PagNLP8 / 9a gene for regulating and controlling development of xylem of poplar and application of PagNLP8 / 9a gene

By cloning and overexpressing the PagNLP8/9a gene, the problem of nitrogen deficiency in poplar plantations limiting timber yield was solved, achieving effective regulation of poplar lignite and increasing timber production.

CN121362764APending Publication Date: 2026-01-20INST OF FORESTRY CHINESE ACAD OF FORESTRY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511544426.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-28
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

Nitrogen deficiency in the soil of poplar plantations affects productivity and limits timber production. Existing technologies are insufficient to effectively regulate xylem development to increase timber yield.

Method used

The PagNLP8/9a gene was cloned and an overexpression vector pK2GW7 was constructed to overexpress it in poplar trees. The gene was then transferred into poplar trees via Agrobacterium-mediated transformation to regulate xylem development.

Benefits of technology

Overexpression of the PagNLP8/9a gene promotes the development of poplar root system, increases plant height, increases the number of internodes, increases xylem width, and increases timber yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121362764A_ABST
    Figure CN121362764A_ABST
Patent Text Reader

Abstract

The invention relates to a PagNLP8 / 9a gene for regulating xylem development of poplar and application of the PagNLP8 / 9a gene, and belongs to the technical field of plant genetic engineering and biology. The nucleotide sequence of the PagNLP8 / 9a gene for regulating and controlling the development of the xylem of the poplar is shown as a sequence 1 in a sequence table; the amino acid sequence of the expression protein of the PagNLP8 / 9a gene is as shown in the sequence 2 in the sequence table. The PagNLP8 / 9a gene is transferred into poplar 84K, and compared with a wild type, the transgenic poplar over-expressing the PagNLP8 / 9a has a phenotype with increased xylem width, which indicates that the PagNLP8 / 9a gene is the key for regulating the development of the xylem of the poplar and has important application value in the field of high-yield genetic engineering of forest trees.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a kind of regulation poplar xylem development PagNLP8 / 9a Gene and its application belong to plant genetic engineering and biotechnology field. BACKGROUND

[0002] Wood is mainly the result of secondary xylem of cambium differentiation of woody plants year after year accumulation. Nitrogen is the basic constituent component of protein, nucleic acid, chlorophyll and some coenzyme, coenzyme, plant hormone and vitamin required for plant growth and development. In nature, plants mainly absorb nitrogen nutrition from soil by root system or symbiosis with microorganisms. Because the nitrogen content in nature is low, nitrogen becomes an important factor limiting plant growth and development, and it is reported that the contribution to crop yield is as high as 40%~50%. For woody plants, nitrogen deficiency is also a key factor limiting wood yield.

[0003] NLP (NIN-Like Protein) is a NIN-like gene. NIN (nodule inception) is first identified in Lotus japonicus, and is an important regulatory gene for root nodule formation of leguminous plants. Subsequent studies have found that this type of gene also exists in non-leguminous plants, which is called NLP gene. NLP gene is a kind of transcription factor unique to plants, which is considered as a "nitrate sensor", which activates the expression of downstream genes by binding to nitrate responsive cis-element (NRE) in the promoter of target gene, and participates in the regulation of early metabolism of nitrate in plants.

[0004] Poplar plantations generally have poor site conditions, and soil nitrogen deficiency greatly affects the productivity of poplar plantations. Therefore, in poplar breeding research, it can be considered to regulate nitrogen metabolism as an entry point to improve wood yield.

[0005] The present inventors believe that it is feasible to regulate xylem development by starting from NLP gene regulating nitrogen metabolism. The research on NLP gene regulating xylem development will lay a theoretical foundation for subsequent breeding of high-yield poplar under poor site conditions, and has important practical significance and application prospect for promoting the prosperity of poplar wood industry. SUMMARY

[0006] In view of the deficiencies in the prior art, the main purpose of the present application is to provide a kind of regulation poplar xylem development PagNLP8 / 9a Gene, at the same time, construct to overexpression vector pK2GW7, the gene is located after 35S promoter, under the drive of 35S promoter, PagNLP8 / 9a Can overexpress in poplar in vivo, thereby regulating the development of poplar xylem.

