Gene MsRH53 for improving salt tolerance of alfalfa and application of gene MsRH53
By overexpressing the MsRH53 gene in alfalfa, its antioxidant system was enhanced, thus solving the problem of insufficient salt stress tolerance in alfalfa and achieving stronger salt tolerance and antioxidant capacity.
Patent Information
- Application Number
- CN202511610042.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-05
- Publication Date
- 2026-01-20
AI Technical Summary
In the existing technology, alfalfa has poor tolerance to salt stress, which leads to inhibited plant growth. Moreover, there is little research on related genes, making it difficult to breed new alfalfa varieties that are more salt-tolerant through molecular breeding.
The MsRH53 gene, a member of the DEAD-box RNA helicase family, was cloned and overexpressed, and introduced into alfalfa via Agrobacterium-mediated genetic transformation. This enhanced the plant's antioxidant system and increased peroxidase activity to accelerate the removal of reactive oxygen species.
It improved the salt tolerance of alfalfa, reduced the wilting of plants under salt stress, decreased MDA content and electrolyte permeability, reduced cell membrane damage, increased peroxidase levels, and enhanced resistance to salt and alkali stress.
Smart Images

Figure CN121362769A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and specifically, the present application provides a gene MsRH53 for improving salt tolerance of alfalfa and application thereof. BACKGROUND
[0002] Alfalfa (Medicago sativa L.) is an important forage crop widely planted around the world, and its biomass and nutritional value are of great significance to animal husbandry. However, soil salinization has become a key environmental stress factor restricting alfalfa production and quality. Salt stress can cause osmotic imbalance, ion toxicity, and excessive accumulation of reactive oxygen species (ROS) in plants, thereby inhibiting the growth and development of alfalfa. Existing studies have shown that the mechanism of plant response to salt stress mainly involves ion balance maintenance, osmotic regulation, antioxidant system enhancement, and plant hormone signal pathway regulation. Among them, the DEAD-box RNA helicase family plays an important role in gene expression regulation, mRNA stability, and non-biological stress response. Some members of the DEAD-box RNA helicase subfamily are involved in regulating non-biological stress tolerance, but there is less research on their functions in alfalfa. Therefore, it is urgent to identify new key genes related to salt stress, analyze their functions, and use them for molecular breeding to cultivate new alfalfa varieties with stronger salt tolerance and alleviate the difficulties of grass and livestock production in saline areas. SUMMARY
[0003] In one aspect, the present application provides a gene MsRH53 for improving salt tolerance of alfalfa, and the nucleotide sequence of the gene is SEQ ID NO. 1.
[0004] In another aspect, the present application provides an alfalfa salt-tolerant protein MsRH53, and the amino acid sequence of the alfalfa salt-tolerant protein MsRH53 is SEQ ID NO. 2.
[0005] In another aspect, the present application provides a vector carrying the gene.
[0006] In another aspect, the present application provides the use of the above-mentioned gene in improving salt tolerance of alfalfa.
[0007] Further, the alfalfa is Medicago sativa.
[0008] Further, the application overexpresses the above-mentioned gene in the alfalfa.
[0009] Further, the overexpression is achieved by introducing an overexpression vector carrying the above-mentioned gene into the alfalfa.
[0010] Further, Agrobacterium-mediated transformation is used to introduce an overexpression vector carrying the above-mentioned gene into the alfalfa.
[0011] Further, the improving salt tolerance of alfalfa comprises reducing wilting of the plant under saline-alkali stress, reducing MDA content and electrolyte permeability in the plant under saline-alkali stress, reducing cell membrane damage of the plant under saline-alkali stress, and / or increasing peroxidase level in the plant under saline-alkali stress.
[0012] In another aspect, the present application provides Medicago sativa in which the above-mentioned gene is overexpressed.
