Deerasirox as human xanthine oxidase inhibitor and application thereof
By using deferasirox and its derivatives, the side effects of existing xanthine oxidase inhibitors have been resolved, providing a safe and effective treatment for uric acid reduction and related diseases. It significantly inhibits xanthine oxidase activity, reduces uric acid levels, and alleviates gout and other diseases.
Patent Information
- Application Number
- CN202410979709.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-19
- Publication Date
- 2026-01-20
AI Technical Summary
Existing xanthine oxidase inhibitors such as allopurinol, febuxostat, and topiplustat have serious and potentially fatal side effects, necessitating the development of novel, effective, and safe xanthine oxidase inhibitors to treat or prevent hyperuricemia and related diseases.
Deferrasrox or its pharmaceutically acceptable salts, esters, isomers, solvates or prodrugs are used to prepare drugs that inhibit the expression or activity of xanthine oxidase, reduce uric acid production and/or uric acid content, and are used to treat or prevent diseases such as gout, uric acid nephropathy, hyperuricemia, type 2 diabetes, hyperlipidemia, obesity, hypertension and atherosclerosis.
Deferrascosine significantly inhibits the expression or activity of human xanthine oxidase, effectively reducing uric acid levels and providing a safe and effective treatment option to reduce or inhibit uric acid production and alleviate or prevent related diseases.
Smart Images

Figure HDA0004956157060000011 
Figure HDA0004956157060000012 
Figure HDA0004956157060000013
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to delaroxide as a human xanthine oxidase inhibitor and its use. BACKGROUND
[0002] Due to changes in diet and lifestyle, the incidence of hyperuricemia (HUA) is on the rise worldwide. Hyperuricemia (HUA) is characterized by the production of high uric acid (UA), which can lead to gout and is associated with the development of metabolic syndrome, type 2 diabetes and cardiovascular disease. Blood uric acid is more than 390 mol / L is called "hyperuricemia", but has not reached the level of complete saturation; when the blood uric acid rises to 420 mol / L, it reaches complete saturation; more than 420 mol / L is called "supersaturation". In the state of supersaturation, uric acid in the blood is easy to deposit in tissues, and many tissues in the human body can have urate deposition, but the degree of deposition is different. Urate is mainly deposited in joints and their attached tissues, such as articular cartilage, tendons, synovial membrane, soft tissues around the joint, and intra-articular cavity, etc., and finally gouty arthritis occurs. Uric acid is also easy to deposit in some subcutaneous connective tissues, and the subcutaneous soft tissues of the auricle, metatarsal, palm, finger and wrist are common. Kidney is also an organ where uric acid is easy to deposit, and urate is mainly deposited in the interstitium and part of the renal tubule, and some can be deposited in the renal pelvis or ureter, forming uric acid nephropathy and kidney stones, ureteral stones or gouty nephropathy. Urate can also be directly deposited on the arterial vessel wall, directly damaging the intima of the blood vessel, becoming one of the auxiliary factors for the occurrence of arteriosclerosis.
[0003] Xanthine oxidase (XO) elevation is considered to be the main cause of HUA: purine is the main substance for the production of uric acid, and xanthine oxidase can catalyze the generation of xanthine from inosine, and then generate uric acid, and can also directly catalyze the generation of uric acid from xanthine. XO inhibitors are currently used in the clinic for the treatment of gout or HUA. However, existing XO inhibitors (allopurinol, febuxostat and topiroxostat) all have serious and potentially fatal side effects.
[0004] Therefore, there is an urgent need to develop new, effective and safe xanthine oxidase inhibitors. SUMMARY
[0005] In view of the above problems, the present application provides delaroxide as a xanthine oxidase inhibitor.
[0006] The present application first provides the use of delaroxide or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the preparation of a medicament for treating or preventing a disease or symptom that benefits from reducing or inhibiting the expression or activity of xanthine oxidase.
[0007] In one or more embodiments, the use comprises the use of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the manufacture of a medicament for treating or preventing a disease or condition that benefits from the inhibition of uric acid production and / or reduction of its content.
[0008] In one or more embodiments, the disease or condition comprises, but is not limited to, one or more of gout, uric acid nephropathy, hyperuricemia, type 2 diabetes, hyperlipidemia, obesity, hypertension and atherosclerosis.
[0009] A second aspect of the present application provides the use of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the manufacture of a human xanthine oxidase inhibitor.
[0010] A third aspect of the present application provides the use of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the manufacture of a preparation for reducing or inhibiting uric acid production.
[0011] A fourth aspect of the present application provides a pharmaceutical composition, characterized in that the pharmaceutical composition comprises:
[0012] (a) deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof;
[0013] (b) a drug that reduces uric acid content and / or inhibits its production, and / or a drug that reduces or inhibits xanthine oxidase expression or activity; and optionally
[0014] (c) a pharmaceutically acceptable excipient.
