and H2. In the binding rate experiment, blank liposomes were used; liposomes (Lip@H1 / H2) encapsulating H1 and H2 were not used. That is, the binding rate calculated was the binding rate between blank liposomes and Apt / C. The preparation method of Lip-Apt / C is described in step (2), where the Lip@H1 / H2 solution was replaced with a blank liposome solution. Regarding the encapsulation efficiency, when preparing Lip@H1 / H2, the amount of H1 / H2 added was 0.6 nmol, and the amount of free H1 / H2 was 62.55 pmol. Calculated using formula (1), the encapsulation efficiency of H1 / H2 within Lip@H1 / H2 was 89.56%. Regarding the binding efficiency, when preparing Lip@Apt / C, the amount of Apt / C added was 0.2 nmol, and the amount of free Apt / C was 24.87 pmol. Calculated using formula (1), the binding efficiency of the blank liposome Lip to Apt / C was 87.56%.

[0070] 4.3 Membrane Fusion Characterization

[0071] The Lip@H1 / H2-Apt / C prepared in the "Lip@H1 / H2-Apt / C preparation" step and the sEVs solution extracted in the "sEVs extraction" step were mixed at a volume ratio of 1:1 and incubated at 37°C for 150 minutes. Then, the hydrated particle size was characterized by transmission electron microscopy, FRET, and laser confocal microscopy.

[0072] Figure 4 A shows the hydration particle size characterization diagrams before and after the membrane fusion of Lip@H1 / H2-Apt / C and sEVs. The average particle size of Lip@H1 / H2-Apt / C is 121.4 nm. After membrane fusion with sEVs, the average particle size increases to 243.1 nm, indicating that membrane fusion of Lip@H1 / H2-Apt / C and sEVs has occurred. Figure 4 B shows a TEM image of the membrane fusion process between Lip@H1 / H2-Apt / C and sEVs. Under the microscope, the membrane structures of the two vesicles are interconnected, and after fusion, they form large vesicles with increased particle size, indicating that membrane fusion has occurred between Lip@H1 / H2-Apt / C and sEVs.

[0073] To avoid the influence of the Atto425 fluorescent group modified on H1, Lip-C (control) and Lip-Apt / C were incubated with sEVs for FRET characterization experiments. Specifically, two film dyes, DiO (excitation / emission: 484 / 510 nm) and DiI (excitation / emission: 540 / 565 nm), were used to stain Lip-C and Lip-Apt / C. The preparation method of Lip-C is the same as that of Lip-Apt / C in Section 4.2. EpCAM Replace -chol with the same concentration of C-chol. For example... Figure 5 As shown, when Lip-Apt / C stained with DiO and DiI was incubated with sEVs at 37°C for 2 hours, the fluorescence intensity of DiO was significantly enhanced; while no significant change in fluorescence signal was observed in the control group liposomes (Lip-C) lacking aptamer modification under the same conditions, confirming that the nucleic acid aptamer on the surface of liposomes can target and drive membrane fusion by specifically recognizing the sEVs membrane protein EpCAM.

[0074] To avoid the influence of the Atto425 fluorescent group modified on H1, Lip-C and Lip-Apt / C were incubated with sEVs respectively before laser confocal microscopy characterization experiments. Specifically, two film dyes were used: DiO was used to stain sEVs, and DiI was used to stain Lip-C and Lip-Apt / C. Figure 6 It was clearly observed that Lip-Apt / C modified with the EpCAM aptamer could capture sEVs in solution, as evidenced by the fluorescence of the fused vesicles containing both DiO and DiI dyes. No obvious fused vesicles were observed when Lip-C without the EpCAM aptamer was mixed with sEVs.

[0075] 4.4 Feasibility Analysis

[0076] 4.4.1 Feasibility Study of CHA-1

[0077] The CHA-1 system contains excitation miRNA-21, hairpin probes H1 and H2. When excitation miRNA-21 is absent, H1 and H2 exhibit a hairpin structure.

[0078] (1) Polyacrylamide gel electrophoresis experiment to investigate the performance of the CHA-1 reaction.

[0079] Hairpin probes H1 and H2 were annealed in a metal bath at 95℃ for 5 minutes, then slowly cooled to room temperature for 30 minutes. Solutions were prepared according to the following groups, and each group of samples was incubated at 37℃ with shaking for 150 minutes. Polyacrylamide gel electrophoresis was then performed, and gel imaging was performed using a gel imaging analysis system. The experimental groups were designed as follows: ① 500 nmol / L miRNA-21; ② 1 μmol / L H1; ③ 1 μmol / L H2; ④ 1 μmol / L H1 + 1 μmol / L H2; ⑤ 500 nmol / L miRNA-21 + 1 μmol / L H1; ⑥ 500 nmol / L miRNA-21 + 1 μmol / L H2; ⑦ 500 nmol / L miRNA-21 + 1 μmol / L H1 + 1 μmol / L H2; ⑧ Marker.

[0080] The results are as follows Figure 7 As shown in Figure A, when the trigger strand miRNA-21 is absent, the hairpin probes H1 and H2, when mixed, still exhibit single characteristic bands, maintaining their hairpin state and not opening each other. When miRNA-21 and hairpin probe H1 coexist, miRNA-21 can open hairpin probe H1 to form a new band. When miRNA-21 and hairpin probe H2 coexist, the hairpin probe H2 will not open due to the absence of H1. Only when H1 and H2 are added simultaneously to the trigger strand miRNA-21 can a chain cascade reaction occur, forming a high molecular weight double-stranded polymer. This result indicates that the designed nucleic acid sequence can complete CHA and meet the needs of experimental signal amplification.

