Application of enterococcus faecium NSK220 in preparation of product with kidney protection function

Abstract

The invention relates to the technical field of probiotics, in particular to application of enterococcus faecium NSK220 in preparation of a product with a kidney protection function, the enterococcus faecium NSK220 is preserved in the China General Microbiological Culture Collection Center on January 6, 2025, the preservation address is No. 3, No.1 yard, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC NO.33306. The invention further discloses a preparation method of the enterococcus faecium NSK220. The strain has anti-inflammatory, anti-oxidation and immunoregulation functions, and can be used for preparing products with kidney protection functions.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of probiotics, in particular to application of Enterococcus lactis NSK220 in preparation of products with kidney protection function. BACKGROUND

[0002] Kidney is a key organ for maintaining metabolic balance and excreting waste, and its dysfunction can lead to toxin accumulation, water and electrolyte imbalance, and systemic inflammatory response. Nephritis (such as glomerulonephritis) is a common kidney disease, and its pathogenesis is closely related to immune abnormalities, oxidative stress and imbalance of inflammatory factors. In the process of nephritis, the decline of the antioxidant capacity of the kidney tissue will exacerbate the damage of the glomerulus and the renal tubule, and the dysfunction of the immune system will further promote the progression of the disease. Therefore, it is of great clinical significance to develop a kidney protection agent with anti-inflammatory, antioxidant and immunoregulatory functions.

[0003] The main treatment methods for nephritis at present include the use of hormones, immunosuppressants, antihypertensive drugs and diuretics, etc. Prednisone acetate is a kind of adrenal cortical hormone drug, which has multiple pharmacological effects such as anti-inflammatory, anti-allergic, immunosuppression, etc. However, it is found that prednisone acetate causes various side effects in clinical use, such as inhibition of insulin secretion, which can cause or aggravate diabetes; inhibition of gastric mucosa function, increase of gastric acid secretion, and induction of gastric discomfort, etc.

[0004] Lactic acid bacteria are normal flora in the intestines of humans and animals, and have physiological functions such as promoting growth, regulating normal flora in the gastrointestinal tract, maintaining microecological balance, improving gastrointestinal function, and improving immunity, etc., and no obvious toxic and side effects have been found. Enterococcus lactis was first isolated from cheese in 2012 (DOI: 10.1099 / ijs.0.030825-0), and is generally considered as a safe lactic acid bacteria. Based on the safety and probiotic properties of lactic acid bacteria, and the potential application value of Enterococcus lactis as an important member thereof, in-depth study on the effect of Enterococcus lactis in the field of kidney protection will provide a new research direction and practical significance for improving the health of the body. SUMMARY

[0005] In view of the technical problems that the existing nephritis treatment drugs (such as prednisone acetate) have side effects, and there is a lack of kidney protection preparations with anti-inflammatory, antioxidant and immunoregulatory functions, the present application provides application of Enterococcus lactis NSK220 in preparation of products with kidney protection function.

[0006] The technical scheme of the present application is as follows: The present application provides application of Enterococcus lactis NSK220 in preparation of products with kidney protection function, Enterococcus lactis (Lactococcus lactis) NSK220 is a kind of lactic acid bacteria, which has the advantages of safety and probiotic properties. Enterococcus lactis)NSK220 has been preserved in China General Microbiological Culture Collection Center on January 6, 2025, the address of the preservation center is No. 1, Beichen West Road, Chaoyang District, Beijing, the preservation number is CGMCC NO. 33306; the products include health care food and medicine.

[0007] Further, the kidney protection function includes enhancing the kidney protection function by improving nephritis; or / and, enhancing the kidney protection function by promoting the kidney antioxidant capacity; or / and, enhancing the kidney protection function by improving immunity.

[0008] Further, improving nephritis includes increasing TNF-α level, increasing IL-10 level and / or reducing serum creatinine level.

[0009] Further, improving nephritis includes reducing inflammatory cell infiltration, reducing glomerular mesangial proliferation and / or reducing kidney edema.

[0010] Further, promoting the kidney antioxidant capacity includes increasing the glutathione peroxidase activity of the kidney.

[0011] Further, improving immunity includes increasing thymus index.

[0012] Further, in the preparation process of the product, Enterococcus lactis NSK220 bacterial liquid is added.

[0013] Further, Enterococcus lactis NSK220 is inoculated in MRS liquid culture medium, and activated culture is carried out, so as to obtain Enterococcus lactis NSK220 bacterial liquid; the culture temperature of Enterococcus lactis NSK220 is 36~40℃, and the culture time is 12~24h.

[0014] Further, the viable bacterial count of Enterococcus lactis NSK220 in the product is ≥1×10 8 CFU / mL or ≥1×10 8 CFU / g.

[0015] Further, the dosage form of the product is liquid agent, tablet, granule, capsule, powder or emulsion.

[0016] The beneficial effects of the present application are: The application provides a lactococcus lactis NSK220 with kidney protection function, which can improve the immune function of a host by promoting thymus development, enhance the antioxidant capacity of the kidney by improving the glutathione peroxidase activity of the kidney, improve the kidney inflammation symptoms by regulating the levels of inflammatory factors (increasing IL-10 and increasing TNF-alpha), and significantly reduce pathological damages such as glomerular mesangial proliferation, inflammatory cell infiltration and kidney edema. Compared with prednisone acetate, the strain has higher safety and no serious side effects while maintaining similar therapeutic effects, and can be used as a long-term treatment option for nephritis.

[0017] In addition, the strain also has excellent intestinal probiotic properties: not only has strong self-aggregation, surface hydrophobicity, bile salt tolerance and gastric acid tolerance, can effectively colonize the intestinal tract and play a probiotic role for a long time; also has a significant inhibitory effect on a variety of diarrhea pathogenic bacteria and foodborne pathogenic bacteria, has potential application value in preventing and treating diarrhea while improving kidney function. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, for those skilled in the art, other drawings can also be obtained based on these drawings without creative labor.

[0019] Figure 1 The picture of the colony morphology of lactococcus lactis NSK220.

[0020] Figure 2 The picture of the gram staining of lactococcus lactis NSK220.