[0015] In one or more embodiments, the drug of (b) is selected from one or more of topiroxostat, febuxostat, allopurinol, probenecid, a loop diuretic, a thiazide diuretic and a thiazide-like diuretic.
[0016] A fifth aspect of the present application provides a kit or a pharmaceutical kit, comprising:
[0017] (a) deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof;
[0018] (b) a drug that reduces uric acid content and / or inhibits its production, and / or a drug that reduces or inhibits xanthine oxidase expression or activity; and
[0019] (c) an instruction for administering the components of (a) and (b) to a subject in need thereof;
[0020] Preferably, the kit or the pharmaceutical kit comprises the pharmaceutical composition as described in any of the embodiments herein and an instruction for administering the pharmaceutical composition to a subject in need thereof.
[0021] The sixth aspect of the present application provides a method for preparing a human xanthine oxidase inhibitor, which comprises the step of mixing deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof with a carrier or an excipient.
[0022] The seventh aspect of the present application provides a method for screening a potential substance for inhibiting the production of uric acid and / or reducing the content of uric acid, which comprises:
[0023] (1) providing a substrate cell system, inducing the system to express xanthine oxidase, and treating the system with deferasirox when inducing the system to express xanthine oxidase;
[0024] (2) adding a candidate substance to the system of (1) and observing the effect of the candidate substance on the substrate cell system;
[0025] If the candidate substance can specifically promote deferasirox to inhibit the production of uric acid and / or reduce the content of uric acid, the candidate substance is a potential substance that can be used in combination with deferasirox to inhibit the production of uric acid and / or reduce the content of uric acid.
[0026] The eighth aspect of the present application provides a method for (1) inhibiting the production of uric acid and / or reducing the content of uric acid, and / or (2) reducing and / or inhibiting the expression or activity of xanthine oxidase, which comprises administering a therapeutically or prophylactically effective amount of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof to a subject in need.
[0027] The ninth aspect of the present application provides a method for preventing, alleviating or treating hyperuricemia or a related disease, which comprises administering a therapeutically or prophylactically effective amount of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof to a subject in need.
[0028] The sixth aspect of the present application provides a method for preventing, alleviating or treating gout or a related disease, which comprises administering a therapeutically or prophylactically effective amount of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof to a subject in need.
[0029] In one or more embodiments, the subject is a mammal, particularly a human.
[0030] In one or more embodiments, the xanthine oxidase is derived from a human. BRIEF DESCRIPTION OF DRAWINGS
[0031] Figure 1 Deferasirox was verified in a stable overexpression of human XO AML12 cell line.
[0032] Figure 2To establish a hyperuricemia mouse model with liver-specific Uox gene knockout based on CRISPR-Cas9.
[0033] Figure 3 To verify the in vivo uric acid-lowering effect of deferasirox.
[0034] Figure 4 To verify the in vitro non-inhibitory effect of deferasirox on XO in mice.
[0035] Figure 5 To verify deferasirox in human liver primary cell-derived liver organoids.
[0036] Figure 6 To verify deferasirox in humanized XO mice. DETAILED DESCRIPTION
[0037] To enable persons skilled in the art to understand the characteristics and effects of the present application, the following is a general description and definition of the terms and phrases mentioned in the specification and claims. Unless otherwise specified, all technical and scientific words used herein have their usual meanings to those skilled in the art of the present application, and in the event of a conflict, the definitions in the present specification shall prevail.
[0038] Theories or mechanisms described and disclosed herein, whether correct or not, should not be considered limiting on the scope of the present application, i.e., the present application can be practiced without regard to any particular theory or mechanism.
[0039] Herein, "comprise", "include", "contain", and similar words cover the meanings of "consist essentially of" and "consist of", for example, when it is disclosed herein that "A comprises B and C", "A consists essentially of B and C" and "A consists of B and C" should be considered to have been disclosed herein.
[0040] As used herein, the terms "comprise", "include", "contain" are used interchangeably and include not only the closed definition, but also the semi-closed and open definition. In other words, the terms include "consist of", "consist essentially of".
[0041] As used herein, the term "effective amount" means an amount that produces a function or activity and is acceptable to humans and / or animals. Those skilled in the art should understand that the "effective amount" can vary depending on the form of the pharmaceutical composition, the route of administration, the adjuvants used, the severity of the disease, and the use of other drugs, etc.
[0042] "Prevention" and "treatment" as described herein include delaying and arresting the progress of a disease, or eliminating a disease, and does not require 100% inhibition, eradication and reversal. In some embodiments, the compositions or pharmaceutical compositions described herein prevent, reduce, inhibit and / or reverse ischemia-reperfusion injury by, for example, at least about 10%, at least about 30%, at least about 50%, or at least about 80% compared to levels observed in the absence of the compositions or pharmaceutical compositions described herein.
[0043] Herein, when describing embodiments or examples, it is to be understood that the invention is not limited to these embodiments or examples. Rather, all alternatives, modifications and equivalents of the methods and materials described herein, which are within the scope of the invention, are to be included herein.
