Omega RNA for detecting brucella, fluorescence detection kit, visual kit and application thereof

The OMEGA system, which uses ωRNA to bind to TnpB protein, enables rapid and accurate detection of Brucella, solving the problem that traditional methods cannot directly confirm the presence of pathogens and providing a low-cost and simple detection solution.

CN121362759AActive Publication Date: 2026-01-20INNER MONGOLIA UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511912659.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-18
Publication Date
2026-01-20
Estimated Expiration
2045-12-18

AI Technical Summary

Technical Problem

Traditional methods for brucellosis diagnosis cannot directly confirm the presence of the pathogen, and PCR testing requires expensive equipment and professional personnel, making rapid on-site testing difficult.

Method used

The OMEGA system, which combines ωRNA with TnpB protein, was used to achieve specific recognition and detection of the Brucella bp26 gene through isothermal amplification and paracleavage activity. Results were observed using fluorescence detection or nucleic acid test strips.

Benefits of technology

This invention provides a low-cost, simple-to-operate detection method with high sensitivity and specificity, enabling rapid and accurate detection of Brucella in non-laboratory environments, and is suitable for detection in food and animal environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121362759A_ABST
    Figure CN121362759A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene detection, in particular to an omega RNA (Ribonucleic Acid) for detecting brucella, a fluorescence detection kit, a visual kit and application thereof. The omega RNA nucleotide sequence provided by the invention is as shown in SEQ ID NO: 4. According to the present invention, the provided omega RNA can specifically recognize the Brucella bp26 gene, the amplification product of the Brucella bp26 gene combined with the TnpB protein has high side cutting activity, the TnpB cuts the non-specific ssDNA report probe after the omega RNA recognizes the target sequence, the Brucella can be detected through the fluorescence detection or the nucleic acid detection test strip, and the high accuracy and the high sensitivity are provided; the Brucella can be detected at any time on a non-laboratory site through an OMEGA-TnpB detection system, and the method has the advantages of being wide in universality, low in operation requirement, efficient and accurate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and in particular to a ωRNA detection kit, a fluorescence detection kit, a visualization kit, and their applications for detecting Brucella. Background Technology

[0002] Brucellosis is a disease caused by Brucella bacteria (Brucella) Brucella Brucellosis, a zoonotic infectious disease caused by pathogens, poses a significant threat to human and animal health. Traditional diagnostic methods for brucellosis primarily rely on serological testing, but these methods have limitations. They typically detect antibodies produced by infection but cannot directly confirm the presence of the pathogen. Polymerase chain reaction (PCR) offers a more sensitive diagnostic option, but its dependence on expensive equipment, skilled personnel, and time-consuming procedures makes it unsuitable for rapid, on-site testing. The advent of CRISPR-Cas systems has revolutionized molecular diagnostics. Notably, the Cas12 and Cas13 systems, with their paracleavage activity, show great promise in pathogen detection. These systems have been successfully applied to detect a variety of infectious pathogens, including those causing blood diseases in animals.

[0003] The OMEGA system is the ancestor of the CRISPR-Cas system, composed of a class of transposon-encoded RNA-guided nucleases, including key proteins such as IscB, IsrB, and TnpB. Among them, the prokaryotically derived TnpB has nuclease properties similar to the Cas12 protein, but its size is only half that of the Cas12a protein (approximately 400 amino acids). Its guide RNA is called ωRNA.

[0004] The IS200 / IS605 transposon family is widely distributed in prokaryotes and eukaryotes. Recent reports confirm that TnpB, encoded by the IS200 / IS605 transposon family, is the evolutionary ancestor of Cas12 in the type V CRISPR-Cas system. The RNA transcript at the right end of the TnpB transposon generates ωRNA. The RNP complex formed by TnpB and ωRNA recognizes the transposon-associated motif (TAM) and leads to cleavage of the target sequence, which is complementary to the guide sequence at the 3' end of the ωRNA. Studies have confirmed that TnpB possesses paracleavage activity, but there is currently no information on its application in Brucella detection. Summary of the Invention

[0005] In order to solve the above problems, the application provides a kind of ωRNA for detecting brucella, fluorescent detection kit, visual kit and its application.The ωRNA provided in the application has higher target specificity to brucella bp26 gene in combination with TnpB protein and produces a side-cutting activity, and brucella can be detected by fluorescence detection or nucleic acid detection test strip, with higher accuracy and sensitivity.