[0081] (2) Characterization of the signal amplification effect of CHA-1 by fluorescence spectroscopy

[0082] Solutions were prepared according to the following groups: ① 100 nmol / L miRNA-21; ② 300 nmol / L H1; ③ 300 nmol / L H1 + 300 nmol / L H2; ④ 100 nmol / L miRNA-21 + 300 nmol / L H1; ⑤ 100 nmol / L miRNA-21 + 300 nmol / L H1 + 300 nmol / L H2. After reacting at 37°C for 150 minutes, the solutions were added to cuvettes, and the fluorescence signals were detected sequentially using a fluorescence spectrometer.

[0083] like Figure 7 As shown in B, the CHA reaction is only triggered when the excitation chain miRNA-21 and H1 and H2 are present simultaneously, thus achieving signal amplification. These results collectively confirm that the designed nucleic acid sequence can achieve target-triggered cascade signal amplification, laying the foundation for subsequent high-sensitivity detection of miRNA-21 in sEVs.

[0084] (3) Feasibility of laser confocal microscopy characterization of CHA-1 for detecting miRNA-21 in sEVs

[0085] Lip@H1 / H2-Apt / C was stained with DiI staining solution, and free dye was removed by ultrafiltration. The experimental group consisted of stained Lip@H1 / H2-Apt / C + sEVs, while the control group consisted of Lip@H1 / H2-Apt / C with an equal volume of PBS buffer. Both groups were incubated at 37°C for 150 minutes and imaged using a laser confocal microscope.

[0086] The results are as follows Figure 8 As shown, after sEVs were incubated with DiI-stained Lip@H1 / H2-Apt / C, Atto425 fluorescence signals could be observed inside DiI-labeled liposomes and fusion vesicles under the corresponding fluorescence excitation. Figure 8 DF); when sEVs are absent, only DiI-labeled liposomes are visible, with no Atto425 fluorescence signal. Figure 8 The results (AC) indicate that CHA-1 can detect miRNA-21 in target sEVs on the basis of membrane fusion.

[0087] 4.4.2 Feasibility Study of CHA-2

[0088] The CHA-2 system includes Apt PD-L1 -L, C-chol, hairpin probes H3 and H4.

[0089] (1) Polyacrylamide gel electrophoresis experiment to investigate the running effect of CHA-2 reaction.

[0090] The experimental procedure for characterizing the signal amplification effect of Trigger-excited H3 and H4 using polyacrylamide gel electrophoresis was as follows: “Experimental Study on the Operation Effect of CHA-1 Reaction by Polyacrylamide Gel Electrophoresis”. The experimental groups were as follows: ① Marker; ② 500 nmol / L Trigger; ③ 1 μmol / L H3; ④ 1 μmol / L H4; ⑤ 1 μmol / L H3 + 1 μmol / L H4; ⑥ 500 nmol / L Trigger + 1 μmol / L H3; ⑦ 500 nmol / L Trigger + 1 μmol / L H4; ⑧ 500 nmol / L Trigger + 1 μmol / L H3 + 1 μmol / L H4.

[0091] Apt PD-L1 The experimental groups for amplifying the signals of H3 and H4 excited by -L and C-chol are as follows: ①Marker; ②500 nmol / LApt PD-L1-L; ③500nmol / L C-chol; ④1μmol / L H3; ⑤1μmol / L H4; ⑥500nmol / LApt PD-L1 -L+500nmol / LC-chol; ⑦500nmol / L Apt PD-L1 -L+1μmol / L H3; ⑧500nmol / L Apt PD-L1 -L+1μmol / L H4; ⑨500nmol / L Apt PD-L1 -L+1μmol / L H3+1μmol / L H4; ⑩500nmol / L C-chol+1μmol / L H3; 500nmol / LC-chol+1μmol / L H4; 500nmol / LC-chol+1μmol / L H3+1μmol / LH4; 500 nmol / LApt PD-L1 -L+500nmol / L C-chol+1μmol / LH3; 500 nmol / LApt PD-L1 -L+500nmol / L C-chol+1μmol / L H4; 500 nmol / L Apt PD-L1 -L+500nmol / L C-chol+1μmol / L H3+1μmol / L H4.

[0092] (2) Characterizing the signal amplification effect of CHA-2 by fluorescence spectroscopy

[0093] The experimental procedures for characterizing the signal amplification effect of trigger-excited H3 and H4 using fluorescence spectroscopy are as follows: "Characterizing the Signal Amplification Effect of CHA-1 using Fluorescence Spectroscopy". The experimental groups are as follows: ① 200 nmol / L Trigger; ② 400 nmol / L H3; ③ 400 nmol / L H3 + 400 nmol / L H4; ④ 200 nmol / L Trigger + 400 nmol / L H3; ⑤ 200 nmol / L Trigger + 400 nmol / L H3 + 400 nmol / L H4.