[0044] Herein, for the sake of brevity, not all possible combinations of the various technical features described in each embodiment or example are described. Therefore, any combination of the various technical features in each embodiment or example can be made, as long as the combination is not contradictory, and all possible combinations are to be considered as within the scope of the present specification.
[0045] The inventors of the present application have found that deferasirox can significantly inhibit or reduce the expression or activity of human xanthine oxidase, and that, while many drug evaluations only consider the safety of a drug, the inventors of the present application have also found that deferasirox only inhibits human xanthine oxidase, but does not inhibit mouse xanthine oxidase, ignoring the species difference.
[0046] Deferasirox
[0047] As described herein, "deferasirox" is also known as "Deferasirox", and has the chemical name of 4-[3,5-di(2-hydroxyphenyl)-1,2,4-triazol-1-yl]benzoic acid, and a molecular formula of C 21 H 15 N3O4, and a CAS number of 201530-41-8.
[0048] The present application also includes pharmaceutically acceptable salts, esters, isomers, solvates or prodrugs of deferasirox, as long as they also have the same or substantially the same function as deferasirox. In the present application, a "pharmaceutically acceptable" ingredient is a substance suitable for use in humans and / or animals without excessive adverse side effects (such as toxicity, irritation and allergic reactions) and has a reasonable benefit / risk ratio. The "pharmaceutically acceptable salt" can be an acid salt and a base salt of deferasirox.
[0049] "Pharmaceutically acceptable acid salt" means a salt that retains the biological activity and properties of the free base and that is not biologically or otherwise undesirable. Such salts can be derived from inorganic acids such as, but not limited to, hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, and the like, and organic acids such as, but not limited to, acetic, dichloroacetic, adipic, alginic, ascorbic, aspartic, benzenesulfonic, benzoic, 4-acetamidobenzoic, camphoric, camphorsulfonic, capric, caproic, caprylic, carbonic, cinnamic, citric, cyclamic, dodecylsulfonic, ethane sulfonic, ethanesulfonic, glycolic, glycerophosphoric, glycollylarsinic, fumaric, galactaric, gentisic, glucoheptonic, gluconic, glucuronic, glutamic, glutaric, 2-oxo-glutaric, glycerophosphoric, glycolic, hippuric, isobutyric, lactic, lactobionic, lauric, maleic, malic, malonic, mandelic, methanesulfonic, mucic, naphthalene-1,5-disulfonic, 2-naphthalenesulfonic, 1 -naphthol-2-carboxylic, nicotinic, oleic, orotic, oxalic, palmitic, pamoic, propionic, pyroglutamic, pyruvic, salicylic, 4-amino-salicylic, sebacic, stearic, succinic, tartaric, thiocyanic, p-toluenesulfonic, trifluoroacetic, undecylenic, and the like.
[0050] "Pharmaceutically acceptable base salt" means a salt that retains the biological activity and properties of the free acid and that is not biologically or otherwise undesirable. These salts are prepared from inorganic bases or from organic bases. Salts from inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, and the like. Preferred inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion-exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, phenethylamine, N,N'-dibenzylethylenediamine, ethylenediamine, glucosamine, methylglucosamine, theobromine, triethanolamine, tromethamine, purines, piperizine, piperidine, N-ethylpiperidine, polyamine resins, and the like. Preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.
[0051] In the present invention, deferasirox can exist as solvates (e.g. hydrates), including monohydrate, dihydrate, hemihydrate, sesquihydrate, trihydrate, tetrahydrate, and the like. In the present invention, prodrugs of deferasirox are also included. As used herein, "prodrug" means a compound that, when administered to a subject, undergoes metabolic or chemical conversion in the subject to yield the desired deferasirox.
[0052] In the present invention, isomers of deferasirox are also included. This is because the compounds have one or more asymmetric centers, so the compounds can exist as racemic mixtures, as individual enantiomers, as individual diastereomers, as mixtures of diastereomers, as cis or trans isomers.
[0053] Applications and methods
[0054] The inventors have found that deferasirox can effectively reduce or inhibit the expression or activity of human xanthine oxidase and significantly reduce the content of uric acid.
[0055] Accordingly, the present invention provides the use of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the manufacture of a medicament or formulation for: treating or preventing a disease or condition that benefits from reducing or inhibiting the expression or activity of human xanthine oxidase.
[0056] In some embodiments, the use includes the medicament or formulation for: treating or preventing a disease or condition that benefits from inhibiting the production of uric acid and / or reducing its content.