[0006] In order to achieve the above purpose, the application provides the following technical solutions: The application provides a kind of ωRNA for detecting brucella, and the nucleotide sequence is shown as SEQ ID NO:4.

[0007] The application provides a kind of fluorescent detection kit for detecting brucella, which comprises the ωRNA, the constant temperature amplification primer, the TnpB protein and the ssDNA report probe 1 described in the above technical solution; the constant temperature amplification primer is a constant temperature amplification primer for amplifying brucella bp26 gene; the ssDNA report probe 1 is a nucleic acid molecule modified with a fluorescent group and a quenching group.

[0008] Preferably, the nucleotide sequence of the ssDNA report probe 1 is 5'-TTTTATTTT-3'; the fluorescent group comprises FAM; and the quenching group comprises BHQ1.

[0009] Preferably, the nucleotide sequence of the constant temperature amplification primer is shown as SEQ ID NO:1 and SEQ ID NO:2; and the TnpB protein comprises ISDra2 TnpB protein from Deinococcus radiodurans.

[0010] The application provides a kind of visual kit for detecting brucella, which comprises the ωRNA, the constant temperature amplification primer, the TnpB protein, the ssDNA report probe 2 and the nucleic acid detection test strip described in the above technical solution; the constant temperature amplification primer is a constant temperature amplification primer for amplifying brucella bp26 gene; and the ssDNA report probe 2 is a nucleic acid molecule modified with a fluorescent group and biotin.

[0011] Preferably, the nucleotide sequence of the ssDNA report probe 2 is 5'-TTTTATTTT-3'; and the fluorescent group comprises FAM.

[0012] Preferably, the nucleotide sequence of the constant temperature amplification primer is shown as SEQ ID NO:1 and SEQ ID NO:2; and the TnpB protein comprises ISDra2 TnpB protein from Deinococcus radiodurans.

[0013] The application provides application of the omega RNA in (1) and / or (2) described in the technical scheme or the fluorescence detection kit or the visualization kit described in the technical scheme. (1) non-diagnostic and non-therapeutic detection of Brucella and / or DNA thereof; (2) screening or assisting in screening of drugs for preventing and treating Brucella infection.

[0014] Preferably, the (1) comprises detecting food and / or animal living environment infected by Brucella.

[0015] Preferably, the detection or screening method comprises: amplifying the sample to be detected by using the constant-temperature amplification primer to obtain an amplification product; reacting the amplification product, the omega RNA, the TnpB protein and the ssDNA reporter probe 1 to detect whether the reaction solution has fluorescence; if the reaction solution has fluorescence, the sample to be detected contains Brucella and / or DNA thereof; if the reaction solution has no fluorescence, the sample to be detected does not contain Brucella and / or DNA thereof; or, reacting the amplification product, the omega RNA, the TnpB protein and the ssDNA reporter probe 2, inserting a nucleic acid detection test strip into the reaction solution and observing the T line and the C line on the nucleic acid detection test strip; if only the T line develops color or both the T line and the C line develop color, the sample to be detected contains Brucella and / or DNA thereof; if only the C line develops color, the sample to be detected does not contain Brucella and / or DNA thereof.

[0016] Beneficial effects: The application provides an omega RNA for detecting Brucella, and the nucleotide sequence is shown in SEQ ID NO: 4. The omega RNA provided by the application can recognize the Brucella bp26 gene, has high flanking cleavage activity on the amplification product of the Brucella bp26 gene in combination with the TnpB protein, and can cut the non-specific ssDNA reporter probe after recognizing the target sequence, so that the Brucella can be detected through fluorescence detection or a nucleic acid detection test strip, and the omega RNA has high accuracy and sensitivity.

[0017] Further, the kit prepared by using the omega RNA provided by the application is a novel Brucella detection kit with low manufacturing cost and strong operability, and the OMEGA-TnpB detection system can detect Brucella at any time on the spot without a laboratory, and the sensitivity is 1x10 0 copies / μL, and the kit has the characteristics of high specificity, wide universality, low operation requirement, high efficiency and accuracy. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings required in the embodiments will be briefly introduced as follows.