[0021] Figure 3 The 16S rRNA phylogenetic tree of lactococcus lactis NSK220.

[0022] Figure 4 The pheS phylogenetic tree of lactococcus lactis NSK220.

[0023] Figure 5Figure 1 is a diagram of antibiotic susceptibility assay results of Enterococcus lactis NSK220; wherein A is the susceptibility assay results of Enterococcus lactis NSK220 to penicillin (PEN), oxacillin (OX), ampicillin (AMP), piperacillin (PIP), and cephalexin (CN), B is the susceptibility assay results of Enterococcus lactis NSK220 to cefazolin (CZ), cefuroxime sodium (CXM), ceftazidime (CAZ), ceftriaxone (CTR), and cefoperazone (CPZ), C is the susceptibility assay results of Enterococcus lactis NSK220 to tetracycline (TET), streptomycin (S), kanamycin (KAN), amikacin (AMK), and gentamicin (GEN), D is the susceptibility assay results of Enterococcus lactis NSK220 to ciprofloxacin (CIP), minocycline (MI), erythromycin (E), norfloxacin (NOR), and azithromycin (AZI), E is the susceptibility assay results of Enterococcus lactis NSK220 to lincomycin (MY), vancomycin (VAN), polymyxin B (PB), cotrimoxazole (SXT), and chloramphenicol (C), and F is the susceptibility assay results of Enterococcus lactis NSK220 to clindamycin (CC), levofloxacin (LEV), imipenem (IPM), doxycycline (DO), and florfenicol (FFC).

[0024] Figure 6 Figure 2 is a diagram of bacteriostatic activity assay results of Enterococcus lactis NSK220; wherein A is the bacteriostatic activity assay results of Enterococcus lactis NSK220 on Escherichia coli, B is the bacteriostatic activity assay results of Enterococcus lactis NSK220 on Staphylococcus aureus, C is the bacteriostatic activity assay results of Enterococcus lactis NSK220 on Salmonella, D is the bacteriostatic activity assay results of Enterococcus lactis NSK220 on Pseudomonas aeruginosa, and E is the bacteriostatic activity assay results of Enterococcus lactis NSK220 on Listeria monocytogenes.

[0025] Figure 7 Figure 3 is a diagram of hemolysis test results of Enterococcus lactis NSK220; wherein a is the hemolysis results of Staphylococcus aureus, and b is the hemolysis results of Enterococcus lactis NSK220.

[0026] Figure 8 Figure 4 is a diagram of the genome circle of Enterococcus lactis NSK220.

[0027] Figure 9 Figure 5 is a diagram of the GO function annotation of the genome of Enterococcus lactis NSK220.

[0028] Figure 10 Figure 6 is a diagram of the KEGG function annotation of the genome of Enterococcus lactis NSK220.

[0029] Figure 11Figure for COG functional annotation of Enterococcus lactis NSK220 genome.

[0030] Figure 12 Figure for regulation results of IL-10 expression level in canine kidney cell inflammation model by Enterococcus lactis NSK220.

[0031] Figure 13 Figure for regulation results of TNF-α expression level in canine kidney cell inflammation model by Enterococcus lactis NSK220.

[0032] Figure 14 Figure for Veen plot of flora distribution.

[0033] Figure 15 Figure for cumulative box plot of species.

[0034] Figure 16 Figure for analysis of relative abundance of species at the level of phylum.

[0035] Figure 17 Figure for analysis of relative abundance of species at the level of genus.

[0036] Figure 18 Figure for LEfSe analysis of flora.

[0037] Figure 19 Figure for phylogenetic evolution branch diagram.

[0038] Figure 20 Figure for results of kidney impact of Enterococcus lactis NSK220 on nephritis mouse model. DETAILED DESCRIPTION

[0039] In order for those skilled in the art to better understand the technical solutions in the present application, the technical solutions in the embodiments of the present application will be described clearly and completely below in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor should belong to the scope of protection of the present application.

[0040] The Enterococcus lactis NSK220 bacterial solution mentioned in the following embodiments is obtained by inoculating Enterococcus lactis NSK220 in MRS liquid medium, and then activating and culturing at 37°C for a certain period of time.

[0041] Example 1: Isolation, screening, identification and preservation of strains 1. Sampling: healthy intestinal segments of adult male Duroc pigs were collected in Qingdao, Shandong Province in July 2020.

[0042] 2. Isolation and Screening of Bacterial Strains: Healthy intestinal samples were collected from five adult male Duroc pigs at a livestock farm in Jimo, Qingdao, China. Intestinal samples were taken using sterile swabs and placed in 50mL sterile screw-cap test tubes containing physiological saline. The samples were transported under refrigeration to the Innovation Technology Laboratory of Qingdao Wangpai Animal Health Products Co., Ltd., where they were vortexed for 15 seconds to release bacteria from the swab tip into the physiological saline, forming a bacterial suspension. This suspension was then serially diluted. MRS solid medium (MRS liquid medium with 14g / L agar) was prepared, sterilized at 121℃, and then allowed to cool to 40-50℃. 1mL of bacterial suspension from each of the different dilutions was added to sterile plates, and then the MRS solid medium (still molten) was poured into the plates to mix with the bacterial suspension. The plates were allowed to solidify and then incubated at 37℃ inverted. One bacterial strain was collected and named NSK220. The preparation method of MRS liquid culture medium is as follows: Mix 10g peptone, 8.0g beef extract, 4g yeast extract, 20g glucose, 1g Tween-80, 5g sodium acetate, 2g diammonium hydrogen citrate, 0.2g magnesium sulfate, 0.04g manganese sulfate, 2g dipotassium hydrogen phosphate, and 1000mL distilled water thoroughly. Adjust the pH to 5.7±0.2 and sterilize at 121℃ for 60 minutes before use.

[0043] 3. Identification and preservation of bacterial strains Based on morphological observation, microscopic examination, 16S rRNA sequencing comparison, and pheS sequencing comparison, the above-mentioned strain (NSK220) was identified as Enterococcus lactis. Enterococcus lactis It was renamed Enterococcus lactis NSK220.