[0057] A "disease or condition that benefits from a decrease or inhibition of xanthine oxidase expression or activity" or "disease or condition that benefits from a decrease in uric acid levels" as described herein is generally a disease associated with xanthine oxidase or uric acid, including but not limited to gout, uric acid nephropathy (as in references Zhu, P.; Liu, Y.; Han, L.; Xu, G.; Ran, J. M. Serum uric acid is associated with incident chronic kidney disease in middle-aged populations: A meta-analysis of 15 cohort studies. PLoS ONE 2014, 9, e100801. and Li, L.; Yang, C; Zhao, Y.; Zeng, X.; Liu, F.; Fu, P. Is hyperuricemia an independent risk factor for new-onset chronic kidney disease? : A systematic review and meta-analysis based on observational cohort studies. BMC Nephrol. 2014, 15, 122.), hyperuricemia, type 2 diabetes (as in references Jia, Z.; Zhang, X.; Kang, S.; Wu, Y. Serum uric acid levels and incidence of impaired fasting glucose and type 2 diabetes mellitus: A meta-analysis of cohort studies. Diabetes Res. Clin. Pract. 2013, 101, 88-96. and Kodama, S.; Saito, K.; Yachi, Y.; Asumi, M.; Sugawara, S.; Totsuka, K.; Saito, A.; Sone, H. Association between serum uric acid and development of type 2 diabetes. Diabetes Care 2009, 32, 1737-1742.), hyperlipidemia (as in references Chen, S.; Yang, H.; Chen, Y.; Wang, J.; Xu, L.; Miao, M.; Xu, C;Association between serum uricacid levels and dyslipidemia in Chinese adults: A cross-sectional study and further meta-analysis. Medicine 2020, 99, e19088. and Goli, P.; Riahi, R.; Daniali, S. S.; Pourmirzaei, M.; Kelishadi, R. Association of serum uric acid concentration with components of pediatric metabolic syndrome: A systematic review and meta-analysis. J. Res. Med. Sci. 2020, 25, 43.), obesity (as in references Ogura, T.; Matsuura, K.; Matsumoto, Y.; Mimura, Y.; Kishida, M.; Otsuka, F.; Tobe, K. Recent trends of hyperuricemia and obesity in Japanese male adolescents, 1991 through 2002. Metabolism 2004, 53, 448-453. and Gong, M.; Wen, S.; Nguyen, T.; Wang, C.; Jin, J.; Zhou, L. Converging Relationships of Obesity and Hyperuricemia with Special Reference to Metabolic Disorders and Plausible Therapeutic Implications. Diabetes Metab. Syndr. Obes. 2020, 13, 943-962.), hypertension (as in references Wang, J.; Qin, T.; Chen, J.; Li, Y.; Wang, L.; Huang, H.; Li, J. Hyperuricemia and risk of incident hypertension: A systematic review and meta-analysis of observational studies. PLoS ONE 2014, 9, e114259. and Grayson, P. C.; Kim, S. Y.and incident hypertension: A systematic review and meta-analysis. Arthritis Care. Res 2011, 63, 102-110.) and atherosclerosis (as in references Ma, M.; Wang, L.; Huang, W.; Zhong, X.; Li, L.; Wang, H.; Peng, B.; Mao, M. Meta-analysis of the correlation between serum uric acid level and carotid intima-media thickness. PLoS ONE 2021, 16, e0246416. and Ji, X.; Leng, X. Y.; Dong, Y.; Ma, Y. H.; Xu, W.; Cao, X. P.; Hou, X. H.; Dong, Q.; Tan, L.; Yu, J. T. Modifiable risk factors for carotid atherosclerosis: A meta-analysis and systematic review. Ann. Transl. Med. 2019, 7, 632.). In exemplary embodiments, the uric acid level is serum uric acid level or uric acid level in cell supernatant, the cells are hepatocytes, and the cells or serum source is a mammal, especially a human.
[0058] In some embodiments, also provided herein is the use of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the manufacture of a human xanthine oxidase inhibitor.
[0059] In some embodiments, also provided herein is the use of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the manufacture of a formulation for reducing or inhibiting uric acid production.
[0060] Another aspect of the present application provides a method of carrying out the above use, the method comprising treating or administering to a subject in need thereof serum or cells with (a) deferasirox as described herein, and pharmaceutically acceptable salts, esters, isomers, solvates or prodrugs thereof, and optionally (b) an agent capable of inhibiting or reducing uric acid production in the serum or cells. As used herein, the term "administering" or "administration" means providing the subject with the compound or agent or medicament of the present application to a subject suffering from or at risk of the disease or condition to be treated or prevented.
[0061] In some embodiments, the present application provides a method of reducing or inhibiting the expression or activity of xanthine oxidase, comprising administering to a subject in need thereof an effective amount of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof, or a pharmaceutical composition comprising deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof.
[0062] In some embodiments, the present application provides a method of reducing uric acid levels in a subject, comprising administering to a subject in need thereof an effective amount of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof, or a pharmaceutical composition comprising deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof.
[0063] In some embodiments, the present application provides a method of treating or preventing a disease or condition described herein that benefits from a reduction or inhibition of the expression or activity of xanthine oxidase, or a disease or condition that benefits from a reduction in uric acid levels, comprising administering to a subject in need thereof an effective amount of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof, or a pharmaceutical composition comprising deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof.
