Primer group and kit for simultaneously detecting aleutian disease virus and canine distemper virus type 6 of panda and application of primer group and kit for simultaneously detecting aleutian disease virus and canine distemper virus type 6 of panda

By designing primer sets suitable for recombinase-mediated isothermal nucleic acid amplification technology, the problem of simultaneous and rapid detection of red panda Aleutian virus and red panda canine distemper virus Asia 6 type in existing technologies has been solved, enabling rapid, accurate, and low-cost on-site detection.

CN121344273AActive Publication Date: 2026-01-16CHINA CONSERVATION & RES CENT FOR THE GIANT PANDA SICHUAN
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511917020.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-18
Publication Date
2026-01-16
Estimated Expiration
2045-12-18

AI Technical Summary

Technical Problem

Current technologies lack methods for simultaneously, rapidly, sensitively, and specifically detecting Aleutian virus and Canine Distemper Virus Asia 6 in red pandas, resulting in high testing costs, long testing times, low efficiency, and difficulty in application in field environments.

Method used

A primer set, including ADV and CDV primer sets, was designed for recombinase-mediated isothermal nucleic acid amplification (RAA) technology under isothermal conditions at 39°C. This technology can specifically identify and detect red panda Aleutian virus and red panda canine distemper virus Asia 6 within 20 minutes, avoiding cross-reaction and false positives.

Benefits of technology

It enables rapid and accurate detection of two viruses within 20 minutes at 39℃, exhibiting high sensitivity and specificity, capable of distinguishing different pathogens, suitable for on-site testing, and reducing testing costs and time requirements.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344273A_ABST
    Figure CN121344273A_ABST
Patent Text Reader

Abstract

The invention discloses a primer group and a kit for simultaneously detecting a panda aleutian virus and a panda canine distemper virus Asia type 6 and application of the primer group and the kit, and belongs to the technical field of virus detection of endangered wild animals. The invention provides a primer group and a kit for specifically recognizing the aleutian disease virus and the canine distemper virus Asia 6 type of the panda, and detection can be completed within 20 minutes under the condition of constant temperature of 39 DEG C; according to the present invention, the method has characteristics of rapid detection, good specificity, high sensitivity and the like, does not produce the cross reaction with other common pathogens, does not produce the false positive phenomenon due to the generation of the primer dimer, has characteristics of rapid detection, good specificity, high sensitivity and the like, and has characteristics of simple and easy operation, and on-site detection without special detection personnel; the method is rapid and accurate in detection, has a good application effect in preliminary application, and provides a method for rapid diagnosis, virus traceability, epidemic disease monitoring and early warning of a wild animal epidemic disease source and the like in zoos and wild animal rescue institutions.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the field of virus detection of endangered wild animals, in particular to a primer set for simultaneously detecting ailuromastomavirus and canine distemper virus genotype 6 of ailuromastomavirus in a small panda, a kit and application thereof. BACKGROUND

[0002] The small panda, as a rare and endangered wild animal, has a high ecological protection value and scientific research value. However, its captive and wild populations are facing serious threats from various infectious diseases, among which the diseases caused by ailuromastomavirus and canine distemper virus genotype 6 of ailuromastomavirus are particularly prominent.

[0003] Ailuromastomavirus is a pathogen belonging to the parvovirus family, which can cause viremia, immune complex deposition, glomerulonephritis, hepatitis and systemic wasting disease after infection, has a high mortality rate, and poses a persistent threat to the small panda population. However, the virus is easily confused with canine parvovirus and feline parvovirus, leading to incorrect detection information and misdiagnosis and mistreatment of animal infections. Canine distemper virus genotype 6 of ailuromastomavirus is a specific genotype of canine distemper virus discovered in recent years. Currently, only small pandas in China have been found to carry this genotype of canine distemper virus. The average genetic distance between this virus and the known 18 main lineages (genotypes) is greater than 4.6%. Phylogenetic analysis based on the full-length genome and H gene sequences shows that the Asia-6 strain forms an independent evolutionary branch. Forty unique amino acid substitutions were found in multiple structural proteins (N, P, M, F, H, L), which have not been reported in other known strains. This genotype of canine distemper virus is highly susceptible and pathogenic to small pandas. After infection, it can cause respiratory symptoms, digestive symptoms and nervous system symptoms, with a rapid course and strong infectivity, often causing individual death and group epidemic outbreaks in small pandas.

