Proteinophilic bacterium strain and application thereof

Abstract

The invention discloses a proteophilic bacterium strain and application thereof, and relates to the technical field of wine brewing microorganisms. The proteiniphilum sp. Strain K 5-3-1 is preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 05, 2023, and the preservation number of the proteiniphilum sp. Strain K 5-3-1 is CGMCC NO.27523. The proteiniphilum sp. Strain K 5-3-1 has the advantages that the preservation number is CGMCC NO.27523; the new strain provided by the invention is separated from pit mud of a strong-flavor liquor pit, is high in acetic acid yield and can be applied to the field of liquor brewing.

Description

Technical Field

[0001] This invention relates to the field of brewing microbial technology, specifically to a protein-loving bacterial strain and its applications. Background Technology

[0002] Strong-aroma baijiu is one of the most popular basic-aroma baijiu types in my country's consumer market, boasting a large consumer base. Beyond being a commodity, it also serves as an important carrier of traditional Chinese culture and humanistic sentiments. Its brewing process utilizes mud pits as fermentation containers. The inner walls of these pits are covered with a specific fermentation clay, also known as pit mud, which contains a rich variety of fermentation microorganisms with complex community structures. Therefore, the quality of the pit mud directly affects the quality and taste of strong-aroma baijiu. As a fermentation carrier, pit mud typically possesses excellent physicochemical properties and a rich microbial community structure, containing a large number of brewing functional microorganisms such as Clostridium, lactic acid bacteria, caproic acid bacteria, Bacillus, and yeast. It also contains various microbial decomposition products, metabolic products, and a variety of volatile flavor compounds, such as alcohols, esters, acids, and ketones, collectively contributing to the rich and mellow body of strong-aroma baijiu. The full exploration and utilization of the microbial resources in the pit mud is of great significance for understanding the flavor mechanisms of baijiu brewing and improving its quality.

[0003] Proteinophiles ( Proteiniphilum *Sp.* (a type of microorganism) are widely present in the cellar mud and mash of baijiu brewing pits, especially in the microbial community of old cellar mud where their abundance is relatively high. They are a dominant genus and important functional microorganisms in the brewing process of strong-aroma baijiu, with acetic acid as their main metabolic product. Some proteinophilic bacteria can also produce propionic acid and a small amount of isovaleric acid, which are important aroma compounds in strong-aroma baijiu. However, due to their obligate anaerobic nature and the not yet fully understood isolation and culture conditions, only a few strains can be isolated to obtain live pure cultures. Therefore, there is still vast potential for research, development, and utilization of this type of microbial resource in the brewing industry. Summary of the Invention

[0004] The purpose of this invention is to provide a new strain of protein-loving bacteria that can enhance the flavor of strong-aroma baijiu during the brewing process.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] This invention provides a new strain of proteinophilic bacteria, belonging to the genus *Proteophila* (…). Proteiniphilum The specimen (sp.) is deposited at the China General Microbiological Culture Collection Center (CGMCC), on June 5, 2023, with accession number CGMCC NO. 27523.

[0007] The 16S rDNA nucleotide sequence of the proteinophilic bacterium K5-3-1 is shown in SEQ ID NO:1.

[0008] The method for isolating and screening the proteophilic bacteria strain K 5-3-1 comprises the following steps: diluting the pit mud of Luzhou-flavor liquor cellar, coating the pit mud on a fastidious anaerobic agar culture medium under anaerobic conditions, and culturing at 37 DEG C for 48 hours; purifying the culture through three repeated four-zone streaking; and obtaining the pure culture, amplifying the 16S rDNA of the genomic DNA of the pure culture, and performing sequence comparison analysis on the sequence in EzBioCloud to obtain the proteophilic bacteria strain K 5-3-1.

[0009] The proteophilic bacteria strain K 5-3-1 can produce acetic acid, and the acetic acid production capacity reaches 2482.5 ppm.