[0013] The system of the present application analyzes the functional mechanism of MsRH53 gene in salt tolerance of Medicago sativa, and finds that the gene improves POD and other peroxidase activities, accelerates ROS clearance, and thus positively regulates salt tolerance of Medicago sativa. The present application provides a theoretical basis for salt tolerance breeding of Medicago sativa. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 Figure 1 is a phylogenetic tree and expression pattern diagram of MsRH53. Part A is a phylogenetic tree of RH53 gene family: the phylogenetic tree is constructed by using protein sequences of Medicago sativa (MsRH53), Medicago truncatula (MtRH53, MtDExD / H20, MtDExD / H22, MtDExD / H26, MtDExD / H40, MtDExD / H45, MtDExD / H50), Glycine max (GmRH53), Zea mays (ZmRH9), Oryza sativa (OsRH9 and OsRH17), Brassica rapa (BraRH5), Triticum aestivum (TaRH53), and Arabidopsis thaliana (AtRH53, AtRH25, AtRH6, AtRH7, and AtRH3). Part B is the expression level of MsRH53 in different tissues of alfalfa: Top (top), Ml (mature leaf), S (stem), Ol (old leaf), CY (lateral bud), YL (young leaf), RM (main root), Rt (root tip), RJ (junction of root cap). Part C is the relative expression amount of MsRH53 in the roots and leaves of Medicago sativa cv. Zhongmu No. 1 under NaCl stress at different time points. Part D is the subcellular localization of MsRH53 in epidermal cells of Nicotiana benthamiana. The scale is 25 μm. Note: the numerical value represents mean ± SD (n=3).
[0015] Figure 2PCR identification and quantitative detection results of MsRH53-OE plants. Part A is the PCR identification results of MsRH53-OE plants, M, DNA ladder AL2000; +, PCGW-OE plasmid positive control; -, wild type (WT) alfalfa DNA negative control; 1-14, resistant seedling DNA samples; part B is the MsRH53 expression amount of wild type and transgenic seedlings; note: the numerical value represents mean ± SD (n=3).
[0016] Figure 3 Salt treatment phenotype of WT and MsRH53-OE lines. Part A: WT and MsRH53-OE plants treated for 0d, 10d, 14d and recovery treatment for 14d, the scale is 5cm (from left to right, 250 mM NaCl 0 day, 250 mM NaCl 10 days, 250 mM NaCl 14 days, Recovery 14 days); under each time, from left to right, WT, OE-9, OE-8, OE-14); part B: leaf DAB and NBT staining, the scale is 1cm.
[0017] Figure 4 Resistance physiological indicators of WT and MsRH53-OE transgenic plants are shown. Note: each sample is designed with three biological replicates, and Student's t-test (*P<0.05, **P<0.01) is used to analyze the difference. Error bar represents ± SD, n=3. DETAILED DESCRIPTION
[0018] The following examples facilitate better understanding of the present application, but are not limited thereto, and these examples are only for illustrative purposes, and do not limit the protection scope of the present application.
[0019] Example 1 MsRH53 gene and its functional characterization
[0020] The present application clones MsRH53 gene from alfalfa (variety: Zhongmo No. 1) and obtains the protein sequence thereof.
[0021] MsRH53
[0022]
[0023] Amino acid sequence:
[0024] >MsRH53
[0025] MITTILRRASSTLSRRTIPAASEILFSTTAATELRHLTARSFHSKSQPLLFRASSASRAGYAAEAFRIEEPSKSNSDEGLEIAKLGISQDIVAALEKKGITKLFPIQRAVLEPAMQGRDMIGRARTGTGKTLAFGIPIMDKIIQFNAKHGRGKDPLALVLAPTRELAKQVEKEFYESAPNLDTICVYGGTPISQQMRQLDYGVDIAVGTPGRIIDLLNRGALNLKEVQFVILDEADQMLQVGFQEDVEKILERLPTERQTLMFSATMPTWIKQLTRNYLKNPLTIDLVGDSDQKLADGISLYSILSDAYVKAGIIVPLIKEHAKGGKCIVFTQTKRDADRISHGMSKSIPCEALHGDISQVQRERTLAGFRNGHFNVLVATDVASRGLDIPNVDLVIHYELPNNSEIFVHRSGRTGRAGKKGTAILVYTQDQSRTLRTIERDVGCKFSELPKIAVDTASLSGFSGGGRFGGGGGGFGGGRSGSFGGGRSGGYSNSGGFSGSRQSGGGFSGGSSSYGENRYGGSSSGRFGSFGSGDSGSRSGGSSGGFSKQGGFGGFGGGSDRSGGFGGGFGDFGSGKPGAFGDRRGRD* (SEQ ID NO. 2).
