Application of upland cotton GhMAKR1 gene in regulation and control of cotton fiber elongation and plant morphology

Abstract

The invention provides an application of a GhMAKR1 gene of upland cotton in regulation and control of cotton fiber elongation and plant morphology, 419 parts and 1081 parts of upland cotton varieties are re-sequenced and subjected to whole genome association analysis with fiber length traits, and it is found that the GhMAKR1 gene located in a D11 chromosome has significantly associated SNP and SV with the cotton fiber length. Gene overexpression and gene silencing means are used for verification and show that high expression of GhMAKR1 in a fiber development stage can significantly inhibit fiber elongation, and silencing causes fiber length increase. Meanwhile, research finds that the GhMAKR1 is used as an unknown functional protein, and overexpression of the GhMAKR1 shows a series of unique phenotypic characteristics, including dwarfing which is mainly shown in stem and internode shortening. In addition, overexpression plants also produce short and small flowers, the vigor of the flowers is reduced, and cotton bolls and seeds become small. The GhMAKR1 and the GhBIN2 protein can form an interaction compound to jointly inhibit the fiber cell elongation process.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, and particularly relates to a Gossypium hirsutum L. GhMAKR1 gene in regulating cotton fiber elongation and plant morphology. BACKGROUND

[0002] Cotton is one of the most important economic crops in the world, and China is the largest cotton producer and consumer in the world, so cotton plays an important role in agricultural economy, textile industry and international trade. Cotton fiber is an important textile and fine chemical raw material, and fiber quality directly determines its economic value. With the structural reform of China's agricultural supply side pointing out that the pursuit of high yield should be changed to taking into account yield, efficiency and quality, and the focus is on quality improvement, cultivating new varieties of high-quality cotton with "double 30" (fiber length of 30 mm, fiber strength of more than 30 cN / tex) has become a key problem that needs to be solved urgently in cotton breeding. Cotton fiber quality indicators include length, strength, fineness, maturity and uniformity, etc. more than ten indicators, among which fiber length is one of the key traits that determine cotton quality and economic benefits.

[0003] The "Green Revolution" witnessed the transformation of wheat and rice plant type. Wheat and rice varieties have been improved in plant type structure, and semi-dwarf plant type has been obtained, which is suitable for mechanical harvesting, and improves crop yield and stress resistance. Therefore, the cultivation of "ideal plant type" is crucial to improve crop yield and reduce labor costs and achieve mechanization. Cotton is an unlimited growth crop, and its plant type seriously affects the lint yield and fiber quality. Breeders regulate cotton plant type through hybridization and backcross technology to cultivate a series of new cotton varieties with high quality, high yield and stable yield. Although people have been researching the ideal plant type of cotton for many years, the process is relatively slow, the number of cloned key genes is small, and it is difficult to apply to cotton breeding. With the transfer of cotton from land to grain to dry and thin saline-alkali land in China, and the increasing demand for high-end raw cotton in the textile industry, cultivating new varieties with high yield and quality suitable for mechanization has become a major demand for the development of the cotton industry. Therefore, mining functional genes related to yield, quality and plant type is the key to cotton molecular breeding improvement, which provides strong support for ensuring the sustainable development and production safety of China's cotton industry, meeting the rapid development of the cotton textile industry and the demand for improving people's living standards.

[0004] GWAS discovers a kinase regulator gene significantly associated with Gossypium hirsutum fiber length GhMAKR1 . The gene is highly expressed during the fiber elongation stage, and is suspected to be closely related to fiber elongation. However, the similarity with the homologous gene in Arabidopsis is less than 30%, and its function has not been reported, indicating that GhMAKR1 is a new gene, which may have unique biological functions or molecular mechanisms. GhMAKR1 ​SUMMARY

[0005] To overcome the deficiencies of the prior art, the purpose of the present application is to provide a Gossypium hirsutum GhMAKR1 application of the gene in regulating cotton fiber elongation and plant morphology, by regulating the expression level of Gossypium hirsutum GhMAKR1 application of the gene in regulating cotton fiber elongation and plant morphology, by regulating the expression level of Gossypium hirsutum

[0006] To achieve the above-mentioned purpose, the present application provides the following scheme: application of the gene in regulating cotton fiber elongation and plant morphology, by regulating the expression level of Gossypium hirsutum GhMAKR1 application of the gene in regulating cotton fiber elongation and plant morphology, by regulating the expression level of Gossypium hirsutum GhMAKR1 application of the gene in regulating cotton fiber elongation and plant morphology, by regulating the expression level of Gossypium hirsutum GhMAKR1 application of the gene in regulating cotton fiber elongation and plant morphology, by regulating the expression level of Gossypium hirsutum

[0007] Preferably, GhMAKR1 The open reading frame of the gene is 537 bases in length, encoding 178 amino acids.