[0094] The experimental groups for detecting signal amplification in sEVs using the CHA-2 system are as follows: ① 400 nmol / L H3 + 400 nmol / L H4; ② 200 nmol / L Apt PD-L1 -L+400nmol / L H3+400nmol / L H4; ③1.4×10 7particles / μLLip-Apt / C+200nmol / L Apt PD-L1 -L+400nmol / L H3+400nmol / L H4; ④1μg / mL PD-L1+1.4×10 7 particles / μL Lip-Apt / C+200nmol / L Apt PD-L1 -L+400nmol / L H3+400nmol / L H4; ⑤4×10 4 particles / μL sEVs+1.4×10 7 particles / μL Lip-Apt / C+200nmol / L Apt PD-L1 -L+400n mol / L H3+400nmol / L H4.

[0095] like Figure 9 As shown in A and B, the excitation chain trigger, in conjunction with H3 and H4, effectively amplified the fluorescence signal, and this signal amplification was also effectively achieved in actual detection of sEVs. This result validates the Apt... PD-L1 -L alone or in combination with C-chol did not elicit nonspecific signals. Lip-Apt / C linked to C-chol reacted specifically with PD-L1 on the sEV membrane and did not interact with free PD-L1 protein in solution.

[0096] like Figure 9 As shown in Figure C, the excitation trigger effectively opens the hairpin probes H3 and H4, generating double-stranded products. This demonstrates that the nucleic acid sequence designed for the trigger can successfully complete the CHA process, meeting the signal amplification requirements in the experiment. Figure 9 D shows that Apt PD-L1 In the experiment of amplifying the signals of H3 and H4 excited by -L and C-chol, Apt PD-L1 Neither -L nor C-chol can open the clip probes H3 and H4 individually, even if both are present, because Apt... PD-L1 The -L hairpin structure cannot be opened because it cannot form the CHA-2 excitation chain trigger with C-chol, nor will it trigger the opening of H3 and H4.

[0097] The above results demonstrate that the proposed method can effectively distinguish between the target sEVs membrane protein PD-L1 and free PD-L1 protein, verifying its specific recognition ability for complex samples.

[0098] (3) Feasibility of laser confocal microscopy characterization of CHA-2 for detecting PD-L1 in sEVs

[0099] Lip-Apt / C was stained with DiO staining solution, and free dye was removed by ultrafiltration. To avoid the formation of a double-chain structure between H3 and H4 in solution, which would prevent observation by laser confocal microscopy, the experimental group used 100 μL of stained 1.4 × 10⁻⁶ μL of the solution. 7 particles / μL Lip-Apt / C+4×10 4 particles / μL sEVs+200nmol / L Apt PD-L1 -L+400nmol / L H3, the control group had its sEVs solution replaced with an equal volume of PBS buffer. Both groups were incubated at 37°C for 150 minutes, and imaging was performed using CLSM.

[0100] The results are as follows Figure 10 As shown, sEVs and DiO-stained Lip-Apt / C, Apt PD-L1 After incubation with -L and H3, Cy5 fluorescence signals can be observed on the surface of DiO-labeled liposomes and fusion vesicles under the corresponding fluorescence excitation. Figure 10 DF); when sEVs are absent, only DiO-labeled liposomes are visible, with no Cy5 fluorescence signal. Figure 10 AC) indicates that CHA-2 can detect PD-L1 in target sEVs based on membrane fusion.

[0101] 4.5 Feasibility study of simultaneous detection of sEVs miRNA-21 and PD-L1

[0102] (1) Investigation of mutual interference of fluorescent probes

[0103] Fluorescence spectra of molecular beacons Atto425 and Cy5 were measured using a fluorescence spectrometer to determine the positions of their maximum excitation and emission peaks. The results showed that the maximum excitation and emission peaks of Atto425 were at 442 nm and 484 nm, respectively, while those of Cy5 were at 638 nm and 676 nm, respectively.

[0104] Two fluorescent probes, H1 and H3, were diluted to the same concentration using reaction buffer. Excitation wavelengths of 442 nm and 638 nm were used sequentially, and fluorescence spectra of the two probes were measured using a fluorescence spectrometer in the ranges of 460–530 nm and 660–730 nm, respectively. The results showed that when the excitation wavelength was 442 nm, H1 exhibited the strongest fluorescence intensity at the maximum emission wavelength of the Atto425 fluorophore (484 nm), while H3 showed weak fluorescence. When the excitation wavelength was 638 nm, H3 exhibited the strongest fluorescence intensity at the maximum emission wavelength of the Cy5 fluorophore (676 nm), while H1 showed weak fluorescence. This indicates that there is a significant distance between the maximum excitation and maximum emission peaks of H1 and H3, and the influence of H1 on the measurement results of H3 is negligible and will not significantly interfere with the signal.

[0105] (2) Feasibility of simultaneous determination of sEVsmiRNA-21 and PD-L1 by fluorescence spectroscopy characterization

[0106] Prepare solutions according to the following groups, react at 37℃ for 150 minutes, and then detect fluorescence: ① 200 nmol / LApt PD-L1 -L+400nmol / L H3+400nmol / L H4; ②200nmol / LApt PD-L1 -L+400nmol / L H3+400nmol / L H4+1.4×10 7 particles / μL Lip-C; ③200nmol / L Apt PD-L1 -L+400nmol / L H3+400nmol / LH4+1.4×10 7 particles / μL Lip@H1 / H2-Apt / C; ④200nmol / L Apt PD-L1 -L+400nmol / L H3+400nmol / L H4+1.4×10 7 particles / μL Lip@H1 / H2-Apt / C+4×10 4 particles / μL sEVs.