[0044] For specific colony morphology photos, see [link to photos]. Figure 1 On MRS solid medium, the colonies have smooth surfaces and appear as viscous, milky-white, opaque, round colonies. See Gram-stained images below. Figure 2 The strain was Gram-positive, and the cells were spherical. These morphological and Gram-stained characteristics are similar to those of *Enterococcus lactis* (…). Enterococcus lactis The morphological characteristics of the strains are similar.

[0045] Phylogenetic analysis of the 16S rRNA and pheS genes of this strain confirmed a close phylogenetic relationship with Enterococcus lactis. Figure 3 The phylogenetic tree of the 16S rRNA gene sequence shows that Enterococcus lactis NSK220 belongs to the genus Enterococcus, combined with Figure 4 Physiophyllum information of the pheS gene indicates that the Enterococcus lactis NSK220 is Enterococcus lactis. Enterococcus lactis ).

[0046] Lactococcus lactis ( Enterococcus lactisThe 16S rRNA gene sequence of NSK220 (SEQ ID NO: 1) is:

[0047] Enterococcus lactis (ATCC 19433) Enterococcus lactis The pheS conservative gene sequence (sequence 2) of NSK220 is as follows: CACCCGGCCTCGTGATATGCAAGATACTTTCTATATTTCAGACGAGATCTTGATTCGGACACATACTTCACCAGTCCAAGCACGGACAATGGAAAAGCATGATTTCTCTAAGGGTGCTCTACGAATGATCTCGCCAGGAAAAGTTTTCCGCAGAGATACAGATGATGCGACCCACAGCCATCAGTTCCATCAAATTGAAGGGCTAGTTGTTGATAAAAACATCACGATGGGCGACCTTAAAGGAACATTAGAAGTCGTAATGAAAAAAATGTTTGGGGAAGAACGTGAAATCCGTTTGCGTCCAAGTTATTTCCCATTTACGGAGCCATCAGTAGAAGTAGATGTCAGCTGTTTCAAATGTGGTGGTGCCGGTTGTAACGTATGTAAATACACTGGCTGGATCGAGATTTTAGGAGCTGGCATGGTGCACCCGAATGTGTTGAAGATGTCAGGAATCAATCCAGAAGAATATTCAGGCTTTGCTTTCGGCCTAGG.

[0048] Enterococcus lactis (ATCC 19433) Enterococcus lactis Enterococcus lactis (ATCC 19433) NSK220 was sent to the China General Microbiological Culture Collection Center for preservation on January 6, 2025, and the preservation number is CGMCC NO. 33306.

[0049] Example 2 Growth characteristics of Enterococcus lactis NSK220 1. Physiological and biochemical characteristics The fatty acid composition of the strain was detected by a microbial fatty acid rapid identification system (MIDI), and the carbohydrate metabolism of the strain was detected by API50CH.

[0050] The MIDI detection result shows that the main fatty acids of Enterococcus lactis NSK220 are oleic acid, palmitic acid and myristic acid, and their contents are 12.74%, 6.95% and 4.57%, respectively.

[0051] The API 50CH test was performed on Enterococcus lactis NSK220, and the positive reactions in the API 50CH test results were L-arabinose, ribose, glucose, fructose, mannose, N-acetyl-glucosamine, uvaursi, esculin, cellobiose, maltose, lactose and sucrose; the negative reactions were glycerol, erythrose, D-arabinose, D-xylose, L-xylose, adonitol, beta-methyl-D-xyloside, sorbose, rhamnose, dulcitol, myo-inositol, sorbitol, alpha-methyl-D-glucoside, inulin, melibiose, raffinose, starch, glycogen, xylitol, D-turanose, D-lyxose, D-saccharose, L-saccharose, D-arabitol, L-arabitol, 2-keto-gluconate and 5-keto-gluconate.

[0052] 2. Growth performance and acid production performance determination The strain was inoculated into MRS liquid medium at an inoculation amount of 4% (v / v), and appropriate amounts of bacterial liquid were taken at 0 h, 1 h, 2 h, 3 h, 6 h, 9 h, 12 h, 15 h, 18 h, 24 h, 30 h, 36 h and 48 h for detection of OD 600 absorbance value and pH value of the bacterial liquid, with time as the abscissa and OD 600 absorbance value and pH value as the ordinate to draw the growth curve and acid production curve of the strain. Enterococcus lactis NSK220 mainly produces lactic acid, acetic acid and propionic acid.

[0053] As shown in Table 1, the strain was in the lag phase after inoculation for 0-3 h, and then grew rapidly into the logarithmic phase after 3 h, and the OD 600 absorbance value of the bacterial liquid tended to be stable, and the strain entered the stationary phase. The pH value of the bacterial liquid decreased slowly from 5.70 to 5.56 within 3 h after inoculation, and then decreased rapidly after 3 h, and finally stabilized at about 4.58.

[0054] Table 1 pH value and OD 600 absorbance value determination results of Enterococcus lactis NSK220

[0055] 3. Gastrointestinal colonization ability 3.1 Self-aggregation determination The Enterococcus lactis NSK220 bacterial liquid after 24 h of activation culture was centrifuged at 10000 rpm for 10 min, the supernatant was discarded, and the bacterial liquid was washed twice with PBS buffer and then resuspended in an equal volume of PBS buffer, and the OD 630 absorbance value (A1) was measured, then vortexed for 10 s, and incubated in a 37℃ constant temperature incubator for 8 h, 16 h and 24 h, respectively, and the upper liquid was carefully taken and the OD 630 absorbance value (A2) was measured. The test was repeated 3 times.

[0056]

[0057] Bacterial self-aggregation ability is generally classified into three categories: low (16%~35%), medium (35%~50%), and high (above 50%). As shown in Table 2, the self-aggregation rates of this strain after 8h, 16h, and 24h of culture were 74.03%, 80.75%, and 83.08%, respectively, indicating that this strain has high self-aggregation ability.

[0058] Table 2. Results of the self-aggregation test of Enterococcus lactis NSK220

[0059] Note: Data in the same row with no letter or the same letter above the header indicates that the difference is not significant. P >0.05), different lowercase letters indicate significant differences ( P <0.05).