[0026] Phylogenetic tree construction: The amino acid sequences of the gene family were extracted from the reference genome database of Medicago sativa ‘Xinjiang Daye’, and the RH amino acid sequences of Arabidopsis thaliana, Glycine max, Medicago truncatula, Zea mays, Glycine max, Triticum aestivum, Brassica rapa were from NCBI (https: / / www.ncbi.nlm.nih.gov / ). The maximum likelihood method (MEGA11) was used for protein evolution analysis of Medicago sativa MsRH53 gene family. Phylogenetic analysis showed that MsRH53 belongs to a conservative DEAD-box helicase subfamily, and has a close evolutionary relationship with the homologous genes of Medicago truncatula, Glycine max and other legume plants. Because it has the highest homology with Medicago truncatula MtRH53, it is named MsRH53 (part A of the present application). Figure 1
[0027] Expression pattern analysis: To further characterize MsRH53, we tested its expression pattern in different tissues of Medicago varia cv. Zhongmai No. 1. The results showed that MsRH53 exhibited the highest transcription level in lateral buds and the lowest in young and mature leaves, indicating tissue specificity (Fig. 1A). Figure 1 To detect the expression pattern of MsRH53 under abiotic stress, we detected the relative expression of MsRH53 in roots and leaves of Medicago varia cv. Zhongmai No. 1 within 24 h of NaCl treatment. The results showed that the expression level of the gene increased with the increase of treatment time, reached a peak at 24 h, and the trend was consistent in roots and leaves (Fig. 1C). Figure 1
[0028] Subcellular localization: To determine the subcellular localization of MsRH53, we fused eGFP to the 3' end of MsRH53 after removing the stop codon. The MsRH53-eGFP fusion gene was ligated into the PCGW vector regulated by the CaMV 35S promoter (35S:MsRH53-eGFP). The recombinant plasmid and the control vector (35S:eGFP) were transformed into Agrobacterium Gv3101 strain, and Agrobacterium, ATHOOK and CBL were injected into healthy tobacco leaves as nuclear localization and membrane localization. The leaves were placed in the dark for 2-3 h, and the expression of GFP (Green fluorescent protein) signal in the cells was observed under laser confocal microscope (Nikon A1 HD25) within 48-72 h. The results showed that MsRH53-GFP overlapped with the expression position of nuclear localization marker protein in the nucleus, proving that MsRH53 protein had nuclear localization in tobacco cells. In addition, MsRH53-GFP also had expression signals outside the nucleus (Fig. 1D). Figure 1 The above results show that MsRH53 responds to salt stress in Medicago sativa.
[0029] Example 2: Obtaining Medicago sativa MsRH53 transgenic plants
[0030] MsRH53 was cloned from Medicago sativa cv. Zhongmu No. 1 by using gene-specific primers MsRH53-F / R. After MsRH53 was homologously recombined into the binary expression vector PC-GW and sequencing confirmation, it was transformed into Agrobacterium EHA105 strain. Genetic transformation was carried out according to the Agrobacterium-mediated genetic transformation method published in the literature of the laboratory in the early stage. The receptor plant used was Medicago sativa cv. Zhongmu No. 1. The alfalfa regenerated plants expressing MsRH53 were verified as transgenic overexpression lines by PCR and qRT-PCR using MsRH53-F1 / R1 primers. Reference: [1] Li J, Zhang WJ, Wang T. Study on establishment of high-frequency plant regeneration system of Medicago polymorpha L. [J]. Chinese Journal of Grassland, 2014, 22(04): 834-839; [2] Wang Kexin; Liu Yanrong; Teng Fengkui; Cen Huifang; Yan Jianping; Lin Shiwen; Li Dayong; Zhang Wanjun*; Heterogeneous expression of Osa-MIR156bc increases abiotic stress resistance and forage quality of alfalfa, The Crop Journal, 2021: https: / / doi.org / 10.1016 / j.cj.2020.11.009.
[0031] PCR detection of transgenic plants: In order to detect whether the vector fragment containing the target gene is integrated into the plant genome, the CTAB method was used to extract the genomic DNA of the wild type and the resistant transgenic plant young leaves. The transgenic resistant plant DNA was used as the template, the wild type Medicago sativa plant (WT, i.e. receptor plant) was used as the negative control, and the plant expression vector was used as the positive control (+), and the MsRH53 gene specific fragment was amplified using the primers.
[0032] 35S-F2: 5’-CGCACAATCCCACTATCCTTC-3’ (SEQ ID NO. 3)
[0033] MsRH53-SalI-R: 5’-GTCGACCTAATCCCTGCCACGACGATCAC-3’ (SEQ ID NO. 4)
[0034] The identification results are as follows Figure 2As shown in part A of FIG. 8, the transgenic positive plants were amplified to obtain a band of the same size as the positive control (+), and the negative control (WT) did not amplify the target band, indicating that the vector fragment had been integrated into the plant genome. PCR detection was used to determine that 9 MsRH53 transgenic plants were obtained.