[0107] like Figure 11 As shown, the changes in FL484 indicate that when there is no Lip@H1 / H2-Apt / C in the system, FL484 is close to 0; when there is Lip@H1 / H2-Apt / C in the system but no sEVs, the H1 / H2 encapsulated within it generates a background signal; when sEVs are added to the system, FL484 increases significantly, confirming that sEVs trigger the CHA-1 cascade reaction. The changes in FL676 indicate that Apt... PD-L1-L+H3 / H4 itself has a background value, and neither Lip@H1 / H2-Apt / C nor sEVs alone can induce CHA-2. Only when both coexist does FL676 show a significant increase, indicating that the occurrence of CHA-2 strictly depends on the specific recognition of sEVs by liposomes. The combined fluorescence changes of FL484 and FL676 indicate that CHA-1 and CHA-2 can be detected in parallel in the same system without significant mutual interference.

[0108] (3) Feasibility of simultaneous detection of sEVs miRNA-21 and PD-L1 using laser confocal microscopy characterization

[0109] 1.4×10 7 particles / μL Lip@H1 / H2-Apt / C, 4×10 4 particles / μL sEVs、200nmol / LApt PD-L1 -L and 400 nmol / L H3 were mixed thoroughly and reacted at 37°C for 150 minutes, and then imaged using CLSM.

[0110] The results are as follows Figure 12 As shown, Lip@H1 / H2-Apt / C is related to sEVs and Apt. PD-L1 After co-incubation with -L and H3, Atto425 fluorescence signal inside the fusion vesicle and Cy5 fluorescence signal on the surface can be observed under the corresponding fluorescence excitation, indicating that after the multifunctional liposomes fuse with sEVs, the simultaneous detection of miRNA-21 and PD-L1 in sEVs can be achieved.

[0111] 4.6 Construction of a simultaneous detection system for intracellular miRNA-21 and membrane protein PD-L1 in sEVs

[0112] 4.6.1 Simultaneous Detection Procedure of Intramembrane miRNA-21 and Membrane Protein PD-L1 in sEVs

[0113] (1) Hairpin probe annealing

[0114] To fully untangle the hairpin structure and facilitate subsequent experiments, Apt... PD-L1 The L, H3, and H4 probes were annealed at 95°C for 10 minutes and 5 minutes, respectively, and then left at room temperature for 30 minutes to stabilize the single-chain structure.

[0115] (2) Preparation and dilution of multifunctional liposomes

[0116] Prepare Lip@H1 / H2-Apt / C according to the method in Section 4.2. After dilution with reaction buffer, take 90 μL and add it evenly to three sterile 200 μL EP tubes.

[0117] (3) Add Apt PD-L1 -L and H3 / H4

[0118] Dilute Apt with reaction buffer PD-L1 After adding -L and H3 / H4, take 15μL and add it evenly to 3 EP tubes.

[0119] (4) sEVs incubation

[0120] Add 60 μL of sEVs solution diluted in PBS to each EP tube, mix well, and incubate at 37°C for 150 minutes.

[0121] (5) Detection

[0122] Turn on the fluorescence spectrometer in advance, preheat the xenon lamp for 30 minutes, then add 20 μL to a quartz cuvette and scan the fluorescence spectrum using excitation wavelengths of 442 nm and 638 nm.

[0123] 4.6.2 Optimization of preparation conditions for multifunctional liposomes

[0124] (1) Apt in Lip@H1 / H2-Apt / C EpCAM -chol concentration optimization

[0125] Apt on Lip@H1 / H2-Apt / C surface connections EpCAM The amount of C-chol directly affects the capture performance of target sEVs. Insufficient dosage will reduce the capture efficiency, while excessive dosage will affect the subsequent insertion of C-chol into the liposome surface. Therefore, optimization is necessary. The specific method involves using Apt at concentrations of 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 μmol / L. EpCAM Lip@H1 / H2-Apt / C was prepared using -chol concentration, and experiments were conducted according to the procedure in 4.6.1 to select the optimal Apt concentration. EpCAM -chol concentration.

[0126] The results show that when Apt in Lip@H1 / H2-Apt / C EpCAM When the concentration of -chol was 0.8 μmol / L, the fluorescence intensity of both CHA-1 and CHA-2 reached its maximum value; when Apt... EpCAM When the amount of -chol added was further increased, the fluorescence intensity of both CHA-1 and CHA-2 decreased to varying degrees.

[0127] (2) Optimization of C-chol concentration in Lip@H1 / H2-Apt / C

[0128] Optimized Apt EpCAMBased on the amount of C-chol used, the number of C-chols linked to the Lip@H1 / H2-Apt / C surface was further optimized to avoid insufficient C-chols leading to low CHA-2 reaction efficiency, and excessive C-chols resulting in reagent waste. Specifically, multifunctional liposomes were prepared with C-chol concentrations of 0.3, 0.6, 0.9, 1.2, 1.5, and 1.8 μmol / L, and experiments were conducted according to the steps in 4.6.1 to select the optimal C-chol concentration.

[0129] The results showed that when the concentration of C-chol in Lip@H1 / H2-Apt / C was 1.2 μmol / L, the fluorescence intensity of both CHA-1 and CHA-2 reached its peak. When the amount of C-chol was further increased, the fluorescence intensity of CHA-1 tended to stabilize, while the fluorescence intensity of CHA-2 showed a decreasing trend.

