Bacillus safensis with high lipase activity and application thereof in biodegradation of mulching film and crop growth promotion

By screening and identifying the Bacillus sabinatus STX-S1 strain with high lipase activity, the problems of slow degradation rate and single function of biodegradable mulch film were solved, achieving efficient degradation of PBAT or PLA mulch film and promoting crop growth.

CN121362706BActive Publication Date: 2026-04-14STASY (SHAOXING) NEW MATERIAL CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-18
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing biodegradable mulch films such as PBAT and PLA degrade slowly under field conditions, and the lipase activity of existing Bacillus subtilis is insufficient, resulting in serious residual film pollution, limited functionality, and difficulty in promoting crop growth.

Method used

The Bacillus safensis STX-S1 strain with high lipase activity was screened and identified. It was obtained through gradient dilution and purification culture. It can stably secrete lipase under neutral to weakly acidic and weakly alkaline conditions, efficiently degrade PBAT or PLA mulch film, and promote crop growth.

Benefits of technology

Bacillus salsa STX-S1 significantly improves the degradation rate of plastic film (film quality loss rate exceeds 40% within 30 days), reduces residual film pollution, and promotes crop growth, showing broad prospects for agricultural application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121362706B_ABST
    Figure CN121362706B_ABST
Patent Text Reader

Abstract

The application discloses a bacillus safensis with high lipase activity and application thereof in biodegradation of mulching film and growth promotion of crops, and belongs to the technical field of agricultural microorganisms and biodegradable materials. The strain is bacillus safensis STX-S1, which is preserved in the China Center for Type Culture Collection on September 15, 2025, and the preservation number is CCTCC NO: M 20252036. The strain can stably secrete lipase under neutral to weak acidic and weak alkaline conditions, and can efficiently degrade PBAT or PLA film biodegradable mulching film, and promote growth of crops.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of agricultural microorganisms and biodegradable materials technology, and more specifically, to a Bacillus sabolicus species with high lipase activity and its application in the degradation of biodegradable mulch films and the promotion of crop growth. Background Technology

[0002] With the widespread use of plastic mulch films in agriculture, residual film pollution has become increasingly serious. Traditional polyethylene (PE) mulch films are difficult to degrade naturally, leading to the deterioration of soil physical and chemical properties and a decline in arable land quality. In recent years, although biodegradable mulch films such as PBAT and PLA have been gradually promoted, their practical application in the field has revealed problems such as slow degradation rate and susceptibility to environmental factors, limiting their large-scale promotion and application.

[0003] Studies have shown that lipases and esterases play a crucial role in the ester bond cleavage of biodegradable plastics. Therefore, screening functional microorganisms with high lipase activity that can effectively decompose PBAT / PLA is key to promoting the complete degradation of biodegradable mulch films.

[0004] On the other hand, Bacillus spp. strains not only produce a variety of degrading enzymes, but also have functions such as secreting plant hormones, improving rhizosphere microecology, and promoting crop growth. However, existing reports on Bacillus strains are mostly concentrated on Bacillus subtilis and Bacillus amyloliquefaciens, while systematic research on the lipase activity and membrane degradation applications of Bacillus safensis is still lacking. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a Bacillus sabolicii strain with high lipase activity and its application in the degradation of biodegradable mulch film and the promotion of crop growth. This strain can efficiently degrade PBAT or PLA biodegradable mulch film and promote the growth of crops (such as rice), solving the problems of slow degradation rate of existing mulch film and single function of strain.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A strain of Bacillus safensis with high lipase activity, namely Bacillus safensis STX-S1, was deposited at the China Center for Type Culture Collection on September 15, 2025, with accession number CCTCCNO: M 20252036.

[0008] The present invention is further configured such that the 16S rDNA sequence of the strain is shown in SEQ ID NO.1.