[0060] 3.2 Surface hydrophobicity determination Take the activated Enterococcus lactis NSK220 bacterial culture after 24 hours of culture, centrifuge at 10,000 rpm for 10 minutes, discard the supernatant, wash twice with PBS buffer, and adjust the OD of the bacterial culture. 630 The absorbance value was 0.25 ± 0.05 (A3). Then, equal volumes of the bacterial suspension were mixed with xylene, chloroform, and a mixture of xylene and chloroform, respectively. The mixture was vortexed for 5 minutes to ensure thorough mixing and then incubated at 37°C for 4 hours. Finally, the aqueous phase was carefully aspirated, and the OD was measured. 630 Absorbance value (A4). The experiment was repeated 3 times.

[0061]

[0062] According to the definition of bacterial surface hydrophobicity, a hydrophobicity >50% is generally considered highly hydrophobic, between 20% and 50% is moderately hydrophobic, and <20% is non-hydrophobic. As shown in Table 3, this strain exhibits a hydrophobicity of 39.69% for xylene and 30.88% for chloroform. The hydrophobicity of a mixture of equal volumes of xylene and chloroform is 44.08%, significantly higher than that of xylene and chloroform alone. P The value <0.05 indicates that the strain has moderate hydrophobicity.

[0063] Table 3 Results of hydrophobicity assay for Enterococcus lactis NSK220 surface

[0064] Note: Data in the same row with no letter or the same letter above the header indicates that the difference is not significant. P >0.05), different lowercase letters indicate significant differences (P <0.05).

[0065] 3.3 Bile salt tolerance test Enterococcus lactis NSK220 and its control strain Enterococcus lactis CICC20421 were activated and cultured on MRS liquid medium for 24 h. After centrifugation at 10,000 rpm for 10 min at 4 °C, the supernatant was discarded, and the bacterial pellet was washed three times with sterile PBS (pH 7.0). The pellets were then resuspended in MRS liquid medium containing 0.1%, 0.3%, and 0.5% (w / v) porcine bile salts, respectively, and incubated at 37 °C on a shaker for 3 h. Before and after incubation, the viable cell count (N) was calculated using the plate count method, and the survival rate was calculated according to the formula. The experiment was repeated three times.

[0066]

[0067] As shown in Table 4, the average tolerance of this strain to 0.1%, 0.3% and 0.5% bile salts was 98.02%, 94.98% and 82.77%, respectively, all of which were higher than those of the control strain.

[0068] Table 4 Results of bile salt tolerance assay for strains

[0069] 3.4 Determination of acid resistance Enterococcus lactis NSK220 and control strain Enterococcus lactis CICC20421, after 18 hours of activation culture, were inoculated at 2.0% (v / v) into MRS liquid medium with initial pH values ​​of 2.0, 3.0, 4.0, 5.0, 6.0, and 7.0, respectively, and incubated at 37°C. Viable cell counts (N) were calculated at 0, 1, 2, and 3 hours using the plate count method, and the survival rate was calculated according to the formula. The experiment was repeated three times.

[0070]

[0071] As shown in Table 5, this strain exhibits high tolerance in acidic environments.

[0072] Table 5 Results of acid resistance test

[0073] 3.5 Temperature tolerance test The activated culture of Enterococcus lactis NSK220 and the control strain Enterococcus lactis CICC20421 were treated in water baths at 40℃, 50℃, 60℃ and 70℃ for 5 min, respectively. Immediately after treatment, they were placed in ice boxes, and the viable count (N) was calculated by plate counting. The survival rate was calculated according to the formula. The experiment was repeated 3 times.

[0074]

[0075] As shown in Table 6, the strain has strong resistance to 40°C and 50°C, and certain resistance to 60°C and 70°C, which is higher than that of the control strain, indicating that the strain is resistant to high temperature, and can be added or sprayed on the surface of functional food at high temperature of 60°C, simplifying the processing procedure and reducing the processing cost.

[0076] Table 6 Results of temperature resistance determination

[0077] 3.6 Cell adhesion capacity determination MDCK cells were cultured in cell culture bottles containing 4% (v / v) fetal bovine serum and 1% (v / v) penicillin-streptomycin-gentamicin mixed solution in DMEM medium. When the cells covered about 90% of the space, 800 μL of 0.25% trypsin digestion solution was added, and the cells were digested at 37°C for 5 min, and then uniformly blown and prepared into a cell suspension (concentration adjusted to 1 x 10 5 cells / mL) in DMEM medium, and then uniformly spread in a 12-well cell culture plate. After culturing to a dense monolayer, the culture medium was discarded, and the cells were washed 3 times with sterile neutral PBS buffer (pH value of 7.0). Then, 1 mL of activated culture solution of Enterococcus lactis NSK220 for 18 h (bacterial solution concentration adjusted to 1 x 10 8 CFU / mL, MOI of 1000, and the control strain was a commercial strain of Lactobacillus rhamnosus LGG) and 1 mL of antibiotic-free DMEM medium were added to the wells, and 2 mL of DMEM medium was added to the blank group. The cells were cultured at 37°C and 5% CO2 for 90 min. After the culture was completed, the cells were washed 5 times with PBS buffer, 1 mL of PBS solution containing 0.05% (v / w) triton X-100 was added, and the cells were lysed at 37°C for 20 min. The number of viable bacteria in the cell lysate was calculated using plate counting method, and the test was repeated 3 times.

[0078] MDCK cells are derived from canine kidney tubules and are widely used as a model of canine intestinal epithelial cells (DOI: 10.3390 / microorganisms12112284). The test results showed that the adhesion capacity of the control strain was 499 CFU / 100 cells for 90 min, and the adhesion capacity of Enterococcus lactis NSK220 to MDCK cells was 502 CFU / 100 cells, indicating that Enterococcus lactis NSK220 has strong cell adhesion capacity. In addition, Enterococcus lactis NSK220 still has an adhesion capacity of 433 CFU / 100 cells to inflamed MDCK cells.