[0130] (3) Optimization of H1 / H2 concentration in Lip@H1 / H2-Apt / C

[0131] The concentration of H1 / H2 encapsulated within Lip@H1 / H2-Apt / C is closely related to the detection performance of CHA-1. During the liposome preparation process according to the steps in Section 4.2, hydrated solutions containing H1 / H2 at concentrations of 1, 2, 3, 4, 5, and 6 μmol / L were added, and experiments were conducted according to the steps in 4.6.1 to select the optimal H1 / H2 concentration.

[0132] The results showed that the H1 / H2 concentration encapsulated within Lip@H1 / H2-Apt / C was positively correlated with the fluorescence intensity of CHA-1, but not with the fluorescence intensity of CHA-2. However, when the H1 / H2 concentration exceeded 6 μmol / L, the growth of the CHA-1 fluorescence signal slowed down.

[0133] Taking all factors into consideration, 0.8 μmol / L Apt was used in subsequent experiments. EpCAM Lip@H1 / H2-Apt / C was prepared by using 1.2 μmol / L C-chol and 6 μmol / L H1 / H2.

[0134] 4.6.3 Optimization of reactant concentration

[0135] (1)Apt PD-L1 -L dosage optimization

[0136] Apt PD-L1-L is crucial for binding to the PD-L1 protein on sEVs membranes and triggering CHA-2, and its concentration directly affects the signal amplification of CHA-2. Therefore, its concentration was optimized. The method was as follows: Apt was prepared at concentrations of 50, 100, 150, 200, 250, and 300 nmol / L. PD-L1 -L Conduct the experiment according to the steps in 4.6.1 to select the optimal Apt. PD-L1 -L dosage.

[0137] The results showed that Apt PD-L1 When the concentration of -L was 200 nmol / L, the fluorescence intensity of both CHA-1 and CHA-2 reached its peak; when Apt PD-L1 When the concentration of -L is further increased, the fluorescence intensity of both CHA-1 and CHA-2 tends to stabilize.

[0138] (2) Optimization of H3 / H4 dosage

[0139] The amount of H3 / H4 used is closely related to the detection sensitivity of CHA-2. The final concentrations of H3 / H4 in the system were adjusted to 100, 200, 300, 400, 500, and 600 nmol / L, and the experiments were carried out according to the steps in 4.6.1 to select the optimal amount of H3 / H4.

[0140] The results showed that the concentration of H3 / H4 in the system was closely related to the fluorescence intensity of CHA-2, but not to the fluorescence intensity of CHA-1. The fluorescence intensity of CHA-2 reached its peak when the concentration of H3 / H4 was 400 nmol / L, and the fluorescence intensity of CHA-2 decreased when the concentration of H3 / H4 increased further.

[0141] (3) Optimization of Lip@H1 / H2-Apt / C concentration

[0142] The amount of Lip@H1 / H2-Apt / C used directly affects the fluorescence signal intensity of the reaction. The multifunctional liposome solution was serially diluted using reaction buffer to adjust the added Lip@H1 / H2-Apt / C concentrations to 0.4, 0.8, 1.1, 1.4, 1.7, and 3.5 × 10⁻⁶. 7 For particles / μL, conduct experiments according to the steps in 4.6.1 to select the optimal Lip@H1 / H2-Apt / C concentration.

[0143] The results showed that the concentration of Lip@H1 / H2-Apt / C was 1.4 × 10⁻⁶. 7When the concentration of particles / μL was increased, the fluorescence intensity of CHA-1 and CHA-2 both reached their peak values. When the concentration of Lip@H1 / H2-Apt / C was further increased, the fluorescence intensity of CHA-1 and CHA-2 decreased.

[0144] In summary, Apt was used in the experiment. PD-L1 The concentration of -L is 200 nmol / L, the concentration of H3 / H4 is 400 nmol / L, and the concentration of Lip@H1 / H2-Apt / C is 1.4 × 10⁻⁶. 7 particles / μL.

[0145] 4.6.4 Optimization of Reaction Time

[0146] The reaction time (sEVs incubation) directly affects the fluorescence signal intensity, so it needs to be optimized. The specific method is as follows: the experiment is carried out according to the steps in 4.6.1, and the fluorescence intensity is detected by a fluorescence spectrometer at 0, 30, 60, 90, 120, 150 and 180 minutes of reaction, respectively, to select the optimal reaction time.

[0147] The results showed that when the reaction time was less than 150 minutes, the fluorescence intensity of both CHA-1 and CHA-2 increased with increasing reaction time. When the reaction time reached 150 minutes, the fluorescence intensity of both CHA-1 and CHA-2 reached its maximum. With further increases in reaction time, the fluorescence intensity of both CHA-1 and CHA-2 showed a decreasing trend. Therefore, a reaction time of 150 minutes was chosen for subsequent experiments.

[0148] During the optimization process, once an optimal dosage or concentration is obtained, the already obtained optimal dosage or concentration is used for the experiment when optimizing the next part of the conditions.

[0149] 4.6.5 Establishment of the Standard Curve

[0150] Different concentrations of sEVs were prepared by serial dilution with PBS buffer: 8.0 × 10⁻⁶ 2 1.0×10 3 2.0×10 3 8.0×10 3 2.5×10 4 1.0×10 5 5.0×10 5 particles / μL, based on optimized conditions, to multifunctional liposomes, Apt PD-L1 Small extracellular vesicles of the extracted sample to be tested were added to the premixed solution of hairpin probe H3 and hairpin probe H4, incubated, and fluorescence detected; standard curves were established with sEVs concentration as independent variable and fluorescence intensity as dependent variable.