[0064] In the methods described herein, deferasirox can be administered at a dose known in the art, for example, a conventional starting dose of 5 to 30 mg / kg, such as 5 mg / kg or 10 mg / kg, but the total dose taken should not exceed 30 mg / kg per day. After the treatment is initiated, the uric acid levels or xanthine oxidase levels can be monitored monthly, and the dose of deferasirox can be adjusted every 3 to 6 months as necessary based on the trend of the levels. The dose adjustment can be made in steps of 5 to 10 mg / kg according to the convention in the art, and if the disease condition cannot be well controlled with an increase of 30 mg / kg per day, a dose of up to 40 mg / kg can be considered, but the dose should not exceed 40 mg / kg per day as much as possible. If the uric acid levels or xanthine oxidase levels have reached the target levels, the dose can be reduced in steps of 5 to 10 mg / kg, and if necessary, the deferasirox treatment can be suspended. In an exemplary embodiment, the dose for a mouse is 20 mg / kg.
[0065] Pharmaceutical compositions
[0066] The compositions of the present application (e.g., pharmaceutical compositions) contain deferasirox, or a salt, ester, isomer, solvate, prodrug, etc. thereof as an active ingredient. As described above, the deferasirox contained therein can inhibit the production of uric acid or reduce the uric acid levels in cells or serum, reduce or inhibit the expression or activity of xanthine oxidase, prevent, alleviate and treat diseases that benefit from a reduction or inhibition of the expression or activity of xanthine oxidase, and prevent, alleviate and treat diseases that benefit from a reduction in uric acid levels.
[0067] When the pharmaceutical compositions described herein are used as medicaments, they can also be pharmaceutical compositions further comprising a pharmaceutically acceptable excipient. A "pharmaceutically acceptable excipient" is a carrier, solvent, suspending agent or vehicle that is pharmaceutically or food-acceptable for delivery of the active ingredients (e.g., deferasirox) in the compositions of the present application to an animal or human. Exemplary excipients can be liquid or solid and include, but are not limited to, pH adjusting agents, surfactants, carbohydrates, adjuvants, antioxidants, chelating agents, ionic strength enhancers, preservatives, carriers, glidants, sweeteners, dyes / colorants, flavor enhancers, wetting agents, dispersing agents, suspending agents, stabilizers, isotonic agents, solvents, emulsifiers, spray-drying agents, compressed air or other suitable gases, or other suitable non-active ingredients for use with the pharmacodynamic compounds. More specifically, suitable excipients can be those commonly used in the art for administration of small molecule compounds. Examples of excipients include various lactose, mannitol, oils such as corn oil, buffers such as PBS, saline, polyethylene glycol, glycerol, polypropylene glycol, dimethylsulfoxide, amides such as dimethylacetamide, proteins such as albumin, and detergents such as Tween 80, monosaccharides and oligosaccharides such as glucose, lactose, cyclodextrins, and starches. As used herein, "physiologically or pharmaceutically acceptable carrier" refers to those carriers and diluents with which the agent is administered to an organism without significant irritation, and which do not abrogate the biological activity and properties of the agent in the pharmaceutical composition to be administered. "Physiologically or pharmaceutically acceptable excipient" refers to inert substances added to a pharmaceutical composition to further facilitate administration of the agent. Non-limiting examples of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols.
[0068] The agent in the pharmaceutical composition is present in a therapeutically effective amount or a prophylactically effective amount. An effective amount is an amount sufficient to improve or in some manner alleviate the symptoms associated with a disease. The amount administered is effective to improve or eliminate one or more symptoms, and can be determined by one of ordinary skill in the art based on the age, sex, physical condition, etc. of the subject. The selection of an effective amount can be determined by one of ordinary skill in the art (e.g., through clinical trials) based on various factors. Such factors include, but are not limited to, the pharmacokinetic parameters of the deferasirox, such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated in the patient, the weight of the patient, the immune status of the patient, the route of administration, etc. A therapeutically effective amount can be determined based on the age, sex, disease to be treated, severity of the disease, other physical conditions of the patient, etc. A therapeutically effective amount can be administered as a single dose, or can be administered in multiple doses according to an effective treatment regimen. As used herein, a subject or patient generally refers to a mammal, and more particularly to a human. Exemplarily, the composition contains, e.g., 0.1-100 mg, preferably 1-50 mg, more preferably 5-30 mg of the active ingredient (e.g., deferasirox).
[0069] The frequency of use of deferasirox can depend on the uric acid content or xanthine oxidase activity under certain conditions, for example, once a day, twice a day, once every two days, three times a week, five times a week, etc., one week, half a month, one month, three months, half a year as a course of treatment. In an exemplary embodiment, the frequency of administration is once a day.