[0019] Figure 1 Schematic diagram for constant temperature amplification primer and ωRNA; Figure 2 Constant temperature amplification product diagram; Figure 3 ωRNA screening diagram; Figure 4 Fluorescence detection sensitivity result; wherein A is the relative fluorescence intensity after detection of different concentrations of plasmids, and B is the fluorescence detection result after detection of different concentrations of plasmids; Figure 5 Fluorescence detection specificity result; wherein A is the fluorescence value at different times, B is the relative fluorescence intensity of different pathogenic bacteria, and C is the fluorescence detection result of different pathogenic bacteria; Figure 6 Test strip detection specificity result; Figure 7 Fluorescence detection of animal samples; wherein A is the fluorescence value of different samples to be tested at different times; B is the relative fluorescence intensity of different samples to be tested, and ‡ is P <0.01; C is the fluorescence detection result of different samples to be tested; Figure 8 Test strip detection of animal samples. DETAILED DESCRIPTION

[0020] The present application provides a kind of ωRNA for detecting Brucella, nucleotide sequence as shown in SEQ ID NO:4.The ωRNA provided by the present application can specifically recognize Brucella bp26 gene, combined TnpB protein has higher side cutting activity to the amplification product of Brucella bp26 gene, ωRNA recognizes target sequence and cuts non-specific ssDNA reporter probe, and Brucella can be detected by fluorescence detection or nucleic acid detection test strip, with higher accuracy and sensitivity.

[0021] Based on the above advantages, the present application provides a fluorescence detection kit for detecting Brucella, which comprises the ωRNA, constant temperature amplification primer, TnpB protein and ssDNA reporter probe 1 described in the above technical solution; the constant temperature amplification primer is a constant temperature amplification primer for amplifying Brucella bp26 gene; the ssDNA reporter probe 1 is a nucleic acid molecule modified with a fluorescent group and a quenching group.

[0022] As an implementation manner, the nucleotide sequence of the ssDNA reporter probe 1 is 5'-TTTTATTTT-3'; the fluorescent group includes FAM; and the quenching group includes BHQ1.

[0023] As an implementation form, the nucleotide sequence of the isothermal amplification primer is shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the TnpB protein comprises an ISDra2 TnpB protein from Deinococcus radiodurans.

[0024] The present application provides a visual kit for detecting Brucella, comprising the omega RNA, the isothermal amplification primer, the TnpB protein, the ssDNA reporter probe 2 and the nucleic acid detection test strip according to the above technical solutions; the isothermal amplification primer is an isothermal amplification primer for amplifying the bp26 gene of Brucella; and the ssDNA reporter probe 2 is a nucleic acid molecule modified with a fluorescent group and biotin. The nucleic acid detection test strip according to the present application is a nucleic acid detection test strip that can capture or bind to biotin.

[0025] As an implementation form, the nucleotide sequence of the ssDNA reporter probe 2 is 5'-TTTTATTTT-3'; and the fluorescent group comprises FAM.

[0026] As an implementation form, the nucleotide sequence of the isothermal amplification primer is shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the TnpB protein comprises an ISDra2 TnpB protein from Deinococcus radiodurans.

[0027] The isothermal amplification primer in the kit provided by the present application specifically amplifies the DNA of Brucella as a template, and the obtained amplification product contains a target sequence that can be recognized by the omega RNA. After the omega RNA recognizes the target sequence, the TnpB protein produces a side-cutting activity on the non-specific ssDNA reporter probe, and fluorescence detection and test strip detection can be performed, thereby realizing the visual detection of Brucella. The kit provided by the present application can detect Brucella at any time on the spot outside the laboratory, and has the characteristics of wide universality, low operation requirement, high efficiency and accuracy.

[0028] The kit provided by the technical scheme has the advantages of simple operation, low manufacturing cost, fast reaction speed, high sensitivity, high specificity, and detection advantages that the results can be observed by naked eyes, and can realize rapid and efficient detection of Brucella nucleic acid, and has good application prospect.

[0029] Based on the above advantages, the application provides the application of the omega RNA, the fluorescent detection kit or the visual kit in (1) and / or (2): (1) non-diagnostic and non-therapeutic detection of Brucella and / or DNA thereof; (2) screening or assisting in screening of drugs for preventing and treating Brucella infection.

[0030] As an implementation manner, the (1) includes detecting food and / or animal living environment infected with Brucella. As an implementation manner, the animal includes a cow and / or a sheep.

[0031] As an implementation manner, the detection or screening method includes: amplifying the sample to be detected by using the isothermal PCR primer to obtain an amplification product; reacting the amplification product, the omega RNA, the TnpB protein and the ssDNA report probe 1 to detect whether the reaction solution has fluorescence; if the reaction solution has fluorescence, the sample to be detected contains Brucella and / or DNA thereof; if the reaction solution has no fluorescence, the sample to be detected does not contain Brucella and / or DNA thereof; or, reacting the amplification product, the omega RNA, the TnpB protein and the ssDNA report probe 2, inserting the nucleic acid detection test strip into the reaction solution, and observing the T line and the C line on the nucleic acid detection test strip; if only the T line develops color or both the T line and the C line develop color, the sample to be detected contains Brucella and / or DNA thereof; if only the C line develops color, the sample to be detected does not contain Brucella and / or DNA thereof.