[0151] like Figure 13 As shown in A and C, since neither of them satisfies linearity, therefore C is... sEVs Perform a logarithmic transformation. Using lgC sEVs Using as the independent variable and the corresponding fluorescence signal intensity as the dependent variable, a standard curve was established. The standard curve for the detection of intracellular miRNA-21 in sEVs is shown below. Figure 13 As shown in B, when the concentration of sEVs is 1.0 × 10⁻⁶ 3 ~5.0×10 5 When particles / μL, the fluorescence signal intensity is related to lgC. sEVs The relationship is linear, and the standard curve equation is Y = 3894.95X - 5618.24(R). 2 =0.9986, Y is FL-FL0, X is lgC sEVs ).

[0152] The standard curve for the detection of sEVs membrane protein PD-L1 is as follows: Figure 13 As shown in D, when the concentration of sEVs is 8.0 × 10⁻⁶ 2 ~5.0×10 5 When particles / μL, the fluorescence signal intensity is related to lgC. sEVs The relationship is linear, and the standard curve equation is Y = 7978.31X - 2029.44(R). 2 =0.9917, Y is FL-FL0, X is lgC sEVs ).

[0153] 4.7 Methodological Evaluation

[0154] 4.7.1 Limit of Detection

[0155] Simultaneously, three blank samples were tested. Based on optimized conditions, the assay was then applied to multifunctional liposomes and Apt... PD-L1 Small extracellular vesicles of the extracted sample were added to the premixed solution of hairpin probes H3 and H4, incubated, and their fluorescence intensity at 484 nm and 676 nm was measured. The standard deviation (SD) was calculated, and the 3SD value was obtained and divided by the slope of the standard curve. The limits of detection (LOD) of miRNA-21 and PD-L1 in sEVs were calculated respectively.

[0156] The calculated LOD of miRNA-21 within the sEV membrane was 4.8 × 10⁻⁶. 2 The LOD of PD-L1 on the surface of the sEVs membrane is 2.8 × 10⁻⁶ particles / μL. 2 particles / μL.

[0157] 4.7.2 Precision and Spike Recovery

[0158] Dilute sEVs-free FBS 20-fold with PBS to obtain 5% sEVs-free FBS. Add sEVs to this solution to achieve a concentration of 0.8 × 10⁻⁶. 3 2.5×10 4 1.0×10 5 particles / μL, three replicates per concentration, based on optimized conditions, to multifunctional liposomes, Apt... PD-L1 The extracted extracellular vesicles of the sample to be tested were added to the premixed solution of L, hairpin probe H3 and hairpin probe H4, incubated, and the corresponding fluorescence intensity was recorded. The corresponding concentration was calculated according to the standard curve, and the relative standard deviation (RSD) and spike recovery rate were calculated by formula.

[0159] The results are shown in Table 2. The recoveries of sEVs intramembrane miRNA-21 and membrane surface PD-L1 by this method ranged from 98.6% to 114.0% and 105.9% to 114.6%, respectively; the corresponding RSDs were 5.09% to 8.07% and 4.62% to 7.14%, respectively.

[0160] Table 2. Precision and Spike Recovery (n=3)

[0161]

[0162] 4.7.3 Specificity

[0163] Due to the complexity of biological samples, the response specificity of H1 / H2 probes in the Lip@H1 / H2-Apt / C system to miRNA-21, miRNA-155, miRNA-486, and random sequences was evaluated. The probes were prepared according to the following groups, and after incubation at 37℃ for 150 minutes, fluorescence was detected using a fluorescence spectrometer: ① 300 nmol / L H1 + 300 nmol / L H2; ② 500 nmol / L miRNA-21 + 300 nmol / L H1 + 300 nmol / L H2; ③ 500 nmol / L miRNA-155 + 300 nmol / L H1 + 300 nmol / L H2; ④ 500 nmol / L miRNA-486 + 300 nmol / L H1 + 300 nmol / L H2; ⑤ 500 nmol / L random + 300 nmol / L H1 + 300 nmol / L H2.

[0164] like Figure 14 As shown, the fluorescence intensity of the reaction between H1 / H2 and miRNA-21 was significantly higher than that of the other groups, indicating that this system has a high specific recognition ability for miRNA-21. This result validates the potential of the H1 / H2 system in detecting miRNA-21.

[0165] Based on the above, the following non-target interfering substances that commonly coexist with sEVs in actual samples were selected as negative controls: miRNA-21, miRNA-155, miRNA-486, Random, albumin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), serum amyloid A1 (SAA1), CD146, EpCAM, and PD-L1 blank liposomes (Lip). All were uniformly treated with Lip@H1 / H2-Apt / C and pre-annealed Apt under optimized conditions. PD-L1 After reacting -L with H3 / H4 at 37℃ for 150 minutes, the signal intensity difference between the sEVs group and each negative control group was compared to verify the specific recognition ability of the EpCAM aptamer-mediated membrane fusion strategy for the target sEVs and to evaluate the specificity of the established detection method.

[0166] The results are as follows Figure 15 As shown, the intensity of both fluorescence signals in the sEVs group was significantly higher than that in the control groups, indicating that the method has good specificity and provides a solid foundation for subsequent clinical sample testing.