[0008] Preferably, the expression of the gene is increased by constructing an overexpression vector containing the coding sequence and introducing it into the cotton plant. GhMAKR1 Preferably, the overexpression vector is introduced into the cotton plant by Agrobacterium-mediated genetic transformation. GhMAKR1 Preferably, the expression of the gene is reduced by VIGS technology in the cotton plant, reducing the expression level of the gene in the plant.

[0009] Preferably, the overexpression vector is introduced into the cotton plant by Agrobacterium-mediated genetic transformation.

[0010] Preferably, the expression of the gene is reduced by VIGS technology in the cotton plant, reducing the expression level of the gene in the plant. GhMAKR1 Preferably, the change in transcription level of the gene is verified by real-time fluorescent quantitative PCR.

[0011] GhMAKR1 Preferably, the expression level of the target protein in the overexpression transgenic line is detected by Western blot.

[0012] Preferably, the transgenic cotton fiber length measured at the five to twenty days after flowering development stage is significantly different from the corresponding wild type control.

[0013] Preferably, the transgenic cotton plant obtained by the above-mentioned application comprises the expression cassette and exhibits a cotton fiber length significantly lower than that of the wild type plant.

[0014] Preferably, the transgenic cotton plant obtained by the above-mentioned application comprises the expression cassette and exhibits a cotton fiber length significantly lower than that of the wild type plant. GhMAKR1

[0015] ​​Preferably, the GhMAKR1 protein and the GhBIN2 protein form an interaction complex in the nucleus, and the existence of the complex is verified by yeast two-hybrid Y2H, BiFC (bimolecular fluorescence complementation), LUC (luciferase complementation) or GST pull-down experiment.

[0016] According to the specific embodiments of the present application, the following technical effects are disclosed: The present application associates a key gene controlling fiber elongation of Gossypium hirsutum through GWAS GhMAKR1 , and creatively finds GhMAKR1 the function of regulating cotton fiber elongation through VIGS technology and transgenic cotton with overexpression, thereby providing important gene resources for high-quality molecular breeding of cotton.

[0017] The present application can obtain transgenic cotton plants through overexpression, GhMAKR1 and the overexpression cotton lines exhibit unique phenotypes, thereby providing a new germplasm resource for cotton breeding. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application.

[0019] Figure 1 The expression pattern analysis schematic diagram provided for the embodiments of the present application is as follows: GhMAKR1 Figure 2 The schematic diagram of positioning on the nucleus and cell membrane and sequence alignment with Arabidopsis thaliana protein provided for the embodiments of the present application is as follows: GhMAKR1 Figure 3 The schematic diagram of transcription level and protein level analysis in overexpression lines and transcription level analysis in gene silencing plants provided for the embodiments of the present application is as follows: GhMAKR1 Figure 4 The schematic diagram of negative regulation of fiber elongation provided for the embodiments of the present application is as follows: GhMAKR1 Figure 5 The schematic diagram of affecting plant morphology provided for the embodiments of the present application is as follows: GhMAKR1

[0020] Figure 6 The schematic diagram of interaction between GhMAKR1 and GhBIN2 provided for the embodiments of the present application is as follows: DETAILED DESCRIPTION

[0021] ​​​​​The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of the present application.

[0022] The present application aims to provide a Gossypium hirsutum GhMAKR1 The application of the gene in regulating cotton fiber elongation and plant morphology, by regulating the expression level of the Gossypium hirsutum GhMAKR1 gene, the negative regulation of cotton fiber length is realized and the overall morphology of the plant is affected, which provides key gene resources and technical means for molecular breeding of high-quality cotton varieties.

[0023] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the present application will be further described in detail below with reference to the drawings and specific embodiments.

[0024] In this embodiment, first, the resequencing data of 419 resource materials is used to identify 1661 SNPs significantly associated with fiber length through association analysis with the fiber length trait, of which 646 are contained in At10 and 755 are contained in Dt11. Meanwhile, it is found that there are 212 SNPs in the physical interval between 24.02 Mb and 24.09 Mb in Dt11, and there are 4 genes in this interval. Further analysis finds that 3 SNP sites are associated with GhMAKR1 Meanwhile, the resequencing data of 1081 resource materials is used to analyze structural variations, and the highest association peak related to fiber length is detected in Dt11, of which 1 SV site is associated with GhMAKR1 These data suggest that the gene may affect cotton fiber length.