[0035] qRT-PCR detection of transgenic plants: In order to detect the expression amount of the target gene in the transgenic plants, qRT-PCR was used to detect and analyze the expression amount of the target gene in the transgenic plants. The cDNA of the transgenic PCR positive plants was used as a template, and the housekeeping gene Actin was used as an internal reference gene to detect the relative expression amount of the target gene in the transgenic plants (FIG. 8, part B). Figure 2
[0036] Quantitative primers:
[0037] MsActin-F: CAAAAGATGGCAGATGCTGAGGAT (SEQ ID NO. 5)
[0038] MsActin-R: CATGACACCAGTATGACGAGGTCG (SEQ ID NO. 6)
[0039] MsRH53-F: TTATGGTGTTGATATAGCGGTTGGTAC (SEQ ID NO. 7)
[0040] MsRH53-R: TTGTCTCTCAGTGGGTAATCTCTCC (SEQ ID NO. 8)
[0041] Example 3: Salt tolerance analysis of MsRH53 transgenic alfalfa plants
[0042] Wild type (WT) and three overexpression lines (OE9, OE8, and OE14) were propagated by stem cutting method, and 3 biological replicates were set for each line. Four-month-old plants were cultured in Hoagland's nutrient solution (catalog number: NS1010) containing 250 mM NaCl for 14 days for salt treatment, and then recovered in Hoagland's nutrient solution for 14 days. During the treatment, constant light and temperature conditions (25°C, 16 h light / 8 h dark) were maintained, and fresh solution was replaced daily to ensure stable concentration. Samples were taken before (0 d) and after (10 d) salt treatment. Under normal growth conditions, no obvious phenotypic differences were observed between the wild type (WT) and the MsRH53-OE lines, but after salt stress treatment, the wild type plant leaves wilted after 10 days of treatment, while the MsRH53-OE lines only showed slight wilting and the top was straight. After 14 days of treatment, the transgenic plants gradually wilted (FIG. 9). Figure 3 H2O2 and O 2- accumulation in MsRH53-OEs were significantly lower than that in WT Figure 3 (B).
[0043] As shown in Fig. 4A, the electrolyte permeability of leaves in MsRH53-OEs was significantly lower than that in WT Figure 4 under salt stress. The MDA content in roots and leaves of WT was significantly higher than that in MsRH53-OEs. The H2O2 content in MsRH53-OEs was significantly lower than that in WT. Meanwhile, the peroxidase (POD) activity in roots and leaves of MsRH53-OEs was significantly higher than that in WT. These results indicated that MsRH53 played a positive regulatory role in salt tolerance of Medicago sativa, which might be mainly due to the enhanced active oxygen scavenging function.
Claims
1. A gene MsRH53 that improves salt tolerance in alfalfa, characterized in that, The nucleotide sequence of the gene is SEQ ID NO.
1.
2. A salt-tolerant protein MsRH53 of Medicago sativa, characterized in that, The amino acid sequence of the salt-tolerant protein MsRH53 of Medicago sativa is SEQ ID NO.
2.
3. Vector, characterized in that The vector carries The gene according to claim 1.
4. The gene according to claim 1 is used for improving the salt tolerance of alfalfa.
5. The use according to claim 4, wherein the alfalfa is Medicago sativa.
6. The use according to claim 4 or 5, wherein the gene according to claim 1 is overexpressed in the alfalfa.
7. The use according to claim 6, wherein the overexpression is achieved by introducing an overexpression vector carrying the gene according to claim 1 into the alfalfa.
8. The use according to claim 7, wherein the overexpression vector carrying the gene according to claim 1 is introduced into the alfalfa using Agrobacterium-mediated transformation.
9. The use according to claim 4, wherein the improvement of the salt tolerance of alfalfa comprises reducing the wilting of the plant under salt-alkali stress, reducing the MDA content and electrolyte permeability in the plant under salt-alkali stress, reducing the cell membrane damage of the plant under salt-alkali stress, and / or increasing the peroxidase level in the plant under salt-alkali stress.
10. Medicago sativa, characterized in that, The gene according to claim 1 is overexpressed in the Medicago sativa.