[0010] The proteophilic bacteria strain K 5-3-1 is isolated from pit mud of a Luzhou-flavor liquor cellar, and the strain can produce acetic acid in large amounts, can improve and enhance the flavor quality of Luzhou-flavor liquor, and can be applied to the field of liquor brewing, thereby providing a new strain resource for the production of Luzhou-flavor liquor. BRIEF DESCRIPTION OF DRAWINGS

[0011] Figure 1 The scanning electron microscope image of the proteophilic bacteria strain K 5-3-1 is shown

[0012] Figure 2 The 16S rDNA phylogenetic evolution tree of the proteophilic bacteria strain K 5-3-1 is shown

[0013] Figure 3 The polar lipid analysis result diagram of the proteophilic bacteria strain K 5-3-1 is shown

[0014] Figure 4 The main organic acid chromatogram of the fermentation liquor of the proteophilic bacteria strain K 5-3-1 is shown DETAILED DESCRIPTION

[0015] The embodiments of the present application are described below by specific examples, and the examples are given only for illustrating the present application, and are not intended to limit the scope of the present application.

[0016] If not specially specified, the chemical reagents used in the following examples can be obtained from commercial channels, and the technical means adopted in the examples are the conventional means used by those skilled in the art.

[0017] The components of the fastidious anaerobic bacteria agar medium used in the examples are: mixed protein peptone 23.0 g, NaCl 5.0 g, soluble starch 1.0 g, glucose 1.0 g, C3H3NaO3 1.0 g, L-arginine 1.0 g, sodium succinate 0.5 g, cysteine hydrochloride 0.5 g, NaHCO3 0.4 g, soluble pyrophosphoric acid 0.25 g, hematin chloride 0.01 g, vitamin K 0.001 g, agar 15.0 g, distilled water 1000 mL; the components of the fastidious anaerobic bacteria broth medium are: mixed protein peptone 15.0 g, yeast extract powder 10.0 g, NaCl 2.5 g, sodium thioethanolate 0.5 g, cysteine hydrochloride 0.5 g, NaHCO3 0.4 g, hematin chloride 0.005 g, resazurin 0.001 g, vitamin K 0.0005 g, agar 0.75 g, distilled water 1000 mL.

[0018] Example 1, Isolation and physiological and biochemical characteristics of the proteinophilic bacteria strain K 5-3-1

[0019] I. Isolation of the new strain K 5-3-1

[0020] All reagents used in the tests were deoxygenated in an anaerobic workstation overnight, and 25 g of the sample of the pit mud of the Luzhou-flavor Chinese liquor cellar was weighed out under anaerobic conditions, added to 225 mL of sterile normal saline, and thoroughly shaken to mix to prepare a 1:10 sample dilution, 1 mL of the sample dilution was taken and added to 9 mL of sterile normal saline to prepare a 1:100 sample dilution, and the above operation was repeated to gradient dilute the sample, and 1:100 ~ 1:10000 dilutions were taken and spread on fastidious anaerobic bacteria agar medium, and cultured anaerobically at 37°C for 48 h, and single colonies on the plates were picked and purified by four-zone streaking, and after three repeated four-zone streaking and culturing, pure culture bacteria were obtained, and named K 5-3-1.

[0021] II. Physiological and biochemical characteristics of the new strain K 5-3-1

[0022] 1. Morphological characteristics of the strain

[0023] The proteinophilic bacteria strain K 5-3-1 obtained by isolation was cultured anaerobically at 37°C for 48 h on fastidious anaerobic bacteria agar medium, and the colonies were light yellow, round, wet, opaque, and had neat edges. Scanning electron microscopy observation showed that the bacterial cells were rod-shaped and arranged singly or in pairs.

[0024] 2. Physiological and biochemical characteristics of the strain

[0025] Physiological and biochemical characteristics of the bacterial strain were analyzed using the API 20A and API ZYM identification systems. The isolated proteinophilic strain K 5-3-1 was found to be able to utilize glucose, mannitol, lactose, sucrose, maltose, salicylate, xylose, aesculin, glycerol, cellobiose, mannose, mesotriose, raffinose, rhamnose, and trehalose. It was positive for acid phosphatase, alkaline phosphatase, esterase (C4), lipoesterase (C8), trypsin, naphthol-AS-BI-phosphohydrolase, α-galactosidase, β-galactosidase, α-glucosidase, and β-glucosidase, weakly positive for N-acetyl-glucosaminease, and negative for oxidase and catalase.