[0007] The above-mentioned objective of this invention is achieved through the following technical solution: A mechanism for regulating the development of poplar wood PagNLP8 / 9a The gene, whose nucleotide sequence is shown in Sequence 1 of the sequence listing.

[0008] Another object of the present invention is to provide the above-mentioned method for regulating poplar wood development. PagNLP8 / 9a Proteins that express genes.

[0009] A mechanism for regulating the development of poplar wood PagNLP8 / 9a The amino acid sequence of the gene's expressed protein is shown in Sequence 2 of the sequence listing.

[0010] Another object of the present invention is to provide a method for regulating the development of poplar pith. PagNLP8 / 9a Gene cloning methods 。

[0011] A mechanism for regulating the development of poplar wood PagNLP8 / 9a The steps involved in gene cloning are as follows: (1) Using silver gland poplar 84K ( P.alba×P.glandulosa cv.84K Using materials (the same below), RNA was extracted using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme Biotech Co., Ltd); RNA was reverse transcribed using an All-In-One 5xRT MasterMix (Applied Biological Materials Inc.) to obtain cDNA of *Populus alba* 84K. (2) Primers were designed using Oligo7 software to amplify the amplification process. PagNLP8 / 9a Gene coding sequence, primer length 15-25bp, Tm value around 56℃, primers with pK2GW7 adapter (eyGFP-SpeI-F: cctgcaggcggccgcactagt; eyGFP-PmeI-R: tccttgtaatcgtttgtttaaac); Using *Populus alba* 84K cDNA as a template, and amplification was performed using 2xPhantaMax Master Mix (Vazyme, Beijing, China) P525 high-fidelity enzyme, a full-length 2967 bp amplification was obtained. PagNLP8 / 9a Gene cDNA sequence; in, PagNLP8 / 9a The forward primers for ORF are shown in Sequence 3 of the sequence listing; PagNLP8 / 9a The ORF reverse primer is shown in sequence 4 of the sequence listing; (3) PCR reaction system as follows: 2xPhanta Max Master Mix 25 μL, forward primer (10 μM) 2 μL, reverse primer (10 μM) 2 μL, template (silver adenine poplar 84K cDNA) 2 μL, sterile ddH2O to 50 μL; reaction program as follows: 95 ℃ 3 min; 95 ℃ 30 s, 56 ℃ 30 s, 72 ℃ 180 s, 35 cycles; 72 ℃ 5 min; The final full-length cDNA sequence of the gene is 2967 bp, and is named PagNLP8 / 9a Gene.

[0012] Another object of the application is to provide a method for constructing a plant expression vector of a poplar xylem development regulating PagNLP8 / 9a Gene. 。

[0013] A method for constructing a plant expression vector of a poplar xylem development regulating PagNLP8 / 9a Gene, and the steps are as follows: (1) The coding sequence of the obtained PagNLP8 / 9a Gene is inserted into the multiple cloning site of the overexpression vector pK2GW7 according to the DNA homologous recombination seamless cloning technology, and an overexpression vector of the PagNLP8 / 9a Gene is obtained, and the sequence of the overexpression vector pK2GW7 is shown in sequence 5. The specific process of the expression vector construction is as follows: according to the reaction system, 100 ng of fresh PCR product, 20 ng of pK2GW7 overexpression vector and 2.5 μL of Basic Mix enzyme are added, and the reaction is carried out in a 50 ℃ metal bath for 0.5 h to obtain the constructed overexpression vector; the above mixed solution after reaction is transformed into E. coli and coated on LB solid screening medium, and single colonies are picked from the LB solid screening medium for PCR detection and sequencing verification to confirm that the gene sequence is successfully inserted into the pK2GW7 overexpression vector. (2) In the constructed vector of the PagNLP8 / 9a Gene, a strong promoter 35S is assembled at the 5' end of the gene, so that the PagNLP8 / 9a Protein can be efficiently expressed in the poplar body; the expression vector pK2GW7 contains LB and RB sequences and a kanamycin (Kan) selection marker, wherein the LB and RB sequences promote the integration of the 35S: PagNLP8 / 9a Expression framework and the selection marker gene Kan assembled therebetween into the poplar chromosome, and the Kan is used as a selection marker for screening of the transgenic poplar, and then a transgenic positive poplar is obtained.