[0079] Example 3 Antibiotic sensitivity determination The paper diffusion method was used to determine the antibiotic sensitivity of the strain. After 24 hours of activation culture, 100 μL of Enterococcus lactis NSK220 bacterial solution was uniformly coated on MRS solid medium. Penicillin, oxacillin, ampicillin, piperacillin, imipenem, vancomycin, streptomycin, gentamicin, amikacin, kanamycin, tetracycline, chloramphenicol, minocycline, doxycycline, cotrimoxazole, azithromycin, erythromycin, clindamycin, norfloxacin, ciprofloxacin, and levofloxacin were selected as 30 kinds of antibiotic paper (7 mm in diameter) and divided into 6 groups (A-E) and pasted on 6 MRS solid media. After being placed in a 37°C constant temperature incubator for 24 hours, whether there was a bacteriostatic ring was observed, and the diameter of each bacteriostatic ring was accurately measured. The test was repeated 3 times.

[0080] As can be seen from Table 7 and Figure 5 The strain has high sensitivity to tetracycline, minocycline, and florfenicol, moderate sensitivity to penicillin, ampicillin, piperacillin, cefoperazone, vancomycin, and chloramphenicol, low sensitivity to ampicillin, amikacin, gentamicin, erythromycin, azithromycin, norfloxacin, ciprofloxacin, levofloxacin, and imipenem, and no sensitivity to oxacillin, cefuroxime sodium, ceftazidime, ceftriaxone, lincomycin, polymyxin B, cotrimoxazole, kanamycin, streptomycin, and clindamycin.

[0081] Table 7 Antibiotic sensitivity test results

[0082] Note: Bacteriostatic ring diameter: +++: 22-26 mm; ++: 15-22 mm; +: 7-14 mm; -: no bacteriostatic ring.

[0083] Example 4 Bacteriostatic ability determination 1. Bacteriostatic test The Oxford cup double-layer agar diffusion method was used to determine the bacteriostatic ability of the strain. Escherichia coli (ATCC25922), Staphylococcus aureus (ATCC25923), Salmonella (ATCC14028), Pseudomonas aeruginosa (ATCC27853), and Listeria monocytogenes (ATCC19115) were enriched and cultured in TSB medium as indicator strains. In a 9 cm sterile culture dish, 5 mL of sterilized TSA agar was first added as the first layer. After solidification, the Oxford cup was placed, and TSA agar containing 1 × 10 7 CFU / mL of pathogenic bacteria was added as the second layer. After solidification, the test solution was added to the hole, and it was placed in a 37°C incubator for 24 hours. After the incubation was completed, the diameter of the bacteriostatic ring was accurately measured. The test was repeated 3 times.

[0084] Each pathogenic bacteria is set with four groups of test solutions, which are a: supernatant group (supernatant obtained by centrifuging the 18h-cultured Enterococcus lactis NSK220 bacterial solution at 10000r / min for 10min), b: bacterial solution group (18h-cultured Enterococcus lactis NSK220 bacterial solution), c: blank group (MRS liquid medium), and d: protein group (bacterial protein obtained by centrifuging the 18h-cultured Enterococcus lactis NSK220 bacterial solution at 10000r / min for 10min).

[0085] As shown in Table 8 and Figure 6 Table 8, the bacterial solution and supernatant of Enterococcus lactis NSK220 have bacteriostatic activity on pathogenic bacteria, and the bacteriostatic activity on Pseudomonas aeruginosa and Listeria monocytogenes is significantly better than that on Escherichia coli, Staphylococcus aureus and Salmonella (P<0.05). P <0.05). The bacterial protein has no bacteriostatic activity.

[0086] Table 8 Bacteriostatic test results

[0087] Note: The same data in the same column without letters or the same letters represent no significant difference (P>0.05), and different lowercase letters represent significant difference (P<0.05). P <0.05) P <0.05) 2. Cell adhesion competition test MDCK cells are cultured in cell culture bottles containing 4% (v / v) fetal bovine serum and 1% (v / v) penicillin-streptomycin-gentamicin mixed solution. When the cells cover about 90% of the space, 800μL of 0.25% trypsin digestion solution is added, and the cells are digested at 37°C for 5min, and then the cells are uniformly blown and prepared into a cell suspension (the concentration is adjusted to 1×10 5 cells / mL), which is uniformly spread in a 24-well cell culture plate, and after the culture reaches a dense monolayer, the culture solution is discarded, and the cells are washed with sterile neutral PBS buffer (pH 7.0) for 3 times, and then 500μL of activated 18h-cultured Enterococcus lactis NSK220 bacterial solution (the bacterial solution concentration is adjusted to 1×10 8 CFU / mL), 500μL of active 18h-cultured Escherichia coli ATCC25922 bacterial solution (the bacterial solution concentration is adjusted to 1×10 8 CFU / mL) and 1mL of antibiotic-free DMEM culture solution are added to the holes of the test group, and 500μL of MRS liquid medium, 500μL of 1×10 8CFU / mL of E. coli ATCC 25922 and 1 mL of DMEM medium without antibiotics were incubated at 37°C in 5% CO2 for 1 day. After incubation, the cells were washed 5 times with PBS buffer and 1 mL of PBS containing 0.1% (v / w) of triton X-100 was added to lyse the cells at 37°C for 5 min. The number of viable E. coli ATCC 25922 cells in the cell lysate was determined by plate counting method. The test was repeated 3 times.

[0088] As shown in Table 9, E. faecalis NSK220 can significantly reduce the adhesion ability of E. coli to MDCK cells. When the strain is present, the adhesion ability of E. coli cells is reduced by about 94%.

[0089] Table 9 Results of cell adhesion competition test

[0090] Example 5 Safety determination 1. Hemolysis test The activated culture of E. faecalis NSK220 after 24 h was streaked on blood agar plates and incubated at 37°C for 48 h. The presence of hemolytic signs on the blood agar plates was checked and the type of hemolysis was determined. Staphylococcus aureus ATCC 25923 was used as a positive control.