[0070] The pharmaceutical composition of the present application can be formulated into any suitable dosage form for oral, intravenous injection or topical administration, etc. The dosage form can be various, as long as it can effectively reach the active ingredient in the mammalian body. For example, it can be selected from: injection, infusion, tablet, capsule, pill. The active ingredient (e.g. deferasirox) can be present in a suitable solid or liquid carrier or diluent. The mixture of active ingredients or pharmaceutical composition of the present application can also be stored in a sterile device suitable for injection or infusion. The effective dose of the active ingredient (e.g. deferasirox) in the composition can vary with the mode of administration and the severity of the disease to be treated, which can be based on the experience and advice of the clinician.
[0071] In a specific embodiment of the present application, a series of administration schemes of deferasirox at different molar concentrations are proposed. In the present application, mice are also used as experimental animals, and the conversion of the administration dose of mice to the administration dose for humans is easily made by those skilled in the art, which can be calculated according to the Meeh-Rubner formula:
[0072] A = K x (W2 / 3) / 10000;
[0073] In the formula, A is the body surface area, m 2 calculated; W is the body weight, g; K is a constant, which is different for different animal species, 9.1 for mice and rats, 9.8 for guinea pigs, 10.1 for rabbits, 9.9 for cats, 11.2 for dogs, 11.8 for monkeys, and 10.6 for humans. It should be understood that the conversion of the administration dose can vary according to the drug and the clinical situation, according to the assessment of experienced pharmacists.
[0074] Dialaroside or the pharmaceutical composition can be administered orally as well as by intravenous, intramuscular or subcutaneous routes, etc. Preferably, it can be administered orally. Pharmaceutical forms suitable for oral administration include, but are not limited to, tablets, powders, capsules, sustained release formulations, etc. Pharmaceutical forms suitable for injection include sterile aqueous solutions or dispersions and sterile powders. In all cases, the forms must be sterile and must be fluid to the extent that can be easily administered in the use of syringeable fluids. If necessary, dialaroside or the pharmaceutical composition can also be administered in combination with other active ingredients or drugs, including but not limited to other drugs known to prevent, alleviate or treat diseases related to hyperuricemia, such as drugs (active ingredients) known to (1) inhibit uric acid production and / or reduce uric acid content, and / or (2) reduce and / or inhibit the expression or activity of xanthine oxidase, and drugs known to treat one or more of gout, uric acid nephropathy, hyperuricemia, type 2 diabetes, hyperlipidemia, obesity, hypertension and atherosclerosis, such as topiroxostat, febuxostat, allopurinol and probenecid, such as diuretics (loop diuretics, thiazide diuretics and thiazide-like diuretics).
[0075] Kit and kit
[0076] The present application also provides a kit or a kit, which contains: (1) a drug that inhibits uric acid production and / or reduces uric acid content, and / or (2) a drug that reduces and / or inhibits the expression or activity of xanthine oxidase, and the kit or the kit contains the pharmaceutical composition described in any of the embodiments herein. Alternatively, the kit or the kit contains dialaroside or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof described herein. Alternatively, the kit or the kit contains: a container, and dialaroside or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof described herein placed in the container.
[0077] The kit or the kit can also contain some auxiliary materials for medication, such as the amount of instruments required for using or administering the composition of various dosage forms, containers such as syringes, etc. The kit or the kit can also contain instructions for use in administering to the subject in need, which describes the method of (1) inhibiting uric acid production and / or reducing uric acid content, and / or (2) reducing and / or inhibiting the expression or activity of xanthine oxidase.
[0078] Human xanthine oxidase inhibitor
[0079] In some embodiments, the present application provides a human xanthine oxidase inhibitor, which contains dialaroside or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof.
[0080] In some embodiments, the present application provides the use of dialaroside or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the preparation of a human xanthine oxidase inhibitor.
[0081] In some embodiments, the present application provides a method of preparing a human xanthine oxidase inhibitor, the method comprising the step of mixing deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof with a carrier or excipient. The carrier or excipient can be as described in any of the embodiments herein.
[0082] Screening method
[0083] In certain embodiments, the present application also provides a method of screening potential substances for inhibiting the production of uric acid and / or reducing the content of uric acid, the method comprising: (1) providing a substrate cell system, inducing the system to express xanthine oxidase, and treating the system with deferasirox at the time of inducing the system to express xanthine oxidase; (2) adding a candidate substance to the system of (1) and observing the effect of the candidate substance on the substrate cell system; wherein if the candidate substance can specifically promote deferasirox to inhibit the production of uric acid and / or reduce the content of uric acid, the candidate substance is a potential substance that can be used in combination with deferasirox to inhibit the production of uric acid and / or reduce the content of uric acid.
[0084] The present application will be further described in the following specific examples. It should be understood that these examples are merely illustrative and are not used to limit the scope of the present application. The methods and reagents used in the examples are conventional methods and reagents in the art, unless otherwise specified.