[0014] Preferably, the LB solid screening medium has the following composition: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 8 g / L agar powder, and 50 mg / L spectinomycin.

[0015] Another object of the present invention is to provide the above-mentioned regulation of poplar wood development. PagNLP8 / 9a Genetic transformation.

[0016] A mechanism for regulating the development of poplar wood PagNLP8 / 9a The genetic transformation of genes involves the following steps: The constructed pK2GW7- was subjected to electric shock. PagNLP8 / 9a The overexpression vector was transformed into Agrobacterium GV3101, and through Agrobacterium-mediated expression, the expression vector was transferred to Agrobacterium GV3101. PagNLP8 / 9a Genes were transferred into poplar trees.

[0017] Another object of the present invention is to provide the above-mentioned method for regulating poplar pith development. PagNLP8 / 9a Applications of genes.

[0018] The regulation of poplar wood development PagNLP8 / 9a Application of genes in regulating the development of poplar wood.

[0019] Preferably, the regulation of poplar wood development includes: PagNLP8 / 9a Genetically modified poplars have well-developed root systems, increased plant height, more internodes, and increased xylem width. Beneficial effects

[0020] This invention uses *Populus alba* 84K as material to clone... PagNLP8 / 9a Gene; simultaneously, an overexpression vector pK2GW7 was constructed, which contains the gene located after the 35S promoter, and is driven by the 35S promoter. PagNLP8 / 9a It can be overexpressed in poplar trees, thereby regulating the development of poplar wood, among which, PagNLP8 / 9a Genes are key genes that regulate the development of poplar wood.

[0021] This invention achieves this through overexpression PagNLP8 / 9a This study aims to regulate the development of poplar wood tissue, increase timber yield, and provide a reference method for cultivating high-yield poplar trees.

[0022] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this does not imply any limitation on the scope of protection of the present invention. Attached Figure Description

[0023] Figure 1 The plant expression vector pK2GW7- of this invention PagNLP8 / 9a A schematic diagram of the structure; Figure 2 This invention is an overexpressionPagNLP8 / 9a Real-time quantitative detection of transcription levels in transgenic poplar trees; Figure 3 The present invention is based on the non-GMO poplar (Silver Gland Poplar 84K) and PagNLP8 / 9a Growth diagram of a genetically modified poplar tree; Figure 4 The present invention is based on the non-GMO poplar (Silver Gland Poplar 84K) and PagNLP8 / 9a A cross-section of a genetically modified poplar stem. Detailed Implementation

[0024] The present invention will be further described below with reference to specific embodiments. Operations not described in detail in the following embodiments can be performed by referring to the instructions for use of molecular cloning related reagent kits.

[0025] Example 1 Cloning PagNLP8 / 9a Gene With silver gland poplar 84K ( P.alba×P.glandulosa cv.84K Using materials from the same source (e.g., *Populus alba*), RNA was extracted using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme Biotech Co., Ltd). RNA was reverse transcribed using an All-In-One 5X RT MasterMix (Applied Biological Materials Inc.) to obtain cDNA of *Populus alba* 84K. Primers (containing start and stop codons) were designed using Oligo7 software, referencing published *Populus alba* genome sequences, to amplify the full-length gene (with pK2GW7 adapters introduced into the primers). in, PagNLP8 / 9a The forward primer for ORF is shown in sequence 3 of the sequence listing; PagNLP8 / 9a The ORF reverse primer is shown as sequence 4 in the sequence listing; Using *Populus aureus* 84K cDNA as a template, amplification was performed using 2xPhantaMax Master Mix (Vazyme, Beijing, China) P525 high-fidelity enzyme. The 50 μL reaction system was as follows: 25 μL 2xPhantaMax Master Mix, 2 μL forward primer (10 μM), 2 μL reverse primer (10 μM), 2 μL template (*Populus aureus* 84K cDNA), and sterile ddH2O to a final volume of 50 μL. The reaction program was: pre-denaturation at 95℃ for 3 min; 35 cycles of 95℃ for 30 s, 56℃ for 30 s, and 72℃ for 180 s; followed by 72℃ for 5 min. The final full-length cDNA sequence of the gene was 2967 bp, and it was named... PagNLP8 / 9aThe gene sequence is shown in Sequence 1 of the sequence listing, and the protein sequence it expresses is shown in Sequence 2 of the sequence listing.