[0091] As shown in Table 9, E. faecalis NSK220 can significantly reduce the adhesion ability of E. coli to MDCK cells. When the strain is present, the adhesion ability of E. coli cells is reduced by about 94%. Figure 7 Figure 7 Figure 7

[0092] 2. Mouse test 2.1 Test procedure 80 healthy and similar weight Kunming mice were randomly divided into 4 groups, 20 mice in each group, half male and half female. The mice in the blank group were orally administered with 0.2 mL of sterile normal saline, and the mice in the other three groups were orally administered with 0.2 mL of E. faecalis NSK220 bacterial solution with concentrations of 1 x 10 9 CFU / mL (low dose group), 1 x 10 10 CFU / mL (medium dose group) and 1 x 10 11 CFU / mL (high dose group), respectively. The mice were fed for a total of 21 days, and the body weight and feed intake of the mice were measured every 3 days, and the health status of the mice was recorded. On the 21st day, the mice were fasted for 12 h and then anesthetized with 1% sodium pentobarbital (50 mg / kg). Blood was collected from the abdominal aorta, centrifuged at 2000 rpm and 4°C for 10 min, and the serum was collected to determine the liver and kidney function indicators of the mice. The heart, liver, spleen, kidney and thymus of the mice were dissected and weighed to calculate the organ index.

[0093] 2.2 Test results​​​ 2.2.1 Growth performance results As shown in Table 10, the average daily feed intake of mice in the low-dose group was significantly higher than that in the high-dose group and the blank group (P < 0.05), but there was no significant difference in the initial weight, final weight, average daily weight gain, and feed conversion ratio of mice among the groups (P > 0.05). P <0.05), the initial weight, final weight, average daily weight gain, and feed conversion ratio of mice among the groups were not significantly different (P > 0.05). P >0.05). It was shown that the addition of 2 x 10 8 CFU of Enterococcus faecalis NSK220 helped to improve the feed intake of animals.

[0094] Table 10 Results of the influence of mouse growth performance

[0095] Note: The same row of data without letters or the same letters indicate no significant difference (P > 0.05), and different lowercase letters indicate significant difference (P < 0.05). P >0.05), and different lowercase letters indicate significant difference (P < 0.05). P <0.05).

[0096] 2.2.2 Organ index results After the end of the experiment, no abnormal histopathological changes and bacterial translocation were observed in the internal organs. As shown in Table 11, there was no significant difference in the heart index, liver index, spleen index, kidney index, and thymus index of mice in each group after supplementation with different doses of Enterococcus faecalis NSK220 (P > 0.05). It was shown that the addition of Enterococcus faecalis NSK220 had no negative impact on the immune system function of mice, and Enterococcus faecalis NSK220 did not show toxic side effects for clinical application in mice. P >0.05). It was shown that the addition of Enterococcus faecalis NSK220 had no negative impact on the immune system function of mice, and Enterococcus faecalis NSK220 did not show toxic side effects for clinical application in mice.

[0097] Table 11 Results of the influence of mouse organ index

[0098] Note: The same row of data without letters or the same letters indicate no significant difference (P > 0.05), and different lowercase letters indicate significant difference (P < 0.05). P >0.05), and different lowercase letters indicate significant difference (P < 0.05). P <0.05).

[0099] 2.2.3 Serum biochemical index results Aspartate aminotransferase (AST) and alanine aminotransferase (ALT) are commonly used indicators for evaluating liver function. Urea nitrogen (BUN) is a commonly used indicator for evaluating kidney function. As shown in Table 12, in terms of liver function, there was no significant difference in the AST and ALT levels of mice in each group (P > 0.05). It was shown that the addition of Enterococcus faecalis NSK220 had no negative impact on the liver function of mice. In terms of kidney function, the BUN level of mice in the high-dose group was significantly lower than that in the blank group and the low-dose group (P < 0.05). P >0.05). It was shown that the addition of Enterococcus faecalis NSK220 had no negative impact on the immune system function of mice, and Enterococcus faecalis NSK220 did not show toxic side effects for clinical application in mice. P<0.05). It indicated that the addition of Enterococcus lactis NSK220 had no negative effect on the kidney function of mice.

[0100] Table 12 The effect of serum biochemical indicators of mice

[0101] Note: The same row of data without letters or the same letters represent no significant difference P >0.05), different lowercase letters represent significant difference P <0.05).

[0102] 3. Whole genome sequencing The raw data obtained by sequencing the strain using the Illumina high-throughput sequencing platform was optimized using FastQC and Trimmomatic. The reference genome was selected from the Enterococcus lactis reference strain deposited in NCBI Enterococcus lactis The whole genome sequence of CX2-6_2. The gene function annotation of the gene sequence was performed using COG, KEGG and GO databases. Circlize was used to draw the genome circle diagram.

[0103] Figure 8 The complete circular genome map of the strain is shown in Figure 1. The complete genome size is 2728079 bp, and the (G+C) content is 36.9%. The GO, KEGG and COG results of the genome of the strain are shown in Table 1. Figure 9-11The GO annotation results showed that the top three enriched biological processes were cellular process, metabolic process and localization; the top three enriched cellular components were membrane, protein-containing complex and organelle; and the top three enriched molecular functions were catalytic activity, binding and transporter activity. The top five KEGG pathways were membrane transport, carbohydrate metabolism, overview, amino acid metabolism and nucleotide metabolism. The COG annotation results showed that the strain was mainly enriched in carbohydrate transport and metabolism, and the main functional predictions were amino acid transport and metabolism, translation, ribosomal structure and biogenesis, and cell wall / membrane / envelope biogenesis. No drug-resistant genes were found in the strain, indicating that there was no risk of drug-resistant gene transfer from the strain to the host, further indicating that the strain was safe.