[0004] Currently, the laboratory detection methods for these two viruses mainly rely on traditional virus isolation, serological detection and conventional polymerase chain reaction technology. Virus isolation is considered the "gold standard", but the operation is extremely tedious and time-consuming (several days to several weeks), requires high experimental conditions and biosafety level, and has unstable sensitivity, which cannot meet the needs of clinical rapid diagnosis and on-site screening. Serological detection can detect antibodies, but cannot effectively diagnose in the early stage (window period) of infection, and cannot distinguish between past infection and current infection, which is more complex in the context of vaccine immunization. Although the conventional PCR technology has significantly improved sensitivity and specificity compared with the former two methods, it relies on expensive and bulky thermal cyclers, the entire detection process takes a long time (usually 2-3 hours), and requires a professional laboratory environment and operators, which greatly limits its application in on-site environments such as farms, zoos and field monitoring sites.

[0005] More importantly, there is currently a lack of non-diagnostic detection tools that can simultaneously, quickly and efficiently detect the two important pathogens mentioned above. In actual epidemic prevention and control work, the clinical symptoms of the small panda may be similar, but the pathogens are different. If a single detection method is used, two independent detection processes need to be performed, which not only doubles the detection cost and time, but also increases the consumption of samples and reagents, and reduces the detection efficiency.

[0006] The recombinase-mediated isothermal nucleic acid amplification technology as a new nucleic acid rapid detection technology has the outstanding advantages of simple operation, rapid reaction and low equipment requirement because the reaction process is carried out at a constant low temperature without the need for a thermal cycler, and is very suitable for rapid detection reagents in the field. However, the application of this technology to multiplex fluorescence detection of small panda Aleutian virus and canine distemper virus type 6 is still blank. The technical difficulty lies in designing primer pairs that can be efficiently and specifically amplified under the same isothermal reaction conditions for two different pathogens, and matching compatible fluorescent probes, while avoiding the generation of primer dimers and cross-reactions, to ensure that the sensitivity and specificity of multiplex detection are not affected.

[0007] In summary, there is an urgent need in the art to develop a primer probe combination, kit and detection method based on the RAA technology that can simultaneously, quickly, sensitively and specifically detect small panda Aleutian virus and small panda canine distemper virus type 6, in order to fill the gap in the prior art and provide strong technical support for the epidemic monitoring, early warning and precise prevention and control of small pandas. SUMMARY

[0008] The purpose of the present application is to provide a primer set, kit and application for simultaneously detecting small panda Aleutian virus and small panda canine distemper virus type 6, in order to solve the problems existing in the prior art. The primer set provided by the present application can complete the detection within 20 min under constant temperature conditions of 39 DEG C, and has the characteristics of rapid detection, good specificity, high sensitivity, etc.

[0009] To achieve the above-mentioned purpose, the present application provides the following solutions:

[0010] The present application provides a primer set for simultaneously detecting small panda Aleutian virus and small panda canine distemper virus type 6, which comprises an ADV primer set and a CDV primer set.

[0011] The ADV primer set comprises an ADV-NS1-F1 with a nucleotide sequence as shown in SEQ ID NO. 3, an ADV-NS1-R3 with a nucleotide sequence as shown in SEQ ID NO. 8, and an ADV-NS1-Probe with a nucleotide sequence as shown in SEQ ID NO. 9.

[0012] The CDV primer set comprises a CDV-N-F1 with a nucleotide sequence as shown in SEQ ID NO. 10, a CDV-N-R2 with a nucleotide sequence as shown in SEQ ID NO. 13, and a CDV-N-Probe with a nucleotide sequence as shown in SEQ ID NO. 16.

[0013] Optionally, the ADV-NS1-Probe is labeled with a FAM fluorescent group at the 29th T, a THF tetrahydrofuran at the 31st T, and a BHQ1 fluorescent quenching group at the 33rd T at the 5' end.

[0014] The CDV-N-Probe is labeled with a ROX fluorescent group at the 26th T, a THF tetrahydrofuran at the 30th A, and a BHQ2 fluorescent quenching group at the 32nd T at the 5' end.