[0025] GhMAKR1 The open reading frame of the kinase regulator protein encoding gene is 537 bp long, encodes 178 amino acids, and the molecular weight is about 20.23 kDa. Subcellular localization analysis shows that GhMAKR1 is located in the cell nucleus and cell membrane. The protein sequence similarity of GhMAKR1 with the homologous gene in Arabidopsis is lower than 30%, and its function has not been reported, indicating that GhMAKR1 is a new gene, which may have unique biological functions or molecular mechanisms.

[0026] To clarify the role of GhMAKR1 in fiber development, this embodiment constructs the overexpression transgenic lines of the gene. qRT-PCR detection shows that in the fiber at 10 days after flowering (10 DPA), the expression level of the gene in the overexpression lines is higher than that in the wild type, and the fiber length of the overexpression lines is shorter than that of the wild type. GhMAKR1The transcription level was significantly increased by 40-60 times compared with the wild type (WT). Western blot analysis further confirmed that the target gene was successfully expressed at the protein level in the overexpression strain, and the expression amount of the gene in the gene silencing plant was significantly lower than that in the control. Fiber dynamic elongation analysis showed that during the fiber development period of 5-20 DPA and mature fiber, the fiber length of the overexpression strain was consistently shorter than that of the wild type, while the fiber length of the gene silencing plant was significantly higher than that of the wild type. It is proved that GhMAKR1 negatively regulates fiber elongation.

[0027] It is further found that GhMAKR1 affects plant development, and the plant height of the overexpression strain is consistently shorter than that of the wild type during the growth period, mainly in the shortening of stem and internode. Various developing organs also differ from the wild type, being significantly smaller than the wild type, mainly including floral organs, cotton bolls, seeds, etc. The pollen activity of the overexpression plant is lower than that of the wild type. From the cell level, it is observed that the stem cell length of the overexpression strain is significantly shorter than that of the wild type.

[0028] In order to further explore GhMAKR1 the molecular function, the CDS sequence of GhMAKR1 is connected to the pGBKT7 vector as a bait to screen interacting proteins with yeast two-hybrid (Y2H) using a cotton fiber yeast library as prey. A candidate interacting protein, named GhBIN2 (GSK3-like protein), is identified through screening. It has been reported in the literature that GhBIN2 plays a negative regulatory role in fiber development, and also regulates cotton plant type development. In order to verify the interaction between GhMAKR1 and GhBIN2, this embodiment uses double-molecular fluorescence complementation (BiFC), double-fluorescent luciferase complementation (LUC) and GST pull-down experiments to verify that there is an interaction between GhMAKR1 and GhBIN2, indicating that they may act together as part of a cotton fiber development regulation complex.

[0029] The biological materials used in this embodiment are introduced as follows: Escherichia coli Trans1-T1 was purchased from Beijing Zison Bio-technology Co., Ltd., with the item number CD501; Agrobacterium GV3101 was purchased from Shanghai Weidi Biological Technology Co., Ltd., with the item number AC1001; pGreen-GFP vector was used for transient expression of green fluorescent protein in tobacco, pGBKT7 and pGADT7 vectors were used for yeast two-hybrid verification test, and pGreenII0800-Luc vector was used for transient expression of LUC in tobacco, all of which were preserved in the laboratory in the early stage.

[0030] The nucleotide sequences and amino acid sequences of the genes used in this embodiment are as follows: GhMAKR1 Coding sequence: ATGGCATGCTTAGACATGTATAATTCGGAGCACAAAGGTCATCATCATCACTGCCCCCCAATGAGTCCAAGAATCTCATTCTCAAATGATTTTGCTGAGACTCAGCAGGTTATGAAGCAAGAGAGGAACTCAAGGGAGGCTCCAGTGTCGTCAGACTTTGAATTCTCAGTATCAAACTACTCCATGATGAGTGCTGATGAGCTTTTCTTTAAGGGTAAGCTTTTGCCATTTAAAGATAATTGTAACAATCAAATGCAAAGGACTTTGAGGGAAGAGCTTCTTGCTGGAGATGATGATGATAATAATGTGACACTAACGCCTCCTAAGGGTTCCACAAGGTGGAAGGGATTTCTGGGGCTCAAGAGAACCCACATTGGTTCCAAAAAAGCTGATAAGATTAATGAAGTGTCCATGGAGAGAATGGGTGACAATAAAAGGTTTGCTTTTGTTCATGAGGACACCCATGTCGTCAAAACTTCACAGGAACTTTTGACTGAAGGAGGGTCAGGTTGCAGGAATGTGGAGATTGGAATATAG GhMAKR1 amino acid sequence: MACLDMYNSEHKGHHHHCPPMSPRISFSNDFAETQQVMKQERNSREAPVSSDFEFSVSNYSMMSADELFFKGKLLPFKDNCNNQMQRTLREELLAGDDDDNNVTLTPPKGSTRWKGFLGLKRTHIGSKKADKINEVSMERMGDNKRFAFVHEDTHVVKTSQELLTEGGSGCRNVEIGI Example 1, GhMAKR1 Correlation with fiber elongation To clarify the tissue expression pattern of this gene, qRT-PCR was performed in root, stem, leaf, flower, sepals, petals and fiber at different developmental stages and ovule. It was found that this gene was highly expressed in fiber, especially in fiber at 10 and 15 days after flowering (as shown in part of Figure 1 Table 1). It was shown that GhMAKR1 may play a key role in fiber elongation or even secondary wall thickening.