[0167] 4.8 Actual Sample Testing

[0168] 4.8.1 Detection of sEVs in cell line supernatant

[0169] Following the method described in "sEVs Extraction," sEVs were extracted from lung adenocarcinoma cell line A549, lung squamous cell carcinoma cell line H520, large cell lung cancer cell line H460, and normal bronchial epithelial cell line BEAS-2B. Based on optimized conditions, sEVs were extracted according to the method described in "sEVs Extraction." PD-L1 The small extracellular vesicles of the extracted sample to be tested were added to the premixed solution of hairpin probe H3 and hairpin probe H4, incubated, and subjected to fluorescence detection. The steps were used to analyze the biomarkers of sEVs in the supernatant of the four cell lines.

[0170] like Figure 16As shown, miRNA-21 and PD-L1 exhibited differentiated distribution characteristics across the four cell lines. In normal lung epithelial cells BEAS-2B, the expression level of miRNA-21 in sEVs was significantly lower than that in lung cancer cell lines. Among the three lung cancer cell lines, H460 cells showed the highest miRNA-21 expression, while A549 cells showed the lowest. H460 cells had the lowest PD-L1 expression level, far lower than that in the BEAS-2B cell line, while H520 cells showed the highest PD-L1 expression. This heterogeneity in marker expression is highly consistent with the molecular subtyping characteristics of lung cancer cell subtypes: H460, as a large cell lung cancer model, is characterized by high miRNA-21 / low PD-L1, H520 (squamous cell carcinoma) shows significant PD-L1 enrichment, and A549 (adenocarcinoma) exhibits a dual low expression pattern.

[0171] The results indicate that the detection method established in this invention can distinguish sEVs subgroups with different molecular phenotypes.

[0172] 4.8.2 Detection of sEVs in plasma

[0173] The established method was used to detect the concentrations of miRNA-21 and PD-L1 in sEVs in plasma samples.

[0174] (1) Sample collection and testing

[0175] With the approval of the ethics committee and the signing of informed consent forms, whole blood samples and clinical information were collected from 146 individuals, including lung cancer patients, patients with benign lung diseases, and healthy controls from a health checkup center at a certain hospital. Among them, there were 47 lung cancer patients, 49 benign lung disease patients, and 50 healthy controls. After collecting whole blood samples, the samples were centrifuged at 3000 rpm at 4°C for 5 minutes, and the collected plasma was placed in cryovials and stored at -80°C for later use.

[0176] A. Inclusion and exclusion criteria for study subjects

[0177] Inclusion criteria for lung cancer patients included: ① patients diagnosed with primary lung cancer by pathology or cytology; ② patients who had not received radiotherapy, chemotherapy, drug therapy, or surgical treatment; and ③ patients who agreed to participate in the study and maintained good adherence. Exclusion criteria included: ① patients with major organ failure; ② patients with malignant tumors in other organs; and ③ patients who were pregnant or breastfeeding.

[0178] Inclusion criteria for patients with benign lung diseases were: ① having benign lung diseases (such as chronic obstructive pulmonary disease, pneumonia, pulmonary interstitial fibrosis, etc.); ② not having malignant tumors in the lungs or other organs; ③ not having other active diseases or concurrent immune, metabolic, or endocrine-related diseases; ④ agreeing to participate in the study and maintaining good adherence. Exclusion criteria included: ① patients who had received radiotherapy, chemotherapy, or drug treatment; ② patients with major organ failure; ③ patients who were pregnant or lactating.

[0179] The inclusion criteria for the normal control group were: ① no malignant tumors in the lungs or other organs; ② no benign lung diseases (such as chronic obstructive pulmonary disease, pneumonia, pulmonary interstitial fibrosis, etc.); ③ no history of radiotherapy or chemotherapy, and no recent drug or surgical treatment; ④ consent to participate in the study and maintain good adherence.

[0180] The basic characteristics of the three groups of subjects are shown in Table 3. The mean age of the LC group (lung cancer patients) was 60 (54, 69) years, the mean age of the BLD group (benign lung disease patients) was 54 (48, 58) years, and the mean age of the NC group (normal control group of the health checkup center) was 55.5 (48, 59) years. The sex ratio of all three groups was 1:1.

[0181] Table 3. Basic Characteristics of the Research Subjects

[0182]

[0183] B. Detection of sEVs in plasma

[0184] Plasma was removed from a -80°C freezer and slowly thawed. The required volume of plasma sample was then taken, diluted 20-fold with PBS, and centrifuged at 2000g for 10 minutes and 10000g for 30 minutes, respectively, collecting the supernatant. Finally, the centrifuged plasma sample was filtered through a 0.22μm membrane to remove large-sized interfering substances. Based on optimized conditions, the process was carried out according to the principle of "towards multifunctional liposomes, Apt..." PD-L1 The procedure of "adding small extracellular vesicles of the sample to be tested to the premixed solution of hairpin probe H3 and hairpin probe H4, incubating, and fluorescence detection" was used to detect and analyze miRNA-21 and PD-L1 in sEVs in plasma samples.

[0185] The detection thermal images are shown below. Figure 17 A and Figure 17 B. The test results of the LC group, BLD group, and NC group were compared and analyzed. The results are shown in Tables 4 and 5. Figure 17As shown in C and D, the fluorescence signal intensities of miRNA-21 and PD-L1 in sEVs of the LC group were significantly higher than those of the BLD and NC groups (P<0.001). The fluorescence signal intensity of miRNA-21 in sEVs of the BLD group was significantly higher than that of the NC group (P<0.05). However, the fluorescence signal intensity of PD-L1 in sEVs of the BLD group was not significantly higher than that of the NC group (P>0.05). In conclusion, the expression levels of miRNA-21 and PD-L1 in sEVs showed statistically significant differences among lung cancer patients, benign lung patients, and normal controls, indicating their potential for screening lung cancer patients.