[0009] The present invention is further configured such that the strain is obtained by screening using the following method: collected soil samples are added to sterile water and serially diluted to obtain 10... -1 ~10 -5 Diluent for dilution; take a dilution of 10. -3 10 -4 10 -5 The diluted solution was spread onto LB solid medium containing 10 g / L olive oil and 1 g / L Triton X-100 and cultured. Colonies were picked for isolation and purification, and the obtained single colonies were cultured on LB liquid medium to obtain the final product.

[0010] The present invention is further configured such that when culturing in LB solid medium containing 10 g / L olive oil and 1 g / L Triton X-100, the culture temperature is 25~30℃ and the culture time is 24~72h.

[0011] The present invention is further configured such that, when cultured in LB liquid medium, the culture temperature is 25~28℃ and the culture time is 12~48h.

[0012] Application of a type of Bacillus safranin with high lipase activity in the degradation of biodegradable mulch film and the promotion of crop growth.

[0013] In summary, the present invention has the following beneficial effects:

[0014] The resulting strain can be produced on a large scale through liquid fermentation, which is low-cost and easy to promote. It has strong environmental adaptability and can stably secrete lipase under neutral to weakly acidic and weakly alkaline conditions. It can also efficiently degrade PBAT or PLA films (with a film quality loss rate of over 40% within 30 days, significantly better than ordinary Bacillus (approximately 15–25%)), significantly reducing agricultural film pollution, promoting crop growth, and is non-toxic and non-pathogenic. It can be directly used in agricultural ecosystems and has broad application prospects. Attached Figure Description

[0015] Figure 1 This is a colony morphology diagram of Bacillus sabovella STX-S1.

[0016] Figure 2 A stained microscopic image of Bacillus sabovella STX-S1;

[0017] Figure 3 Phylogenetic tree diagram of Bacillus sabovella STX-S1;

[0018] Figure 4A comparison chart of rice growth to demonstrate the seedling-promoting effect of Bacillus salsa STX-S1. Detailed Implementation

[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] Example 1: Strain Screening and Identification

[0021] 10g of soil sample collected from the mountainous area of ​​Fusheng Wufengling, Yuecheng District, Shaoxing City, Zhejiang Province was added to 100mL of sterile water, shaken thoroughly at 28℃ and 200rpm, and then serially diluted to obtain 10g of the sample. -1 ~10 -5 Diluent for dilution; take a dilution of 10. -3 10 -4 10 -5 100 µl of each dilution solution was spread onto LB solid medium containing 10 g / L olive oil and 1 g / L Triton X-100, and incubated upside down at 28 °C for 48 h (the incubation temperature can be adjusted between 25-30 °C and the incubation time between 24-72 h as needed). The growth of the strain and the formation of the clear zone were observed. Colonies with a clear zone diameter ≥10 mm were picked and isolated and purified by streak plating to obtain single colonies. The single colonies were inoculated into LB liquid medium and incubated at 28 °C and 200 r / min on a shaker for 24 h (the incubation temperature can be adjusted between 25-28 °C, the incubation time between 12-48 h, and the shaker speed between 150-200 r / min as needed). Then the bacterial culture was transferred to 25% glycerol and stored at -80 °C.

[0022] The colonies were Gram-positive under microscopic staining; the strain cells were rod-shaped and contained spores; the colony morphology of *Bacillus sabovellatus* STX-S1 is shown in the figure. Figure 1 See staining microscopic images Figure 2 The 16S rDNA sequence of the screened strain was sequenced by the Hangzhou branch of Beijing Qingke Biotechnology Co., Ltd. The 16S rDNA sequence is as follows:

[0023]

[0024] ATGATTGGGGGTGAAGTCGTACAGG (SEQ ID NO. 1).

[0025] The sequencing results were submitted to the NCBI database for BLAST analysis. The phylogenetic tree of *Bacillus salsafoetida* STX-S1 is shown below. Figure 3 The strain was identified as belonging to Bacillus safensis and named Bacillus safensis STX-S1. This Bacillus safensis STX-S1 was deposited at the China Center for Type Culture Collection on September 15, 2025, with accession number CCTCC NO: M 20252036, and deposit address: Wuhan University, Wuhan, China.