[0026] The isolated proteinophilic bacterial strain K 5-3-1 can grow at 20–40℃ and pH 6.0–9.0, with the optimal growth temperature being 30℃ and the optimal growth pH being pH 7.0. It can tolerate up to 1% NaCl.

[0027] Example 2: Molecular biological characteristics of proteinophilic bacterial strain K5-3-1

[0028] I. Identification of 16S rDNA of the new strain K5-3-1

[0029] The K5-3-1 strain was inoculated onto fastidious anaerobic agar medium and cultured anaerobicly at 37°C for 48 h. A loopful of colony was picked and genomic DNA was extracted using a bacterial genome extraction kit.

[0030] The 16S rDNA of the P1-1 genomic strain was amplified using primers 27F and 1492R. The results were: 27F: AGAGTTTGATCCTGGCTCAG, 1492R: GGTTACCTTGTTACGACTT.

[0031] component volume 2x PCR master mix 25 μL primer F (10 μmol / L) 1 μL primer R (10 μmol / L) 1 μL strain genomic DNA 2 μL sterile double-distilled water 21 μL

[0032] PCR reaction procedure: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 1 min, 55℃ annealing for 1 min, 72℃ extension for 1.5 min, for a total of 30 cycles; 72℃ extension for 10 min; terminate the reaction at 4℃ and store for later use.

[0033] After PCR product gel electrophoresis detection, the samples were sent to Shanghai Sangon Biotech Co., Ltd. for 16S rDNA sequencing. The 16S rDNA sequence of strain K5-3-1 is shown in SEQ ID NO:1.

[0034] The 16S rDNA gene sequence obtained from sequencing strain K5-3-1 was compared with the sequences of strains with valid names in the EzBioCloud database. The neighbor-joining method in MEGA software was used to identify strains of *Forsythia stolonifera* (…).Tannerella forsythia ) ATCC 43037 T A phylogenetic tree of the species K 5-3-1 was constructed as shown in Fig. 1. Figure 2

[0035] II. Whole genome ANI analysis of the new species K 5-3-1

[0036] The whole genome ANI analysis of the species K 5-3-1 and the top ten validly published type strains with the highest 16S rDNA gene sequence similarity was performed. The FASTA format genome sequences of the ten type strains were downloaded from the NCBI database as reference sequences, and the data pollution was checked by ContEst16S software (https: / / www.ezbiocloud.net / tools / contest16s). The ANI values between the genome sequence of the species K 5-3-1 and the genome sequences of the type strains were calculated by ANI Calculator software of EzBioCloud database. The results showed that the ANI value between the species K 5-3-1 and the type strain of Saccharococcus proteophilus (ATCC 43037) was the highest, which was 79.09%, < 95%. Proteiniphilum saccharofermentans ) DSM 28694 T

[0037] III. Whole genome dDDH analysis of the new species K 5-3-1

[0038] The whole genome dDDH analysis of the species K 5-3-1 and the top ten validly published type strains with the highest 16S rDNA gene sequence similarity was performed. The data pollution was checked by ContEst16S software (https: / / www.ezbiocloud.net / tools / contest16s), and the dDDH was calculated by GGDC (Genome-to-Genome Distance Calculator 2.1, https: / / ggdc.dsmz.de / ggdc.php#) software. The results showed that the dDDH value between the species K 5-3-1 and the type strain of Saccharococcus acetisporus (DSM 18083) was the highest, which was 23.80%, < 70%. Proteiniphilum acetatigenes ) DSM 28694 T

[0039] IV. Analysis of drug resistance genes and virulence genes of the new species K 5-3-1

[0040] 1. Analysis of drug resistance genes of the species

[0041] ​​​The genome sequence of strain K 5-3-1 was aligned with the ResFinder nucleic acid database (https: / / cge.cbs.dtu.dk / services / ResFinder / ) with the parameters set to ID = 90%, Minimum length = 60% for screening, and the genes associated with non-antibiotic resistance were removed to analyze the drug resistance genes of strain K 5-3-1. The results showed that strain K 5-3-1 did not contain drug resistance genes.