[0085] Example 1: Deferasirox validation in AML12 cell line stably overexpressing human XO
[0086] Experimental procedure: A cell line stably overexpressing human XO was constructed by lentivirus infection in mouse AML12 hepatocyte cell line, and the cells were passaged into 96-well plates at a density of 2 x 10 4 cells / well, and cultured in DMEF / 12 medium (10% FBS) for 24 h. Different concentrations (1, 10, 20 μM in DMSO) of deferasirox were added for pre-treatment for 24 h, and then the medium was replaced with serum-free and phenol red-free DMEM medium, and uric acid substrates inosine and guanosine were added at a concentration of 100 μM each for incubation for 8 h. The uric acid content in the supernatant of each group of cells and the effect on cell viability were detected. 1 μM allopurinol was used as a positive control, and DMSO was used as a blank control.
[0087] The results are shown in Table 1. Figure 1As shown, the level of uric acid in the supernatant of the hXO Cell Model group was significantly higher than that of the Control group, and 1 μM allopurinol could significantly reduce the level of uric acid in the supernatant, indicating that the model was successful. Deferasirox showed a dose-dependent inhibitory effect on the production of uric acid, and 1 uM also had a statistically significant effect, but 10 uM and 20 uM had better effects and did not significantly affect cell toxicity.
[0088] Example 2: Deferasirox has no inhibitory effect on mouse XO
[0089] (1) In vivo verification
[0090] 1.1 Establishment of a hyperuricemia mouse model with liver-specific Uox gene knockout based on CRISPR-Cas9
[0091] Experimental procedure: For liver-specific knockout of Uox, Uox-sgRNA (GTTCTCCATATTCAGAGAGA+AGG) was cloned into an AAV vector (the plasmid was obtained by modification in the laboratory, and the modification method was as follows: the original CMV promoter on the pAAV-GFP plasmid (Cell Biolabs, AAV-400) was replaced with a thyroid binding globulin (TBG) promoter, and the restriction enzyme cutting sites at both ends were Mlu I and EcoR I; GFP was replaced with Cre-T2A-Luciferase-sgRNA, and the restriction enzyme cutting sites at both ends were EcoR I and Xba I) to obtain AAV-Cre-Luci-sgUox, and AAV-Cre-Luci without sgRNA was used as a control plasmid. AAV viruses were packaged separately, and the packaging plasmids used were AAV-helper and AAV-8 (Cell Biolabs). Eight-week-old male homozygous Cas9 knockin mice were randomly divided into groups and injected intravenously with 2 x 10^11 virus titer per mouse. To establish a hyperuricemia animal model, after three weeks of AAV injection, the mice were given hypoxanthine (300 mg / kg) by gavage once a day for 7 days, and 0.5% CMC-Na solution was used as a control.
[0092] The results are shown in Table 1. Figure 2As shown, the serum uric acid of Uox-sgRNA+Hypoxanthine (mHUA Model) group was significantly higher than that of WT+Hypoxanthine group, while the serum uric acid of Uox-sgRNA group was not significantly higher than that of WT group, indicating that only the combination of Uox KO and gavage of Hypoxanthine can establish a hyperuricemia mouse model. Creatinine and urea nitrogen are two indicators of kidney function. The serum creatinine and urea nitrogen levels of the mHUA Model group were significantly higher than those of the WT+Hypoxanthine group, while the Uox-sgRNA group even had a decreasing trend compared with the WT group, indicating that high concentration of uric acid in serum induces kidney damage to some extent, and also proving that the hyperuricemia mouse model established by this method is successful.
[0093] 1.2 Verification of the in vivo uric acid-lowering effect of Deferasirox
[0094] Using the above method to establish a hyperuricemia mouse model, 20 mg / kg deferasirox or allopurinol as a positive control was gavaged 2h after gavage of hypoxanthine, once a day, and blood was taken 2h after gavage ended on the 7th day to detect the uric acid content in serum.
[0095] The results are shown in Figure 3 Compared with the mHUA Model group, gavage of 20 mg / kg deferasirox did not reduce the uric acid content in serum, while the positive control allopurinol significantly reduced the uric acid content in serum. This indicates that deferasirox may not have an inhibitory effect on mouse XO.
[0096] (2) In vitro verification
[0097] To further verify that deferasirox has no inhibitory effect on mouse XO, a cell line stably overexpressing mouse XO was constructed by lentivirus infection in the mouse AML12 hepatocyte line. Cells were passaged into 96-well plates at a density of 2x10 4 cells / well in DMEF / 12 medium (10% FBS) for 24h, 10μM deferasirox was added for 24h pretreatment, then the medium was replaced with serum-free, phenol-free DMEM medium and 100μM uric acid substrates inosine and guanosine were added for incubation for 8h. The uric acid content in the supernatant of each group and the effect on cell viability were detected. 1μM allopurinol was used as a positive control and DMSO as a blank control.
[0098] The results are shown in Figure 4As shown, 10 mM deferasirox treatment did not reduce the uric acid content in cell supernatant compared with the mXO Cell Model group, while the positive control allopurinol group significantly reduced the uric acid content in cell supernatant. This suggests that deferasirox cannot reduce uric acid by inhibiting mouse XO.