[0026] Example 2 PagNLP8 / 9a Construction of plant gene expression vectors Using cloning technology to build PagNLP8 / 9a Gene overexpression vector, using specific PCR primers (Example 1) PagNLP8 / 9a Using ORF primers and 84K cDNA from *Populus alba* as a template, PCR amplification was performed. PagNLP8 / 9a The gene ORF was constructed into the expression vector pK2GW7, and the sequence is shown in sequence 5 of the sequence listing. The overexpression vector construction reaction system consisted of 100 ng of fresh PCR product, 20 ng of pK2GW7 overexpression vector, and 2.5 μL of Basic Mix enzyme. The mixture was placed in a 50℃ metal bath and reacted for 0.5 h to obtain the constructed overexpression vector. The resulting mixture was transformed into *E. coli* and plated onto LB solid selection medium. The composition of the LB solid selection medium was as follows: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 8 g / L agar powder, and 50 mg / L spectinomycin. Single clones were picked from the selection medium for PCR detection and sequencing verification to confirm successful insertion of the gene sequence into the pK2GW7 overexpression vector. PagNLP8 / 9a In the constructed gene vector, the 5' end of the gene is equipped with a strong 35S promoter, which enables... PagNLP8 / 9a The protein was efficiently expressed in poplar; the expression vector pK2GW7 contained LB and RB sequences as well as a kanamycin (Kan) selection marker, where the LB and RB sequences promoted the assembly of the 35S:: PagNLP8 / 9a The expression framework and selection marker gene Kan were integrated into the poplar chromosome, and Kan was used as a selection marker for the selection of transgenic poplars, thereby obtaining transgenic positive poplars.

[0027] Example 3 PagNLP8 / 9a Genetic transformation The constructed pK2GW7- was subjected to electric shock. PagNLP8 / 9a The overexpression vector was transformed into Agrobacterium GV3101, and through Agrobacterium-mediated expression, PagNLP8 / 9a Gene transfer into poplar (Silver Gland Poplar 84K, P.alba×P.glandulosa cv.84K (The same applies below), the specific transformation steps are as follows: The *Populus silveraefolia* 84K tissue culture seedlings used for genetic transformation were cultured at a temperature of 23-25℃, with a light intensity of 16 / 8h (day / night) and a light intensity of 50 μM•m. -2 •s -1 Cultured under the conditions containing pK2GW7- PagNLP8 / 9aAgrobacterium expressing the vector was used to infect leaf disks of P. alba 84K at OD 600 = 0.6-0.8, and the infected leaf disks were cultured in shoot induction medium (SIM, Murashige-Skoog (MS) basal medium supplemented with 0.5 mg / L 6-benzylaminopurine (6-BA) and 0.05 mg / L naphthalene acetic acid (NAA)) for 3 days in darkness at 23±2°C. The leaf disks after co-cultivation were transferred to SIM containing 200 mg / L Timentin and 6 mg / L Kanamycin, and were induced and selected for resistant shoots at 23-25°C, 16 / 8 h (day / night) illumination, and 50 μM m -2 s -1 . After about 20 days of induction, the resistant shoots were transferred to rooting medium (RIM, 1 / 2 MS basal medium supplemented with 0.05 mg / L IBA (indole butyric acid) and 0.02 mg / L NAA) containing 10 mg / L Kanamycin and 200 mg / L Timentin, and were induced to form roots. The DNA of the rooted plant leaves was extracted and verified by PCR.