[0031] GhMAKR1Encoding a kinase regulatory factor protein, GhMAKR1 has an open reading frame of 537 bp, consisting of a 178-amino acid sequence, and a molecular weight of approximately 20.23 kDa. Subcellular localization analysis showed that GhMAKR1 is located in the nucleus and cell membrane. Figure 2 (As shown in Part A). GhMAKR1 shares less than 30% similarity with homologous genes in Arabidopsis thaliana. Figure 2 As shown in Part B), and its function has not yet been reported, indicating that GhMAKR1 It is a new gene that may have unique biological functions or molecular mechanisms.

[0032] Example 2 GhMAKR1 Negative regulation of fiber elongation To clarify GhMAKR1 To investigate the role of this gene in fiber development, this example constructed a transgenic line overexpressing this gene. qRT-PCR analysis showed that, 10 days post-flowering (10 DPA), the overexpressing line... GhMAKR1 Transcription levels were significantly increased by 40-60 times compared to wild-type (WT) (e.g. Figure 3 As shown in Part A), Western blot analysis further confirmed that the target gene in the overexpression line could be successfully expressed as a protein (e.g., Figure 3 (As shown in Part B). Using VIGS technology, GhMAKR1 was silenced in cotton plants; the whitening marker indicated the success of the silencing effect (e.g., ...). Figure 3 (As shown in section C), and the expression level of 10 DPA fiber samples was detected. It was found that the expression level of this gene in gene-silenced plants was significantly lower than that in the control (e.g., Figure 3 (As shown in section D). Fiber dynamic elongation analysis showed that during fiber development and maturation at 5-20 DPA, the fiber length of the overexpressing lines was consistently shorter than that of the wild type, while the mature fiber length of the gene-silenced plants was significantly longer than that of the wild type, confirming... GhMAKR1 Negative regulation of fiber elongation ( Figure 4 ).

[0033] Example 3 GhMAKR1 Affects plant growth and development Further discoveries GhMAKR1 It affects plant development; during the growth period, the plant height of overexpressing lines is consistently shorter than that of the wild type, mainly manifested in the shortening of stems and internodes (e.g., Figure 5 (As shown in Part A). Various developmental organs also differ from the wild type, being significantly smaller, mainly including floral organs, bolls, and seeds (e.g., ...). Figure 5 (As shown in the BE section). The pollen activity of the overexpressing plants was reduced compared to the wild type (e.g., Figure 5 (As shown in section F). At the cellular level, the stem cell length of the overexpression line was significantly shorter than that of the wild type (e.g., ...). Figure 5(As shown in section G).

[0034] Example 4: The interaction between GhMAKR1 and GhBIN2 jointly inhibits fiber development. To explore further GhMAKR1 The molecular function, in this embodiment will GhMAKR1 The CDS sequence was ligated into the pGBKT7 vector as bait, and a cotton fiber yeast library was used as prey for screening interacting proteins using yeast two-hybrid Y2H. A candidate interacting protein was identified through screening and named GhBIN2 (a GSK3-like protein). Previous literature reports... GhBIN2 It plays a negative regulatory role in fiber development and also affects cotton plant architecture development. To verify the interaction between GhMAKR1 and GhBIN2, GhBIN2 The CDS sequence was ligated into the pGADT7 vector, and this vector, along with the GhMAKR1 recombinant vector ligated into the pGBKT7 vector, was co-transformed into Y2H-gold cells. The cells were cultured on SD / -Leu / -Trp / -His / -Ade medium. Results showed that colonies grew on the positive control pGBKT7-53+pGADT7-T plate, indicating the effectiveness of the yeast experimental system. However, no colonies grew on the negative control pGBKT7-lam+pGADT7-T, pGBKT7-GhMAKR1+pGADT7-T, and pGBKT7+pGADT7-GhBIN2 plates, while colonies grew on pGBKT7-GhMAKR1+pGADT7-GhBIN2, indicating an interaction between GhMAKR1 and GhBIN2 (e.g.,...). Figure 6 (As shown in Part A of the middle section).