[0026] Bacillus safensis STX-S1 strain was inoculated into 100 mL LB liquid medium (pH adjusted with NaOH) at pH 7 and cultured in a shaker at 28°C and 200 rpm for 24 h to activate the strain. Then, 1% of the activated strain was inoculated into 50 mL LB medium (pH 7) containing 10 g / L olive oil and 1 g / L Triton X-100, and cultured in shakers at 15°C, 20°C, 28°C, 37°C, 45°C, and 50°C at 200 rpm. The OD of the bacterial culture was measured every 2 h. 600 Three replicate experiments were conducted. The results showed that *Bacillus salsafras* STX-S1 exhibited a significant growth lag at 15℃; growth was good at 20℃, 28℃, 37℃, and 45℃ with no significant growth lag; however, 50℃ had a significant impact on the growth of *Bacillus salsafras* STX-S1, with a lower OD value. 600 Almost no growth.

[0027] Bacillus safensis STX-S1 strain was inoculated into 100 mL LB liquid medium at pH 7 and cultured at 28°C and 200 rpm for 24 h to activate the strain. Then, 1% of the activated solution was inoculated into 50 mL LB solid medium containing 10 g / L olive oil and 1 g / L Triton X-100 (adjusted to the desired pH with NaOH) at pH 4, 5, 6, 7, 8, 9, 10, and 11, respectively, and cultured at 28°C and 200 rpm for 48 h. The OD of the bacterial culture was measured every 2 h. 600Three replicate experiments were set up. The results showed that when the pH was between 6 and 9, the strains could grow normally and maintain a high growth rate; while when the pH was less than 6 or greater than 9, the growth of the strains was significantly inhibited.

[0028] Bacillus sabolicus STX-S1 strain was inoculated into 100 mL LB liquid medium at pH 7 and cultured in a shaker at 28℃ and 200 rpm for 24 h to activate the strain, obtaining an activated solution. The activated solution was then inoculated into enzyme-producing medium (prepared from 20 g soybean meal, 20 g corn steep liquor, 10 g soluble starch, 5 g K₂HPO₄, and 5 g NaNO₃, pH 7.5) at a 1% inoculation rate and cultured in shake flasks at 28℃ and 200 rpm for 72 h. The fermentation broth was centrifuged at 4℃ and 8000 rpm for 10 min, and the supernatant was collected as the crude enzyme solution for analysis. Lipase activity in the crude enzyme solution was detected using a kit. The results showed that the lipase activity in the crude enzyme solution of Bacillus sabolicus STX-S1 was 127 U / mL.

[0029] Example 2: Application of Bacillus safensis STX-S1 in degrading mulch film

[0030] Bacillus sabovella STX-S1 strain was inoculated into 100 mL of LB liquid medium at pH 7 and cultured in a shaker at 28°C and 200 rpm for 24 h to activate the strain and obtain the activation solution. Three pieces of aseptically treated PBAT mulch film, cut to 5×5 mm, were added to LB solid medium at pH 7 containing 10 g / L olive oil and 1 g / L Triton X-100, and then... 8 The strain was inoculated at a concentration of CFU / mL and added to the activation solution. The culture was then carried out in a constant temperature shaker at 28°C and 2000 rpm for 30 days.

[0031] After 30 days, the mulch film was removed, and excess culture medium was rinsed off with sterile water. The degraded PBAT film was then washed in a 2% (w / v) sodium dodecyl sulfate (SDS) solution with shaking (180 r / min) for 4 hours, followed by repeated washing with sterile water. After drying in a 60℃ oven, the mass of the degraded PBAT mulch film was measured and calculated using the following formula: Mulch film weight loss rate (%) = (Weight of mulch film before degradation - Weight of mulch film after degradation) / Weight of mulch film before degradation × 100%. The calculated weight loss rate was 41.5%.

[0032] Example 3: Application of Bacillus safensis STX-S1 in promoting rice seedling growth

[0033] (1) Bacillus sabovella STX-S1 was inoculated into LB liquid medium at pH=7 and cultured in a shaker at 28℃ and 200rpm to obtain a viable count of 3×10⁻⁶. 7 CFU / g of Bacillus sarfusae STX-S1 bacterial suspension.