[0015] The application also provides an application of the primer set in the preparation of a kit for simultaneously detecting the Ailuropoda melanoleuca Alaskavirus and the Ailuropoda melanoleuca canine distemper virus Asia 6.

[0016] The application also provides a kit for simultaneously detecting the Ailuropoda melanoleuca Alaskavirus and the Ailuropoda melanoleuca canine distemper virus Asia 6, comprising the primer set.

[0017] Optionally, the kit simultaneously detects the Ailuropoda melanoleuca Alaskavirus and the Ailuropoda melanoleuca canine distemper virus Asia 6 according to the following steps:

[0018] The cDNA of the sample to be tested is used as a template to perform a RAA reaction by using the primer set according to claim 1 or 2, and the fluorescence signal is collected to obtain the Ct value of the sample to be tested.

[0019] Optionally, if a typical amplification curve appears in the FAM channel and the Ct is less than or equal to 35, it is determined that the sample to be tested contains the Ailuropoda melanoleuca Alaskavirus; if a typical amplification curve appears in the ROX channel and the Ct is less than or equal to 35, it is determined that the sample to be tested contains the Ailuropoda melanoleuca canine distemper virus Asia 6.

[0020] If the Ct is greater than 35 or no amplification curve appears, it is determined that the sample to be tested does not contain the Ailuropoda melanoleuca Alaskavirus and the Ailuropoda melanoleuca canine distemper virus Asia 6.

[0021] Optionally, the reaction condition of the RAA reaction is 39℃ for 20 min.

[0022] Optionally, the reaction system of the RAA reaction is RAA dry powder 1 tube, A buffer 25 μL, B buffer 2.5 μL, ADV-NS1-F1 2 μL, ADV-NS1-R3 2 μL, ADV-NS1-Probe 0.5 μL, CDV-N-F1 2 μL, CDV-N-R2 2 μL, CDV-N-Probe 0.5 μL, DNA template 5 μL and H2O 8.5 μL.

[0023] Optionally, the final concentration of the ADV-NS1-F1, the ADV-NS1-R3, the CDV-N-F1 and the CDV-N-R2 is 0.5 μM.

[0024] The final concentration of the ADV-NS1-Probe and the CDV-N-Probe is 0.2 μM.

[0025] The present application discloses the following technical effects:

[0026] The present application provides a primer group and a kit for specifically recognizing the small panda Aleutian parvovirus and the small panda canine distemper virus Asia 6, and the detection can be completed within 20 min under the condition of constant temperature at 39 DEG C; and the primer group does not cross-react with other common pathogens, and false positive phenomenon caused by primer dimer is not generated.

[0027] The present application has the advantages that the implementation process is simple and easy to operate, the detection can be performed on site without special detection personnel, the detection is rapid and accurate, and good application effect is obtained in preliminary application, and the present application has important significance for the prevention and control of the small panda Aleutian parvovirus and the small panda canine distemper virus Asia 6.

[0028] The present application can effectively distinguish the Aleutian parvovirus from the canine parvovirus, and can also effectively distinguish the canine distemper virus Asia 6 from other genotypes of the canine distemper virus, and in view of the fact that the canine distemper virus Asia 6 is currently only found in the small panda in China, the present application can also play a role in tracing and specific detection.

[0029] The detection method provided by the present application has the characteristics of rapid detection, good specificity, high sensitivity and the like, and can provide a method for rapid diagnosis of zoos and wild animal protection. BRIEF DESCRIPTION OF DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings needed in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the present application, and for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1 Agarose gel electrophoresis map of the amplified product of the Ailuropoda melanoleuca virus and the canine distemper virus Asia 6;

[0032] Figure 2 Screening result curve of the fluorescent amplification of the Ailuropoda melanoleuca virus primer group;

[0033] Figure 3 Screening result curve of the fluorescent amplification of the Ailuropoda melanoleuca canine distemper virus Asia 6 primer group;

[0034] Figure 4 Sensitivity test result curve of the Ailuropoda melanoleuca virus duplex fluorescent RAA primer group;

[0035] Figure 5 Sensitivity test result curve of the Ailuropoda melanoleuca canine distemper virus Asia 6 duplex fluorescent RAA primer group;

[0036] Figure 6 Specificity test result curve of the Ailuropoda melanoleuca virus and the Ailuropoda melanoleuca canine distemper virus Asia 6 duplex fluorescent RAA primer group;