[0186] Table 4. Description and Analysis Results of Plasma Sample Testing

[0187]

[0188] Table 5. Results of pairwise comparison analysis of plasma samples

[0189]

[0190] To further evaluate the diagnostic efficacy of the established detection method in lung cancer screening and auxiliary diagnosis, 49 patients with benign lung diseases and 50 normal controls were combined into a non-lung cancer group (n=99), which was included in the analysis along with 47 patients in the lung cancer group. Data on sEVs miRNA-21 and PD-L1 were obtained through plasma sample testing. The AUC was used to evaluate the diagnostic efficacy of single markers and combined detection of both in lung cancer screening and auxiliary diagnosis: the AUC (95% CI) for single detection of miRNA-21 and PD-L1 in sEVs was 0.909 (0.852-0.966) and 0.830 (0.763-0.897), respectively; while the AUC (95% CI) for combined detection increased to 0.931 (0.886-0.977), fully demonstrating that combined detection can significantly enhance the accuracy of lung cancer screening and auxiliary diagnosis. ROC curves were plotted based on the AUC results. Figure 18 .

[0191] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An aptamer-mediated membrane fusion-based sensor for simultaneous detection of exosomal membrane protein PD-L1 and miRNA-21, characterized in that, Comprise: (1) Multifunctional liposomes, which are obtained after encapsulating hairpin probe H1 and hairpin probe H2 inside the liposomes, modifying EpCAM aptamer and auxiliary chain on the surface of the liposome membrane, wherein the EpCAM aptamer can specifically bind to the surface of the small extracellular vesicles, and the miRNA-21 in the small extracellular vesicles, the hairpin probe H1 and the hairpin probe H2 form a first catalytic hairpin self-assembly system; (2) the Apt of the hairpin structure PD-L1 -L, the Apt PD-L1 -L comprises, in order from 5' end to 3' end, a PD-L1 aptamer, a connecting arm, an auxiliary chain hybridization region and a partial primer strand sequence, the PD-L1 aptamer can specifically bind to PD-L1 on the surface of the small extracellular vesicle, the auxiliary chain hybridization region can specifically bind to the auxiliary chain which is base complementary pairing, and the partial primer strand sequence and the 5' end of the auxiliary chain together form a primer strand of a second catalytic hairpin self-assembly system. (3) hairpin probe H3 and hairpin probe H4, the Apt PD-L1 - L, the auxiliary chain, hairpin probe H3 and hairpin probe H4 form a second catalytic hairpin self-assembly system.

2. The sensor of claim 1, wherein, The preparation method of the multifunctional liposomes comprises: Step 1: using 1,2-dipalmitoyl-sn-glycero-3-phosphocholine, cholesterol, and distearoyl phosphatidyl ethanolamine-polyethylene glycol as raw materials, and using a film dispersion method to prepare the liposomes; Step 2: incubating the hairpin probe H1 solution and the hairpin probe H2 solution after annealing with the liposome solution, and extruding; Step 3: adding the EpCAM aptamer solution and the auxiliary chain solution and incubating, thereby obtaining the multifunctional liposomes.

3. The sensor of claim 2, wherein, In the system for preparing the multifunctional liposomes, the concentration of the EpCAM aptamer is 0.8 μmol / L, the concentration of the auxiliary chain is 1.2 μmol / L, and the concentrations of the hairpin probe H1 and the hairpin probe H2 are both 6 μmol / L.

4. The sensor of claim 1, wherein, The sequence of the hairpin probe H1 is shown as SEQ ID NO: 5, and the sequence of the hairpin probe H2 is shown as SEQ ID NO:

6.

5. The sensor of claim 1, wherein, The sequence of the EpCAM aptamer is shown as SEQ ID NO:

7.

6. The sensor of claim 1, wherein, The sequence of the PD-L1 aptamer is ACAGGTTCTGGGGGGTGGGTGGGGAACCTG, the connecting arm is composed of T bases, and the sequence of the auxiliary chain hybridization region is AGGTTCC. Preferably, the sequence of the auxiliary chain is shown as SEQ ID NO:

10. Preferably, the sequence of the trigger strand is CGATAGATGATTGACTCCGGAGAC.

7. The sensor of claim 1, wherein, The sequence of the hairpin probe H3 is shown as SEQ ID NO: 12, and the sequence of the hairpin probe H4 is shown as SEQ ID NO:

13.

8. Use of the sensor of any one of claims 1-7 in the preparation of a lung cancer detection kit.

9. Use according to claim 8, characterized in that, The use comprises the following steps: Step 1 : To multifunctional liposome, Apt PD-L1 - addition of extracted small extracellular vesicles of the sample to be tested to the pre-mix of L, hairpin probe H3 and hairpin probe H4, incubation; Step 2: fluorescence detection.

10. Use according to claim 9, characterized in that, Aptamer application PD-L1 The concentration of L is 200 nmol / L, the concentration of hairpin probe H3 and hairpin probe H4 is 400 nmol / L, and the concentration of multifunctional liposome is 1.4 x 10 7 particles / μL.

Images