[0032] In order to further illustrate the application, the omega RNA, the fluorescent detection kit, the visual kit for detecting Brucella and the application thereof provided by the application are described in detail in combination with the embodiments and the drawings, but they cannot be understood as limiting the protection scope of the application.

[0033] Example 1 Design of isothermal amplification primer and omega RNA of Brucella bp26 gene 1.1 According to the Brucella bp26 gene DNA sequence, the isothermal amplification primer F and R are designed by using Primer Premier5, and the specific sequences are as follows: F: 5'-GCTACGCCAGGCAAAGAC-3' (SEQ ID NO: 1); R: 5'-CGTGACGGATTCATCCAAA-3' (SEQ ID NO: 2); First, the bp26 gene sequence (SEQ ID NO: 3) was synthesized, linked with a pMD19-T vector as an amplification template, and the template was gradient diluted to 1 x 10 3 copies / μL for DNA isothermal amplification. The isothermal amplification kit was purchased from Guangzhou AidGene Biotechnology Co., Ltd. The isothermal amplification system was as follows: 29.4 μL A buffer, 2 μL F, 2 μL R, 1 μL DNA template, 2.5 μL B buffer, and ddH2O to 50 μL.

[0034] bp26: 5'-ATGAACACTCGTGCTAGCAATTTTCTCGCAGCCTCATTTTCCACAATCATGCTCGTCGGCGCTTTCAGCCTGCCCGCTTTCGCACAGGAGAATCAGATGACGACGCAGCCCGCGCGCATCGCCGTCACCGGGGAAGGCATGATGACGGCCTCGCCCGATATGGCCATTCTCAATCTCTCGGTGCTACGCCAGGCAAAGACCGCGCGCGAAGCCATGACCGCGAATAATGAAGCCATGACAAAAGTGCTCGATGCCATGAAGAAGGCCGGCATCGAAGATCGCGATCTCCAGACAGGCGGCATCAATATCCAGCCGATTTATGTCTATCCTGACGACAAGAACAACCTGAAAGAGCCTACCATCACCGGCTATTCTGTATCCACCAGTCTCACGGTTCGCGTGCGCGAACTGGCCAATGTTGGAAAAATTTTGGATGAATCCGTCACGCTCGGTGTTAATCAGGGCGGTGATTTGAACCTGGTCAATGATAATCCCTCCGCCGTGATCAACGAGGCGCGCAAGCGCGCAGTGGCCAATGCCATTGCCAAGGCGAAGACGCTTGCCGACGCTGCAGGCGTGGGGCTTGGCCGTGTGGTGGAAATCAGTGAACTGAGCCGCCCGCCCATGCCGATGCCAATTGCGCGCGGACAGTTCAGAACCATGCTAGCAGCCGCACCGGACAATTCCGTGCCGATTGCCGCAGGCGAAAACAGCTATAACGTATCGGTCAATGTCGTTTTTGAAATCAAGTAA-3' (SEQ ID NO: 3).

[0035] After isothermal amplification, the electrophoresis result was observed and photographed in a gel imager. As shown in Figure 2 the F and R primer sets amplified bright target bands, and the length of the target bands was 265 bp.