[0037] Figure 7 Repeatability test result curve of the Ailuropoda melanoleuca virus and the Ailuropoda melanoleuca canine distemper virus Asia 6 duplex fluorescent RAA primer group;

[0038] Figure 8 Repeatability test result curve of the Ailuropoda melanoleuca virus and the Ailuropoda melanoleuca canine distemper virus Asia 6 duplex fluorescent RAA primer group. DETAILED DESCRIPTION

[0039] The various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0040] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where particular ranges of values are given, understand that each intervening value, to the upper or lower limit of the ranges is also specifically included. Each smaller range that falls within the broader ranges is also specifically included in the present application. The upper and lower limits of these smaller ranges can independently be included or excluded in the range.

[0041] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in full the methods and / or materials which are described herein. In case of conflict, the present specification will control.

[0042] Various modifications and changes can be made to the specific embodiments described herein without departing from the scope or spirit of the application. Other embodiments will be apparent to those of ordinary skill in the art from the description and examples provided herein. The description and examples are illustrative only.

[0043] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0044] The dry powder reaction tube, A Buffer, and B Buffer used in the present application were purchased from Hangzhou Zhongce Biotechnology Co., Ltd.

[0045] Example 1 Design of specific primers and probes

[0046] The Ailuropoda Alaskavirus DNA was extracted using the Tiangen Tissue Genomic DNA Extraction Kit and stored at -20°C.

[0047] A positive plasmid was constructed, and a recombinant plasmid DNA containing the target gene Ailuropoda Alaskavirus NS1 fragment was constructed. The recombinant plasmid was transformed into DH5a competent cells for amplification. The Plasmid Mini Kit I kit was used to extract the plasmid to determine the plasmid concentration, and the plasmid was stored at -20°C. The partial genomic sequence of the target gene ADV-NS1 is shown in SEQ ID NO. 1.

[0048] SEQ ID NO. 1:

[0049] TGTTAGCAGGGTTAATATGTAAAGCAACAGTAAACTATGGTGTAGTGACTACAAGCAACCCAAACTTTCCATGGACTGACTGTGGTAATAGAAACATTATCTGGGCTGAAGAGTGTGGTAACTTAGGTAACTGGGTTGAAGATTTTAAAGCCATCACCGGAGGTGGTGATGTGAAAGTAGA.

[0050] The RNA fast 200 total RNA extraction kit was used to extract the small panda canine distemper virus Asia 6 RNA, and the PrimeScript ™ RT reagent Kit was used to prepare cDNA, which was stored at -20℃.

[0051] A positive plasmid was constructed, which contained the recombinant plasmid DNA of the target gene small panda canine distemper virus Asia 6 N gene fragment. The recombinant plasmid was transformed into DH5α competent cells for amplification. The Plasmid Mini Kit I kit was used to extract the plasmid to determine the plasmid concentration, which was stored at -20℃. The partial genomic sequence of the target gene small panda canine distemper virus Asia 6 N gene is shown in SEQ ID NO. 2.

[0052] SEQ ID NO. 2:

[0053] CAATATATTGCTAGCTTCCATCTTGGCTCAAATTTGGATCCTGCTCGCTAAAGCAGTGACTGCCCCTGATACCGCAGCCGACTCGGAAATGAGAAGGTGGATTAAGTATACCCAACAGAGACGTGTGGTCGGGGAATTTAGAATGAACAAAATCTGGCTTGATATTGT.

[0054] The amplification products of the above small panda Aleutian virus and canine distemper virus Asia 6 were subjected to agarose gel electrophoresis, and the results are shown in Figure 1 The small panda Aleutian virus NS1 fragment and canine distemper virus Asia 6 N gene fragment were successfully amplified.

[0055] All small panda Aleutian virus NS1 gene sequences and all small panda canine distemper virus Asia 6 N gene sequences published in the NCBI GenBank database were compared respectively, and specific primers and probes were designed for the conserved region, as shown in Table 1. The primers and probes were synthesized and modified by Wuhan Tianyihuiyuan Biotechnology Co., Ltd.