[0104] Example 6 Determination of kidney protection function 1. Cell test The canine kidney cells were cultured in cell culture bottles containing 4% (v / v) Inner Mongolia fetal bovine serum and 1% (v / v) penicillin-streptomycin-gentamicin mixed solution in DMEM culture medium. When the cells covered about 90% of the space, 800 μL of 0.25% trypsin digestion solution was added, and the cells were digested at 37°C for 5 min. The cells were blown and mixed with DMEM culture medium to prepare a cell suspension (concentration adjusted to 1 × 10 5cells / mL) were uniformly plated in 24-well cell culture plates, and after the cells grew into a dense monolayer, the culture solution was discarded, the cells were washed with sterile neutral PBS buffer (pH 7.0) for 3 times, 1 mL of DMEM culture solution was added to some of the wells to form a blank group, 1 mL of DMEM culture solution containing 0.1% (w / v) lipopolysaccharide was added to some of the wells to form a model group, and the cells were induced at 37°C and 5% CO2 for 1 day to obtain inflamed canine kidney cells. Then, the culture solution was discarded, the cells were washed with PBS buffer for 3 times, 500 μL of activated culture solution of Lactobacillus gasseri NSK220 (bacterial solution concentration was adjusted to 1 x 10 8 CFU / mL) and 500 μL of antibiotic-free DMEM culture solution were added to the wells to form a test group, 500 μL of activated culture solution of the control strain Lactobacillus gasseri CICC20421 and 500 μL of antibiotic-free DMEM culture solution were added to the wells to form a control strain group, 1 mL of antibiotic-free DMEM culture medium was added to the wells to form a negative control group, and the cells were cultured at 37°C and 5% CO2 for 1 day. The liquid in the wells of the blank group, the model group, the test group, the control strain group and the negative control group was collected, and the contents of tumor necrosis factor (TNF-α) and interleukin 10 (IL-10) were determined using a canine TNF-α detection kit and a canine IL-10 detection kit according to the instructions. The test was repeated 3 times.

[0105] As shown in Table 13 and Figure 12-13 It can be seen that the levels of the anti-inflammatory factor IL-10 and the pro-inflammatory factor TNF-α in the model group were significantly higher than those in the blank group P <0.05), which indicated that the canine kidney cell inflammation model was successfully established. The expression level of IL-10 in the test group was significantly higher than that in the control strain group and the negative control group P <0.05), and there was no significant difference in the expression level of TNF-α between the test group and the negative control group P >0.05), which indicated that the strain could effectively increase the expression level of the anti-inflammatory cytokine.

[0106] Table 13 Results of the strain protection of inflamed canine kidney cells

[0107] Note: The same row of data without letters or the same letters indicate no significant difference P >0.05), different lowercase letters indicate significant difference P <0.05).

[0108] 2. Animal experiment 2.1 Experimental method Eighty 8-week-old mice were randomly divided into four groups (n=20): a control group, a model group, an experimental group, and a control group. After one week of acclimatization, mice in the model group, experimental group, and control group were injected via the tail vein to induce nephritis. Then, the four groups underwent a 14-day gavage experiment: the control group and model group were administered 0.2 mL of physiological saline daily, while the experimental group was administered 2 × 10⁻⁶ gavage daily. 8 CFU (Cytobacter lactic acid enterococcus) NSK220, and the control group were administered 10 mg / kg body weight of prednisolone acetate daily by gavage.

[0109] Weigh and record food intake every 3 days; collect urine on day 13 to determine urinary protein content; fast mice for 12 hours on day 15, anesthetize them by intraperitoneal injection of 1% sodium pentobarbital solution at a dose of 50 mg / kg body weight, then collect blood, centrifuge at 2000 rpm and 4℃ for 10 min to collect serum, and measure mouse serum biochemical indicators; dissect and weigh the mouse thymus, and calculate the thymus index; flash freeze one kidney in liquid nitrogen to determine kidney antioxidant capacity; collect feces to detect bacterial abundance; fix the other kidney in 4% paraformaldehyde and perform HE staining.

[0110] 2.2 Experimental Results 2.2.1 Effects on mouse growth performance As shown in Table 14, the final weight and average daily weight gain of mice in the blank group were significantly higher than those in other groups. P <0.05), there were no significant differences in initial weight, average daily feed intake, and feed conversion ratio. P The value >0.05 indicates that the inflammation model was successfully established.

[0111] Table 14 Effects of bacterial strains on growth performance in nephritis model mice

[0112] Note: Data in the same row with no letter or the same letter above the header indicates that the difference is not significant. P >0.05), different lowercase letters indicate significant differences ( P <0.05).

[0113] 2.2.2 Serum immune markers As shown in Table 15, compared with the model group, the serum levels of tumor necrosis factor (TNF-α) and interleukin-10 (IL-10) in the experimental group mice were significantly increased. P <0.05, but there was no significant difference compared with the blank group and the control group ( P >0.05), compared with the blank group, the serum interleukin-6 (IL-6) levels in the other three groups of mice were significantly increased ( P <0.05, serum interferon-γ (IFN-γ) levels showed no significant difference among the groups ( P>0.05), indicating that the strain can effectively alleviate nephritis.

[0114] Table 15 Effect of the strain on immune indexes of serum of nephritis model mice

[0115] Note: The same row of data without letters or the same letters means no significant difference P >0.05), different lowercase letters mean significant difference P <0.05).

[0116] 2.2.3 Kidney function indexes As shown in Table 16, compared with the blank group, the serum creatinine (CRE) content of the model group mice was significantly increased P <0.05), the CRE of the test group and the control group mice was significantly reduced P <0.05). The urea nitrogen (BUN) level of the control group mice was significantly lower than that of the other groups P <0.05). There was no significant difference in urine protein (UP), urine protein creatinine ratio (UPRE) and albumin (Alb) among the groups P >0.05), indicating that the supplementation of Lactococcus lactis NSK220 can protect the kidney function by reducing the serum creatinine level.

[0117] Table 16 Effect of the strain on kidney function indexes of nephritis model mice

[0118] Note: The same row of data without letters or the same letters means no significant difference P >0.05), different lowercase letters mean significant difference P <0.05).

[0119] 2.2.4 Thymus index As shown in Table 17, the thymus index of the blank group and the test group mice was significantly higher than that of the model group and the control group P <0.05), indicating that the supplementation of the strain can significantly reverse the thymus index and improve the immune function of the body.

[0120] Table 17 Effect of the strain on organ indexes of nephritis model mice

[0121] Note: The same row of data without letters or the same letters means no significant difference P >0.05), different lowercase letters mean significant difference P <0.05).