[0028] Example 4 PagNLP8 / 9a Application of the gene Agrobacterium-mediated leaf disk method was used to genetically transform P. alba 84K. The 84K tissue culture seedlings used for genetic transformation were cultured in a growth chamber at 23-25°C, 16 h light / 8 h dark illumination, and 50 μM m -2 •s -1 . Agrobacterium containing pK2GW7- PagNRT3.1 and OD 600 = 0.6-0.8 was used to infect leaf disks of P. alba 84K, and the infected leaf disks were cultured in shoot induction medium (SIM, Murashige-Skoog (MS) basal medium supplemented with 0.5 mg / L 6-BA and 0.05 mg / L NAA) for 3 days in darkness at 23±2°C. The leaf disks after dark culture were transferred to SIM containing 200 mg / L Timentin and 6 mg / L Kanamycin, and were induced and selected for resistant shoots at 23-25°C, 16 h light / 8 h dark illumination, and 50 μM m -2 •s -1Under specific conditions, resistant adventitious shoots were induced and screened. After one month of induction and screening culture, the resistant adventitious shoots were transferred to RIM rooting medium (1 / 2 MS basal medium supplemented with 0.05 mg / L IBA and 0.02 mg / L NAA) containing 200 mg / L Timentin and 10 mg / L Kanamycin, until adventitious roots were induced, resulting in overexpression. PagNLP8 / 9a Genetically modified poplar trees, PagNLP8 / 9a The three transgenic poplar lines with high expression levels (OE4, OE5, and OE8) will be used as representatives for subsequent phenotypic observation and functional studies. like Figure 2 As shown, this is an overexpression of the present invention. PagNLP8 / 9a The graph shows the real-time quantitative detection of transcription levels in transgenic poplar trees. Tissue culture seedlings approximately one month old were used as material. RNA was extracted and reverse transcribed, and the transcription was performed using the SYBR Premix Ex Taq™ Kit (TaKaRa), with the ACTIN gene as an internal control, using a LightCycler 480 (Roche) real-time quantitative instrument. The bar chart in the graph shows... PagNLP8 / 9a The gene was overexpressed in both non-transgenic poplar (Silver Gland Poplar 84K) and transgenic poplar (OE4, OE5, OE8). PagNLP8 / 9a Expression levels in three lines of transgenic poplar; from Figure 2 It can be seen that, compared with the non-transgenic poplar (Silver Gland Poplar 84K), the transgenic poplars (OE4, OE5, OE8) have... PagNLP8 / 9a The level of expression has significantly improved; such as Figure 3 The image shows a non-genetically modified poplar (Silver Gland Poplar 84K) and the present invention. PagNLP8 / 9a Comparative images of the growth phenotypes of transgenic poplar trees (OE4, OE5, OE8), photographed using a regular camera; from Figure 3 It can be seen that, compared with non-genetically modified poplar (Silver Poplar 84K), PagNLP8 / 9a The well-developed root system, increased plant height, and increased number of internodes in transgenic poplar trees (OE4, OE5, OE8) indicate that... PagNLP8 / 9a Gene overexpression promotes poplar growth; such as Figure 4 The image shows a non-genetically modified poplar (Silver Gland Poplar 84K) and the present invention. PagNLP8 / 9a Cross-section of stem from transgenic poplar (OE4, OE5, OE8), from Figure 4 It can be seen that the transgenic poplar has a significantly increased width of its wood, indicating that... PagNLP8 / 9a Overexpression promotes xylem development.

[0029] This invention will... PagNLP8 / 9a When the gene was transferred into *Populus silveraefolius* 84K, it was overexpressed compared to the wild type. PagNLP8 / 9a The transgenic poplar of the application appears the phenotype of increased xylem width, which indicates that PagNLP8 / 9a The gene is a key regulatory gene for regulating poplar xylem development, and has important application value in the field of high-yield genetic engineering of forest trees.

[0030] Although the above detailed description of the purpose of the application and the embodiments, those skilled in the art can realize that various improvements and changes can be made to the application without departing from the scope defined by the claims, and such improvements and changes should still belong to the protection scope of the application.

Claims

1. A gene regulating development of xylem in Populus, the nucleotide sequence of which is shown as SEQ ID NO: 1 in the sequence listing. PagNLP8 / 9a 2. The gene according to claim 1, wherein the nucleotide sequence of the gene is shown as SEQ ID NO: 1 in the sequence listing.