[0042] 2. Analysis of virulence genes of the strain

[0043] The virulence genes of strain K 5-3-1 were analyzed by aligning the genome sequence with the VirulenceFinder nucleic acid database (https: / / cge.cbs.dtu.dk / services / VirulenceFinder / ). The alignment parameters were set to ID = 90%, Minimum length = 60%, and the genes not associated with virulence were removed. The results showed that strain K 5-3-1 did not contain virulence genes.

[0044] Through comprehensive analysis of the colony morphology, physiological and biochemical characteristics, 16S rDNA gene sequence, whole genome ANI analysis, and dDDH analysis of strain K 5-3-1, it was identified as a new strain of Proteus sp. Strain K 5-3-1 did not contain drug resistance genes and virulence genes. Proteiniphilum sp. ) new strain, and strain K 5-3-1 did not contain drug resistance genes and virulence genes.

[0045] Example 3, Analysis of the chemical components of the cell of the Proteus sp. strain K 5-3-1

[0046] I. Analysis of the fatty acid components of the new strain K 5-3-1

[0047] Fresh plate cultures of strain K 5-3-1 were collected, and after fatty acid cleavage, saponification, methylation, and extraction, the main fatty acid types and contents of strain K 5-3-1 were determined by gas chromatography (GC) combined with the MIDI Sherlock automatic identification system. The results showed that the main fatty acid components of strain K 5-3-1 were C 15:0 ANTEISO FAME, with a content of 39.12%.

[0048] II. Analysis of the polar lipid components of the new strain K 5-3-1

[0049] Fresh culture of strain K 5-3-1 was collected and freeze-dried into bacterial powder. Methanol, chloroform, and glass beads were added to the bacterial powder, and after crushing, the lower organic phase was vacuum concentrated. The concentrated liquid was two-dimensionally developed on a TLC plate, dried, and developed for color. The cell polar lipid composition of strain K 5-3-1 was analyzed by referring to the main polar lipid standard atlas. For example,Figure 3 As shown in the figure, the main polar lipids of strain K 5-3-1 cells are UAPL (Unidentified aminophospholipid), UL (Unidentified lipid) and NPG (Phospholipids of unknown structure containing glucosamine).

[0050] Three, cell wall sugar and DAP component analysis of new strain K 5-3-1

[0051] The fresh culture precipitate of strain K 5-3-1 was freeze-dried into bacteria powder, and the cell wall components were detected by thin layer chromatography (TLC) and high performance liquid chromatography (HPLC) after hydrolysis with hydrochloric acid. The results show that the cell wall characteristic DAP component of strain K 5-3-1 is meso DAP, and the cell wall characteristic sugar component is glucose.

[0052] Example 4, determination of main organic acids in proteophilic bacteria strain K 5-3-1 fermentation broth

[0053] Strain K 5-3-1 was inoculated into a fastidious anaerobic broth medium at an inoculation amount of 2%, and cultured anaerobically at 37℃ for 10 days. The fermentation broth was diluted 10 times with ultrapure water, uniformly oscillated, filtered through a 0.22 μm filter membrane to remove bacteria as a sample to be tested, and the content of main organic acids in the fermentation broth was determined by HPLC. The chromatographic program is as follows: chromatographic column: Rezex ROA-Organic Acid H+ (8%) (300×7.8 mm); column temperature: 80℃; mobile phase: H2SO4 5 mmol / L; flow rate: 0.6 mL / min; sample size: 10 μL; detector: PDA (210 nm). The main organic acid in the fermentation broth of proteophilic bacteria strain K 5-3-1 is acetic acid, and the content is 2482.5 ppm.

[0054] The proteophilic bacteria strain screened in the present application has high acetic acid yield, which helps to improve the flavor quality of strong-flavor liquor and has a broad application prospect.

Claims

1. Proteinophiles ( Proteiniphilum The bacterial strain K5-3-1 (sp.) is characterized by: The bacterial strain is preserved in China General Microbiological Culture Collection Center with the preservation number of CGMCC NO. 27523.

2. The proteophagic bacterial strain K 5-3-1 according to claim 1, characterized in that: The 16S rDNA nucleotide sequence of the bacterial strain is shown as SEQ ID NO:

1.

3. The protein-philic bacterial strain K 5-3-1 according to claim 1, characterized in that: The bacterial strain can produce acetic acid.

Images