[0122] 2.2.5 Kidney antioxidant indexes As shown in Table 18, compared with the model group, the kidney glutathione peroxidase (GSH-Px) activity of the test group and the control group was significantly increased (P<0.05) P <0.05), and there was no significant difference in the kidney glutathione peroxidase (GSH-Px) activity of the test group compared with the blank group (P>0.05). There was no significant difference in the activities of other kidney antioxidant indicators, catalase (CAT), malondialdehyde (MDA) and superoxide dismutase (SOD) among the groups (P>0.05). P >0.05). The above results show that the supplement of the strain can effectively increase the GSH-Px activity and promote the antioxidant capacity of the kidney.

[0123] Table 18 Effect of bacteria on kidney antioxidant indicators of nephritis model mice

[0124] Note: The same row of data without letters or the same letters represent no significant difference (P>0.05) P >0.05), different lowercase letters represent significant difference (P<0.05). P <0.05).

[0125] 2.2.6 Fecal flora 2.2.6.1 Species composition As shown in the bacterial flora distribution Veen Figure 14 , the blank group has 221 unique amplicon sequence variants (ASVs), the test group has 236 unique ASVs, the control group has 314 unique ASVs, and the model group has 304 unique ASVs; the four groups have 562 common ASVs. As shown in the cumulative box plot of species Figure 15 , the curve gradually tends to be flat, indicating that in this environment, the species will not significantly increase with the increase of sample size, and the sample size is sufficient for data analysis. As shown in the relative abundance analysis chart of species at the door level Figure 16 , the dominant bacterial phylum of each group is Bacteroidota (Bacteroidetes), Firmicutes (Firmicutes), Proteobacteria (Protists). As shown in the relative abundance analysis chart of species at the genus level Figure 17 , compared with the model group, the blank group, the test group and the control group have increased abundance of Lactobacillus in the beneficial bacteria genus (P<0.05 and P<0.01), and the relative abundance of Escherichia-Shigella in the harmful bacteria genus has decreased (P<0.05). Ligitactobaciius Lactobacilfus Escherichia-Shigelia

[0126] 2.2.6.2 LEfSe analysis Flora LEfSe analysis and phylogenetic evolution branch diagram as Figure 18 and Figure 19 ​​​As shown, using (Biomarkers, LDA≥3.0) as the standard, the biomarkers in the model group are the order Treponema (…). o_Oscillospirales ) and Rumenococci ( f_ Ruminococcaceae The biomarkers in the blank control group were daughter genera of Lactobacillus. g_Ligilactobacillus The biomarker for the experimental group was *Myxobacterium* ( ). g_Blautia ) and Enterococcus ( f_Enterococcaceae , g_ Enterococcus ).

[0127] 2.2.7 HE staining results Results of HE staining of mouse kidneys as follows Figure 20 As shown, in the control group mice, the glomeruli in the renal cortex were oval-shaped with clear capillaries (red reticular structure), no thickening of the basement membrane, and no proliferation of mesangial cells (blue staining). The renal pelvic cells were tightly and regularly arranged, consistent with the structure of normal kidney tissue. In the model group mice, some mesangial matrix proliferated in the glomeruli, and edema appeared in the proximal convoluted tubules. Figure 20 (Red arrow), mesangial cell proliferation and neutrophil infiltration ( Figure 20 Black arrow), neutrophil infiltration was observed in the renal pelvis ( Figure 20 Black arrow). Mesangial cell proliferation was observed in the glomeruli of mice in both the experimental and control groups. Figure 20 (red arrow), and the proximal convoluted tubule edema was relieved ( Figure 20 (Blue arrow) The inflammatory infiltration of neutrophils in the renal pelvis was relieved. Figure 20 (Blue arrow). In summary, supplementation with this strain can effectively reduce inflammatory cell infiltration, reduce glomerular mesangial proliferation and renal edema, and protect the kidneys of mice with nephritis.

[0128] Although the present invention has been described in detail with reference to the accompanying drawings and preferred embodiments, the present invention is not limited thereto. Various equivalent modifications or substitutions can be made to the embodiments of the present invention by those skilled in the art without departing from the spirit and essence of the invention, and such modifications or substitutions should all be within the scope of the present invention. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should also be covered within the protection scope of the present invention.

Claims

1. Use of Enterococcus lactis NSK220 for the manufacture of a product having a kidney protective function, characterized in that, Lactococcus lactis (ATCC 8014) Enterococcus lactis NSK220 has been deposited with China General Microbiological Culture Collection Center on January 6, 2025, at the address of No. 1, Beichen West Road, Yuan 3, Chaoyang District, Beijing, with the preservation number of CGMCC NO. 33306.

2. Use according to claim 1, wherein The kidney protection function includes enhancing the kidney protection function by improving nephritis; or / and, enhancing the kidney protection function by promoting the kidney antioxidant capacity; or / and, enhancing the kidney protection function by improving immunity.

3. Use according to claim 2, wherein the compound is ###0002### Improving nephritis includes increasing TNF-α level, increasing IL-10 level and / or reducing serum creatinine level.

4. The use according to claim 2, wherein the compound is ###0002### Improving nephritis includes reducing inflammatory cell infiltration, reducing glomerular mesangial proliferation and / or reducing kidney edema.

5. The use according to claim 2, wherein the compound is ###0002### Promoting the kidney antioxidant capacity includes increasing the glutathione peroxidase activity of the kidney.

6. The use according to claim 2, wherein Improving immunity includes increasing the thymus index.

7. The use according to claim 1, wherein In the preparation process of the product, Enterococcus lactis NSK220 bacterial liquid is added.

8. Use according to claim 7, wherein the compound is ###0002### Enterococcus lactis NSK220 is inoculated in MRS liquid culture medium, and activated culture is carried out, so as to obtain Enterococcus lactis NSK220 bacterial liquid; the culture temperature of Enterococcus lactis NSK220 is 36-40 DEG C, and the culture time is 12-24 h.

9. The use according to claim 1, wherein The viable cell count of Enterococcus lactis NSK220 in the product is ≥1 x 10 8 CFU / mL or ≥1 x 10 8 CFU / g.

10. The use according to claim 1, wherein The dosage form of the product is liquid agent, tablet, granule, capsule, powder or emulsion.

Images