[0035] To further verify whether the interaction between GhMAKR1 and GhBIN2 exists in plants, this example performed a bimolecular fluorescence complementation (BiFC) experiment in tobacco leaves. The results showed that when the GhMAKR1-nYFP and GhBIN2-cYFP fusion proteins were co-expressed in the lower epidermal cells of tobacco leaves, YFP fluorescence could be observed in the cell nucleus and cell membrane. This fluorescence signal confirms the physical interaction between GhMAKR1 and GhBIN2 in the cell nucleus and cell membrane (e.g., Figure 6 (As shown in Part B); The Dual-Luciferase Complementation Assay (LUC) also yielded similar results (e.g., ...). Figure 6In addition, the GST-labeled GhMAKR1 protein was co-incubated with the His-labeled GhBIN2 protein, the unbound protein was washed away, and the beads were boiled for SDS-PAGE electrophoresis. It was found that the GST-GhMAKR1 successfully pulled down the His-GhBIN2 protein, indicating that there was specific and direct interaction between the two proteins (as shown in part C of FIG. 6). Figure 6

[0036] Based on the results of Y2H, BiFC, LUC and Pull-down experiments, it is shown that there is interaction between GhMAKR1 and GhBIN2, which indicates that they may play a role in fiber development as part of the cotton fiber development regulatory complex.

[0037] The embodiments in the specification are described in a progressive manner, and each embodiment focuses on the difference from other embodiments. The same or similar parts between the embodiments can be referred to each other. For the system disclosed in the embodiments, the description is relatively simple because it corresponds to the method disclosed in the embodiments. The relevant parts can be referred to the description of the method.

[0038] The principles and implementation manners of the present application are described by using specific examples in the specification. The above description of the embodiments is only used to help understand the method of the present application and its core idea. For those skilled in the art, the specific implementation manners and application scope can be changed according to the idea of the present application. In summary, the content of the specification should not be understood as a limitation of the present application.​

Claims

1. A Gossypium hirsutum GhMAKR1 gene in regulating cotton fiber elongation and plant morphology, characterized in that, By increasing GhMAKR1 gene expression levels decrease cotton fiber length, by decreasing GhMAKR1 gene expression increases cotton fiber length, while overexpression GhMAKR1 exhibit a range of unique phenotypic characteristics, including shortened stems and internodes, produce small flowers, which have reduced vigor, and smaller bolls and seeds.

2. Use according to claim 1, characterized in that, GhMAKR1 The open reading frame of the gene is 537 bases in length, encoding 178 amino acids, which is improved GhMAKR1 Gene expression is achieved by constructing an overexpression vector containing GhMAKR1 The coding sequence and introducing into cotton plants.

3. Use according to claim 2, characterized in that, Wherein the overexpression vector is introduced into cotton by Agrobacterium-mediated genetic transformation.

4. Use according to claim 1, characterized in that, wherein the reduction GhMAKR1 Gene expression was achieved in vivo in cotton by VIGS technology.

5. Use according to claim 4, characterized in that, wherein said gene silencing results in GhMAKR1 reduced expression in cotton plants.

6. Use according to any one of claims 2 to 5, characterized in that, Verification was performed using real-time quantitative PCR. GhMAKR1 The transcriptional level changes were investigated, and Western blot was used to verify the protein level of the target gene expression in the overexpression transgenic lines.

7. Use according to any one of claims 2 and 3, characterized in that, The transgenic cotton fiber length measured at the development stage of five to twenty days after flowering is significantly different compared with the corresponding wild type control.

8. A transgenic cotton plant obtained by the use as claimed in claims 2 and 3, characterized by, The plants comprise GhMAKR1 The expression cassette and exhibit significantly shorter cotton fiber length than wild-type plants, while also exhibiting a series of unique phenotypic characteristics, including shortened stems and internodes, production of small flowers, bolls, and seeds, and significantly decreased pollen viability.

9. Use according to claims 4 and 5 to obtain a gene silenced plant, characterized by Plants with reduced expression of GhMAKR1 exhibit significantly higher fiber length than wild-type plants.

10. Use according to any one of claims 1 to 4, characterized in that, GhMAKR1 protein and GhBIN2 protein form an interaction complex in the nucleus, and the presence of the complex is verified by yeast two-hybrid Y2H, bimolecular fluorescence complementation BiFC, dual luciferase complementation LUC or GST pull-down experiment.

Images