2. The gene of claim 1, wherein the expression protein has an amino acid sequence as set forth in SEQ ID NO: 2 of the sequence listing. PagNLP8 / 9a 2. The gene of claim 1, wherein the expression protein has an amino acid sequence as set forth in SEQ ID NO: 2 of the sequence listing.

3. The method for regulating poplar wood development as described in claim 1 PagNLP8 / 9a The steps involved in gene cloning are as follows: (1) Taking Populus alba 84K as the material, RNA was extracted using a FastPure Universal Plant Total RNA Isolation Kit kit; (2) The RNA was reversely transcribed using an All-In-One 5xRT MasterMix, and cDNA was obtained, and Oligo7 software was used to design primers for full-length gene amplification; wherein, PagNLP8 / 9a ORF forward primer as shown in sequence 3 of the sequence listing; PagNLP8 / 9a ORF reverse primer as set forth in SEQ ID NO: 4 of the Sequence Listing; (3) The high-fidelity PCR reaction system is as follows: 2xPhanta Max Master Mix, forward primer, reverse primer, Populus alba 84K cDNA, sterile ddH2O; The full-length cDNA sequence of the gene is 2967 bp, named as PagNLP8 / 9a Gene.

4. The method for regulating poplar wood development as described in claim 3 PagNLP8 / 9a A gene cloning method, characterized by: The reaction procedure of the reaction system in step (3) is as follows: Pre-denaturation 95℃ 3min; 95℃ 30s, 56℃ 30s, 72℃ 180s, 35 cycles; 72℃ 5min.

5. The method for regulating poplar wood development as described in claim 1 PagNLP8 / 9a The construction method of plant expression vectors for genes involves the following steps: (1) The coding sequence of the obtained PagNLP8 / 9a gene was inserted into the multiple cloning site of the overexpression vector pK2GW7 according to the seamless cloning technology of DNA homologous recombination to obtain a constructed PagNLP8 / 9a gene overexpression vector. The sequence of the overexpression vector pK2GW7 is shown in SEQ ID NO:

5. The specific process of constructing the expression vector is as follows: according to the reaction system, 100ng of fresh PCR product, 20ng of pK2GW7 overexpression vector, and 2.5μL of Basic Mix enzyme were added and placed in a 50℃ metal bath for 0.5h to obtain the constructed overexpression vector; the above mixed solution after reaction was transformed into E. coli and plated on LB solid screening medium, and single colonies were picked from the LB solid screening medium for PCR detection and sequencing verification to confirm that the gene sequence was successfully inserted into the pK2GW7 overexpression vector; (2) in PagNLP8 / 9a The 5' end of the gene in the constructed vector is assembled with a strong promoter 35S, which can make the protein highly expressed in poplar; PagNLP8 / 9a The expression vector pK2GW7 contains LB and RB sequences and a kanamycin selection marker. The LB and RB sequences promote the integration of the 35S: PagNLP8 / 9a expression framework and the selection marker gene Kan into the poplar chromosome, and Kan is used as a selection marker for the selection of transgenic poplar, thereby obtaining transgenic positive poplar.

6. The method for regulating poplar wood development as described in claim 5 PagNLP8 / 9a A method for constructing a plant expression vector for genes, characterized by: The composition of the LB solid screening medium is as follows: tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, agar powder 8g / L, spectinomycin 50mg / L.

7. The method for regulating poplar wood development as described in claim 1 PagNLP8 / 9a The genetic transformation of genes involves the following steps: (1) The pK2GW7- constructed in claim 5 was transformed into Agrobacterium GV3101 by electric shock method. PagNLP8 / 9a The overexpression vector was transformed into Agrobacterium GV3101. (2) The Populus gene was transferred into Populus by Agrobacterium-mediated transformation. PagNLP8 / 9a transferred into Populus by Agrobacterium-mediated transformation.

8. The use of a gene as claimed in claim 1 for regulating poplar xylem development. PagNLP8 / 9a in the regulation of poplar xylem development.

9. The use of a gene as claimed in claim 8 for regulating poplar xylem development. PagNLP8 / 9a The use of a gene for regulating poplar xylem development, characterized in that, The regulation of poplar xylem development comprises: PagNLP8 / 9a The transgenic poplar has developed root system, increased plant height, increased internode number and increased xylem width.