[0034] (2) Disinfect the Zhejing 27 rice seeds by soaking them in 1wt% sodium hypochlorite solution for 10 minutes. Then, the rice seeds were divided into two groups. One group of rice seeds was soaked in the Bacillus sabensis STX-S1 bacterial solution from step (1) for 4 hours as the treatment group. The other group of rice seeds was soaked in sterile water for 4 hours as the blank control group. After that, both groups of rice seeds were cleaned with sterile water. The cleaned seeds were placed in a glass dish containing moist absorbent paper and germinated in the dark at 37℃ for 2 days.

[0035] (3) Mix peat and vermiculite at a volume ratio of 2:1 to form a substrate, and fill 6 rice pots with 600 mL of substrate per pot. Sow rice seeds from the treatment group and the blank control group with consistent germination into rice pots, 3 pots per group, with 10 seeds per pot. Cultivate for 25 days with 16 hours of light and 8 hours of darkness per day. During the light cultivation period, the treatment group is treated with Bacillus sabensis STX-S1 bacterial solution from step (1) every 5 days, with 60 mL added per pot per round. The blank control group is treated with sterile water every 5 days, with 60 mL added per pot per round.

[0036] (4) The rice plants that had been cultured for 25 days were pulled out of the substrate by the roots, rinsed thoroughly with clean water, and the moisture on the rice plants was absorbed using absorbent paper. The root length, fresh root weight, and seedling height of the rice in the treatment group and the blank control group were measured respectively. The comparison of the growth of rice in the treatment group and the blank control group is shown in the figure. Figure 4 The results showed that the average root length of the rice in the treatment group was 14.3 cm (22.31% higher than that in the blank control group), the average fresh root weight was 0.15 g (21.6% higher than that in the blank control group), and the average seedling height was 28.2 cm (23.24% higher than that in the blank control group). After 25 days of cultivation, the seedling vigor index of the rice in the treatment group was also 22.4% higher than that in the blank control group.

[0037] In this embodiment of the invention, the LB liquid culture medium was prepared by dissolving LB culture medium (powder, purchased from Hangzhou Best Biotechnology Co., Ltd.) in distilled water at a ratio of 25g:1000mL. The LB solid culture medium containing 10g / L olive oil and 1g / L Triton X-100 was prepared by adding agar, olive oil, and Triton X-100 to this LB liquid culture medium, with the amount of agar added to the LB solid culture medium being 2wt%. All the above culture media were sterilized at 121℃ for 20min after preparation.

[0038] The lipase activity test kit used in this embodiment of the invention was purchased from Beijing Solarbio Technology Co., Ltd., model number BC2340; the PBAT mulch film was produced by Stachi (Shaoxing) New Materials Co., Ltd., brand number SDM-07.

[0039] The above description is merely a preferred embodiment of the present invention. The scope of protection of the present invention is not limited to the above embodiments. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention. It should be noted that for those skilled in the art, any improvements and modifications made without departing from the principles of the present invention should also be considered within the scope of protection of the present invention.

Claims

1. The application of *Bacillus sabolicii* with high lipase activity in the degradation of biodegradable mulch film and the promotion of crop growth, characterized in that... The strain is Bacillus safensis STX-S1, which was deposited at the China Center for Type Culture Collection on September 15, 2025, with accession number CCTCC NO: M 20252036; the biodegradable mulch film is PBAT mulch film.

2. The application of *Bacillus sabinatus* with high lipase activity according to claim 1 in the degradation of biodegradable mulch film and the promotion of crop growth, characterized in that... The 16S rDNA sequence of this strain is shown in SEQ ID NO.1.

Citation Information

Patent Citations

  • Bacillus safensis and application thereof

    CN111154669A

  • Microbial bacterium V66 and application thereof in plant growth promotion and flowering promotion

    CN118064295A

  • KR20250118887A