[0036] 1.2 Design of ωRNA according to the isothermal amplification products of F and R, see the schematic diagram Figure 1wherein 5'-GCCGCCTGTCTGGAGATCGC-3' (SEQ ID NO: 7) is the sequence on the ωRNA that recognizes the isothermal amplification product, and the TAM sequence is TTGAT, and the specific sequence is as follows: ωRNA-1: 5'-GATTCAAGAATCCCGAAGTGAAGAATCTTGCCGTCCGTACATGGACTTGCCCGAACTGTGGGGAAACCCATGACCGAGACGAGAACGCTGCGCTGAACATTCGGCGTGAAGCGTTGGTGGCTGCGGGAATCTCAGACACCTTAAACGCTCATGGAGGCTATGTCAGACCTGCTTCGGCGGGCAATGGTCTGCGAAGTGAGAATCACGCGACTTTAGTCGTGTGAGGTTCAAGCCGCCTGTCTGGAGATCGC-3' (SEQ ID NO: 4); ωRNA-2: 5'-GATTCAAGAATCCCGAAGTGAAGAATCTTGCCGTCCGTACATGGACTTGCCCGAACTGTGGGGAAACCCATGACCGAGACGAGAACGCTGCGCTGAACATTCGGCGTGAAGCGTTGGTGGCTGCGGGAATCTCAGACACCTTAAACGCTCATGGAGGCTATGTCAGACCTGCTTCGGCGGGCAATGGTCTGCGAAGTGAGAATCACGCGACTTTAGTCGTGTGAGGTTCAAGCCGCCTGTCTGGAGATCGCGA-3' (SEQ ID NO: 5); ωRNA-3: 5'-GATTCAAGAATCCCGAAGTGAAGAATCTTGCCGTCCGTACATGGACTTGCCCGAACTGTGGGGAAACCCATGACCGAGACGAGAACGCTGCGCTGAACATTCGGCGTGAAGCGTTGGTGGCTGCGGGAATCTCAGACACCTTAAACGCTCATGGAGGCTATGTCAGACCTGCTTCGGCGGGCAATGGTCTGCGAAGTGAGAATCACGCGACTTTAGTCGTGTGAGGTTCAAGCCGCCTGTCTGGAGATCGCGATC-3' (SEQ ID NO: 6); The constant temperature amplification product was detected by fluorescence with ωRNA-1, ωRNA-2 and ωRNA-3 as guide sequences, and the fluorescence reaction system was: 2 μL TnpB, 1 μL ωRNA, 5 μL 10×Buffer, 1 μL ssDNA reporter probe 1 (FAM-TTTTATTTT-BHQ1), 1 μL constant temperature amplification product, and water to 50 μL.

[0037] The FAM fluorescence signal was collected every minute, and the detection was continued for 20 min.

[0038] The detection results are shown in Figure 3 (* * for P <0.01, the lower graph is the same), and the ωRNA-1 with the highest activity of side cutting was selected for subsequent detection.

[0039] Example 2 Sensitivity detection of Brucella detection kit based on OMEGA-TnpB High-concentration bp26 gene plasmid was diluted to 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 and 1×10 0 copies / μL, and the negative control was NC (enzyme-free water), and fluorescence detection was performed. The detection method was the same as in Example 1.

[0040] The results are shown in Figure 4 , wherein A is the relative fluorescence intensity after detection of different concentrations of plasmid, and B is the fluorescence detection result after detection of different concentrations of plasmid. The results show that the sensitivity of fluorescence reading is 1×10 0 copies / μL. It shows that the Brucella detection kit based on OMEGA-TnpB has good sensitivity.

[0041] Example 3 Specificity detection of Brucella detection kit based on OMEGA-TnpB Brucella (B. abortus, NCBI Taxonomy ID: 235), bovine viral diarrhea virus (BVDV, NCBI Taxonomy ID: 11099), bovine dermatophilus (LSDV, NCBI Taxonomy ID: 376849) and bovine tuberculosis mycobacterium (M. bovis, NCBI Taxonomy ID: 1722) were used. Brucella Bovine viral diarrhea virus Lumpy skin disease virus Mycobacterium bovis ​​​The nucleic acid of the Brucella melitensis (NCBI Taxonomy ID: 1765) was used as the amplification template for fluorescence detection and test strip detection to verify the specificity of the kit.

[0042] The fluorescence detection method was the same as in Example 1.

[0043] The test strip detection reaction system: 2 μL TnpB, 1 μL ωRNA, 3 μL 10x Buffer, 1 μL constant temperature amplification product, 1 μL ssDNA reporter probe 2 (FAM-TTTTATTTT-Biotin), water to 30 μL, 37°C incubation for 20 minutes, and the nucleic acid detection test strip was inserted into the reaction solution to read the results (positive: only "T" line or "T" line and "C" line are displayed, negative: "C" line and "T" line are not displayed); the nucleic acid detection test strip was purchased from Aidgene (item number: EDN-CZ01). The detection results are shown in Figure 5 and Figure 6 wherein, Figure 5 A is the fluorescence value at different times, Figure 5 B is the relative fluorescence intensity of different pathogenic bacteria, Figure 5 C is the fluorescence detection result of different pathogenic bacteria.

[0044] The fluorescence detection ( Figure 5 ) and test strip detection ( Figure 6 ) can accurately read the positive results of Brucella, and there is no obvious cross reaction with the nucleic acids of the other four pathogenic bacteria that infect cattle and sheep, indicating that the OMEGA-TnpB-based Brucella detection kit has good specificity.