[0056] Table 1 Primer probe sequences of the ailurid virus and the canine distemper virus type 6 of the ailurid

[0057]

[0058] The ADV-NS1-Probe probe is labeled with a FAM fluorescent group at the 29th T, a THF tetrahydrofuran at the 31st T, and a BHQ1 fluorescent quenching group at the 33rd T at the 5' end.

[0059] The CDV-N-Probe probe is labeled with a ROX fluorescent group at the 26th T, a THF tetrahydrofuran at the 30th A, and a BHQ2 fluorescent quenching group at the 32nd T at the 5' end.

[0060] Example 2 Screening and optimization of primer pairs

[0061] Three pairs of upstream and downstream amplification primer pairs of the ailurid virus NS1 and the canine distemper virus type 6 N gene were combined in pairs to obtain nine primer probe combinations, as shown in Table 2.

[0062] Table 2 Primer probe combinations of the ailurid ADV and CDV

[0063]

[0064] According to the number of reactions, a Mix containing water, A Buffer, an upstream primer, a downstream primer, and a probe was prepared according to the reaction system (Table 3), and then added to a detection unit tube containing the reaction dry powder. 10 5 copies / μL plasmid standard as a positive control template was added to the detection unit tube, and then B Buffer was added to the detection unit tube. The tube cap was covered, and the tube was inverted and shaken thoroughly for 5-6 times. Low-speed centrifugation was performed for 10 sec. The detection unit tube was placed in a Genchek fluorescence detector, and a 39℃ reaction was performed for 20 min to obtain an amplification curve.

[0065] Table 3 RAA reaction system

[0066]

[0067] The screening results of the optimal primer and probe combination of the ailurid ADV are shown in Table 3. Figure 2 The results show that the ADV-F1R3 primer probe combination has the earliest peak and the highest amplification efficiency, which is more conducive to the rapid and efficient amplification of the ailurid virus. Therefore, the good RAA primer combination is the upstream primer ADV-NS1-F1, the downstream primer ADV-NS1-R3, and the probe ADV-NS1-Probe.

[0068] The screening results of the best primer and probe combination of CDV Asia 6 type of small panda are shown in Table 5. Figure 3 As shown in Table 5, the results show that the CDV-F1R2 primer probe combination curve peaks earliest and has the highest amplification efficiency, which is more conducive to the rapid and efficient amplification of CDV Asia 6 type of small panda. Therefore, the good RAA primer combination is the upstream primer CDV-N-F1, the downstream primer CDV-N-R2 and the probe CDV-N-Probe.

[0069] Example 3 Establishment and optimization of reaction system

[0070] In the total reaction system 50 μL (Table 4), 5 μL of sterile water, 25 μL of A Buffer, 2.5 μL of B Buffer, 2.5 μL of small panda Aleutian and canine distemper virus Asia 6 type gene template, 5 μL in total, the probe concentration is set to 0.2 μM, the upstream and downstream primer concentration gradients of small panda Aleutian and canine distemper virus Asia 6 type are 0.4 μM, 0.5 μM and 0.6 μM, and the concentrations of the two primers are cross-reacted to form 9 combinations. The reaction is carried out at 39℃ for 20 min, and the amplification curve is obtained.

[0071] Table 4 Optimization of RAA reaction system

[0072]

[0073] Table 5 RAA primer probe concentration combination results

[0074]

[0075] Through analysis of the detection results (Table 5), the best primer and probe concentration ratio confirmed in this embodiment is 5:2, wherein the upstream and downstream primer concentrations of small panda Aleutian virus are 0.5 μM, and the probe is 0.2 μM. The downstream primer concentration of small panda canine distemper virus Asia 6 type is 0.5 μM, and the probe is 0.2 μM.

[0076] Example 4 Double fluorescent RAA reaction system, kit and detection method of small panda Aleutian virus and small panda canine distemper virus Asia 6 type

[0077] According to the above primer and probe optimization ratio, the double fluorescent RAA reaction system of small panda Aleutian virus and small panda canine distemper virus Asia 6 type is shown in Table 6.