[0099] Example 3: Deferasirox validation in human liver primary cell-derived liver organoids and humanized XO mice
[0100] 3.1 Deferasirox validation in human liver primary cell-derived liver organoids
[0101] Human primary hepatocytes (provided by Professor Huijian Li, Institute of Molecular Cell Sciences, Chinese Academy of Sciences) were cultured according to known in vitro expansion and maturation protocols: primary human hepatocytes were seeded at a density of 3 x 10 4 cells / cm 2 in collagen I-coated 6-well plates, and the HM culture medium was replaced every 2 days, with a 5-6 day passage for expansion. For liver organoid culture, cells were seeded at a density of 8 x 10 4 cells / well in non-binding surface 96-well plates, and HIM culture medium was used to culture them in a normoxic incubator (5% CO2, 37°C) for 10 days to mature them into liver organoids. To detect the inhibitory effect of deferasirox on uric acid production, after 24 hours of pre-treatment with different concentrations (1, 10, 20 mM in DMSO) of deferasirox, the cells were incubated with serum-free, phenol red-free DMEM medium with the addition of guanosine and inosine (100 mM each) for 8 hours, and then the cell supernatant was collected, the uric acid content in the cell supernatant was detected using mass spectrometry, 1 mM allopurinol was used as a positive control, and DMSO was used as a blank control.
[0102] The results are shown in Figure 5 As shown, deferasirox also showed a dose-dependent inhibitory effect on uric acid production in human liver primary cell-derived organoids, and had no significant effect on cell toxicity.
[0103] 3.2 Deferasirox validation in humanized XO mice
[0104] The humanized XO mouse is constructed by Zhi Cuo Yao Kang. The construction strategy is to insert the human CDS sequence + 3'UTR region after the ATG start codon of the mouse XO gene in situ, and then add the PloyA termination signal. The mouse sequence is terminated and not expressed. Then the humanized XO mouse is mated with the Cas9 knockin mouse. The liver Uox knockout is achieved by AAV tail vein injection. The modeling and drug treatment refer to the method of in vivo verification in Example 2.
[0105] The results are shown in Table 2. Figure 6 As shown in Table 2, compared with the hHUA model group, deferasirox and positive control allopurinol can significantly reduce the uric acid content in the serum of humanized XO mice, and both have no effect on the renal function creatinine and urea nitrogen of mice. It shows that deferasirox is a relatively safe and effective inhibitor targeting human XO.
Claims
1. Use of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the manufacture of a medicament for treating or preventing a disease or condition that benefits from reducing or inhibiting the expression or activity of human xanthine oxidase.
2. The use according to claim 1, which comprises the use of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the manufacture of a medicament for treating or preventing a disease or condition that benefits from inhibiting the production of uric acid and / or reducing its content.
3. Use according to claim 1 or 2, characterized in that, The disease or condition comprises one or more of gout, uric acid nephropathy, hyperuricemia, type 2 diabetes, hyperlipidemia, obesity, hypertension and atherosclerosis.
4. Use of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the manufacture of a human xanthine oxidase inhibitor.
5. Use of deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof in the manufacture of a preparation for reducing or inhibiting the production of uric acid.
6. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises: (a) deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof; (b) a drug that reduces the content of uric acid and / or inhibits its production, and / or a drug that reduces or inhibits the expression or activity of xanthine oxidase; and optionally (c) a pharmaceutically acceptable excipient.
7. The pharmaceutical composition of claim 6, wherein (b) the drug is selected from one or more of topiroxostat, febuxostat, allopurinol, probenecid, a loop diuretic, a thiazide diuretic and a thiazide-like diuretic.
8. A kit or a pharmaceutical pack comprising: (a) deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof; (b) a drug that reduces the content of uric acid and / or inhibits its production, and / or a drug that reduces or inhibits the expression or activity of xanthine oxidase; and (c) an instruction for administering the components of (a) and (b) to a subject in need thereof; Preferably, the kit or the pharmaceutical pack comprises the pharmaceutical composition of claim 6 or 7 and an instruction for administering the pharmaceutical composition to a subject in need thereof.
9. A method for preparing a human xanthine oxidase inhibitor, which comprises the step of mixing deferasirox or a pharmaceutically acceptable salt, ester, isomer, solvate or prodrug thereof with a carrier or an excipient.
10. A method for screening a potential agent for inhibiting the production of uric acid and / or reducing its content, which comprises: (1) providing a substrate cell system, inducing the system to express xanthine oxidase, and treating the system with deferasirox at the time of inducing the system to express xanthine oxidase; (2) adding a candidate agent to the system of (1) and observing the effect of the candidate agent on the substrate cell system; wherein, if the candidate agent can specifically promote deferasirox to inhibit the production of uric acid and / or reduce the content of uric acid, the candidate agent is a potential agent for use with deferasirox to inhibit the production of uric acid and / or reduce its content.