[0045] Example 4 Application of OMEGA-TnpB-based Brucella Detection Kit In order to verify the effect of the kit in detecting Brucella samples, 8 samples infected with Brucella virus (including 2 cattle blood samples, 2 sheep blood samples, 2 cattle milk samples and 2 sheep milk samples) and 2 samples not infected with Brucella virus were collected for application evaluation. First, the room temperature sample lysis kit (purchased from Nanjing Nuowezan Biotechnology Co., Ltd.) was used. The sample to be tested was incubated at room temperature for 3 minutes, and then the constant temperature amplification was used to obtain the bp26 gene fragment product to be tested, and the fluorescence detection and test strip detection were performed, and the detection method was the same as in Example 3.

[0046] The results are shown in Figure 7 and 8 wherein, Figure 7 A is the fluorescence value at different times, Figure 7 B is the relative fluorescence intensity of different pathogenic bacteria, P <0.01.Figure 7 C is the fluorescence detection result of different samples to be tested, Figure 8 is the test strip detection result.

[0047] The results show that the positive detection rate of the fluorescence method is 100% (8 / 8) in different samples, and the positive detection rate of the test strip method is 100% (8 / 8).

[0048] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which belongs to the protection scope of the present application.

Claims

1. An omega RNA for detecting Brucella, characterized by, The nucleotide sequence is shown as SEQ ID NO:

4.

2. A fluorescent detection kit for detecting Brucella, characterized by, The nucleotide sequence of the ssDNA reporter probe 2 is 5'-TTTTATTTT-3'; the fluorescent group comprises FAM.

3. The fluorescent detection kit according to claim 2, characterized in that, The nucleotide sequence of the ssDNA reporter probe 2 is 5'-TTTTATTTT-3'; the fluorescent group comprises FAM.

4. The fluorescence detection kit according to claim 2 or 3, characterized in that, The nucleotide sequence of the ssDNA reporter probe 2 is 5'-TTTTATTTT-3'; the fluorescent group comprises FAM.

5. A visualisation kit for detecting Brucella, characterised in that, The nucleotide sequence of the ssDNA reporter probe 2 is 5'-TTTTATTTT-3'; the fluorescent group comprises FAM.

6. The visualization kit of claim 5, wherein, The nucleotide sequence of the ssDNA reporter probe 2 is 5'-TTTTATTTT-3'; the fluorescent group comprises FAM.

7. The visualization kit of claim 5 or 6, wherein, The nucleotide sequence of the ssDNA reporter probe 2 is 5'-TTTTATTTT-3'; the fluorescent group comprises FAM.

8. Use of the omega RNA of claim 1 or the fluorescent detection kit of any one of claims 2-4 or the visual kit of any one of claims 5-7 in (1) and / or (2): (1) non-diagnostic and non-therapeutic detection of Brucella and / or DNA thereof; (2) screening or assisting in screening of drugs for preventing and treating Brucella infection.

9. Use according to claim 8, characterized in that, The (1) comprises detecting food and / or animal living environment infected with Brucella.

10. Use according to claim 8 or 9, characterized in that, The method for detection or screening comprises: performing isothermal PCR amplification on the sample to be tested by using the isothermal amplification primer to obtain an amplification product; reacting the amplification product, the omega RNA, the TnpB protein and the ssDNA reporter probe 1 to detect whether the reaction solution has fluorescence; if the reaction solution has fluorescence, the sample to be tested contains Brucella and / or DNA thereof; if the reaction solution has no fluorescence, the sample to be tested does not contain Brucella and / or DNA thereof; or, reacting the amplification product, the omega RNA, the TnpB protein and the ssDNA reporter probe 2, inserting the nucleic acid detection test strip into the reaction solution and observing the T line and the C line on the nucleic acid detection test strip; if only the T line develops color or both the T line and the C line develop color, the sample to be tested contains Brucella and / or DNA thereof; if only the C line develops color, the sample to be tested does not contain Brucella and / or DNA thereof.

Citation Information

Patent Citations

  • High-temperature-resistant TnpB protein and application thereof in nucleic acid detection

    CN117512071A

  • Application of programmable TnpB nuclease gene editing

    CN119752847A

  • Methods for identification and detection of mycobacterium tuberculosis complex and nontuberculous mycobacteria using duplex real time polymerase chain reaction

    KR1020120088563A