[0078] Table 6 RAA double fluorescent detection reaction system

[0079] Reagent name Volume used Final concentration RAA dry powder 1 tube - A buffer 25 μL - B buffer 2.5 μL - ADV-NS1-F1 (10 μM) 2 μL 0.5 M ADV-NS1-R3 (10 μM) 2 μL 0.5 μM ADV-NS1-Probe 0.5 μL 0.2 μM CDV-N-F1 (10 μM) 2 μL 0.5 μM CDV-N-R2 (10 μM) 2 μL 0.5 μM CDV-N-Probe 0.5 μL 0.2 μM DNA template 5 μL - H2O 8.5 μL - Total volume 50 μL -

[0080] The specific operation steps are as follows:

[0081] The total RNA of the sample to be tested is used as a template to prepare cDNA by reverse transcription reagent;

[0082] The prepared cDNA is used as a template, and RAA reaction is performed according to the reaction system in Table 6, and the reaction time is 20 min at 39°C to obtain an isothermal amplification curve. The FAM channel represents the ailu virus of the small panda, and the ROX channel represents the canine distemper virus type 6 of the small panda in Asia;

[0083] Structure determination:

[0084] The isothermal amplification results of the positive control: there is a typical amplification curve, and Ct≤30; the isothermal amplification results of the negative control: no amplification curve appears, or Ct>40; the above positive control and negative control are effective results, which are used as a control standard to determine whether the sample to be tested contains the ailu virus of the small panda and the canine distemper virus type 6 of the small panda in Asia.

[0085] The sample to be tested: if a typical amplification curve appears in the FAM channel or the ROX channel, Ct≤35, then the sample to be tested contains the ailu virus of the small panda or the canine distemper virus type 6 of the small panda in Asia;

[0086] Negative: if Ct>35, or no amplification curve appears, it is judged as a negative sample, that is, the sample to be tested does not contain the ailu virus of the small panda and the canine distemper virus type 6 of the small panda in Asia or does not reach the detection threshold of the ailu virus of the small panda and the canine distemper virus type 6 of the small panda in Asia.

[0087] Example 5: Sensitivity, repeatability and specificity verification of the detection method

[0088] 1. Sensitivity verification of the method

[0089] In order to explore the sensitivity of the fluorescent RAA detection method, the constructed positive plasmid was determined for concentration by using a full-wavelength enzyme marker (Thermo Fisher). The copy number was calculated according to the copy number calculation formula: copy number (copies / μL)=[DNA concentration (ng / μL) / fragment size (bp)]×9.12×10 11 Subsequently, the positive plasmid was diluted by 10 times in ratio to 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL. The positive plasmid with different dilution degrees was used as a template, the reaction system constructed in Example 4 was used, and a negative control (sterilized water) was set to determine the sensitivity of the fluorescent RAA detection method. From Figure 4 and Figure 5As can be seen from the FAM and ROX channels, obvious amplification curves appear when the concentration is as low as 10 copies / μL. Therefore, the detection method provided by the application has a minimum detection limit of 10 copies / μL for both the small panda Aleutian virus and the small panda canine distemper virus type 6.

[0090] 2. Method specificity verification

[0091] In order to explore whether the fluorescent RAA detection method will cross-react with other pathogens, the cDNA of feline calicivirus, canine parvovirus, canine distemper virus type 1 and porcine epidemic diarrhea virus was used as a template, and the cDNA containing small panda Aleutian virus and small panda canine distemper virus type 6 was set as a positive control to evaluate the specificity of the fluorescent RAA detection method.

[0092] The reaction system constructed in Example 4 was used to detect the different templates.

[0093] From Figure 6 As can be seen, the cDNA of the small panda Aleutian virus and the small panda canine distemper virus type 6 both appear obvious amplification curves, and the negative control and the templates of feline calicivirus, canine parvovirus, canine distemper virus type 1 and porcine epidemic diarrhea virus do not appear curve characteristics.

[0094] The above results show that the detection method does not cross-react with other common pathogens and does not have non-specific reactions with host RNA, and has high specificity.

[0095] 3. Method repeatability verification

[0096] In order to explore the repeatability effect of the fluorescent RAA detection method, the template concentration was set to 10 4 copies / μL and 10 3 copies / μL, respectively, and 3 repeated experiments were performed in parallel, and the results are shown in Figure 7 and Figure 8 At the concentrations of 10 4 copies / μL and 10 3 copies / μL, typical amplification curves appear, and the repeatability is good.

[0097] In summary, the double fluorescent RAA detection method for the Ailuropoda alleysan virus and the Ailuropoda canine distemper virus type 6 provided by the application can specifically detect the Ailuropoda alleysan virus and the Ailuropoda canine distemper virus type 6 from various pathogens, and the minimum detection limit of the two viruses is 10 copies / ul, the repeatability is good, the detection can be completed in 20 min, has good popularization value and application prospect, and can also provide effective technical support for rapid detection screening of the Ailuropoda alleysan virus and the Ailuropoda canine distemper virus type 6 and tracing, early warning and comprehensive prevention and control of the diseases caused by the two viruses.

[0098] The above-described embodiments are only used to describe the preferred modes of the present application, and do not limit the scope of the present application, and various modifications and improvements to the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope determined by the claims of the present application.

Claims

1. A primer set for simultaneous detection of Ailuropoda melanoleuca Aleutian virus and Ailuropoda melanoleuca canine distemper virus Asia 6, characterized in that, The primer set comprises an ADV primer set and a CDV primer set; The ADV primer set comprises ADV-NS1-F1 with a nucleotide sequence as shown in SEQ ID NO. 3, ADV-NS1-R3 with a nucleotide sequence as shown in SEQ ID NO. 8, and ADV-NS1-Probe with a nucleotide sequence as shown in SEQ ID NO. 9; The CDV primer set comprises CDV-N-F1 with a nucleotide sequence as shown in SEQ ID NO. 10, CDV-N-R2 with a nucleotide sequence as shown in SEQ ID NO. 13, and CDV-N-Probe with a nucleotide sequence as shown in SEQ ID NO.

16.

2. The primer set of claim 1, wherein The ADV-NS1-Probe is labeled with a FAM fluorescent group at the 29th T at the 5' end, a THF tetrahydrofuran at the 31st T, and a BHQ1 fluorescent quenching group at the 33rd T; The CDV-N-Probe is labeled with a ROX fluorescent group at the 26th T at the 5' end, a THF tetrahydrofuran at the 30th A, and a BHQ2 fluorescent quenching group at the 32nd T.

3. Use of the primer set of claim 1 or 2 in the preparation of a kit for simultaneously detecting the Aleutian disease virus of small pandas and the canine distemper virus type 6 of small pandas.

4. A kit for simultaneous detection of Ailuropoda Sichuanensis virus and canine distemper virus Asia 6 type in small pandas, characterized in that, The kit comprises the primer set of claim 1 or 2.

5. The kit of claim 4, wherein The kit simultaneously detects the Aleutian disease virus of small pandas and the canine distemper virus type 6 of small pandas by the following steps: Using the cDNA of the sample to be tested as a template, performing a RAA reaction by using the primer set of claim 1 or 2, collecting the fluorescence signal, and obtaining the Ct value of the sample to be tested.

6. The kit of claim 5, wherein If a typical amplification curve appears in the FAM channel and the Ct is less than or equal to 35, it is determined that the sample to be tested contains the Aleutian disease virus of small pandas; if a typical amplification curve appears in the ROX channel and the Ct is less than or equal to 35, it is determined that the sample to be tested contains the canine distemper virus type 6 of small pandas; If the Ct is greater than 35 or no amplification curve appears, it is determined that the sample to be tested does not contain the Aleutian disease virus of small pandas and the canine distemper virus type 6 of small pandas.

7. The kit of claim 5, wherein The reaction condition of the RAA reaction is 39℃ and 20 min.

8. The kit of claim 5, wherein The reaction system of the RAA reaction is RAA dry powder 1 tube, A buffer 25 μL, B buffer 2.5 μL, ADV-NS1-F1 2 μL, ADV-NS1-R3 2 μL, ADV-NS1-Probe 0.5 μL, CDV-N-F1 2 μL, CDV-N-R2 2 μL, CDV-N-Probe 0.5 μL, DNA template 5 μL, and H2O 8.5 μL.

9. The kit of claim 8, wherein The final concentration of the ADV-NS1-F1, the ADV-NS1-R3, the CDV-N-F1, and the CDV-N-R2 is 0.5 μM. The final concentration of the ADV-NS1-Probe and the CDV-N-Probe is 0.2 μM.

Citation Information

Patent Citations

  • Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method for panda parvovirus

    CN116024384A

  • Constant-temperature detection kit and detection method for detecting pathogens

    WO2024066083A1