Amplification-free telomere length detection method and kit

Abstract

The invention belongs to the technical field of nucleic acid detection, and particularly relates to an amplification-free telomere length detection method and a kit. The invention provides an amplification-free telomere length detection method. The amplification-free telomere length detection method comprises the following steps: (1) obtaining a genome DNA sample from a sample to be detected; (2) contacting the genome DNA sample with a cascade signal amplification system to generate a detectable fluorescence signal; and (3) collecting a fluorescence signal, and calculating the total length or relative length of the telomere according to the established standard curve. The method does not need complex amplification steps, the detection process can be carried out at a constant temperature, the result is more stable, the repeatability is good, and the method is suitable for POCT application.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of nucleic acid detection, and particularly relates to a non-amplification telomere length detection method and kit. BACKGROUND

[0002] Telomere is a special structure composed of repetitive DNA sequences and special telomere binding proteins at the end of eukaryotic cell chromosomes. Although eukaryotes show diversity in evolution, the telomere structure is relatively conserved. The telomere sequence of human and other vertebrates has a repeat unit of TTAGGG. Telomeres can prevent degradation, fusion and rearrangement of chromosome ends, thereby maintaining the independence, integrity and stability of chromosomes. Although telomeres do not have coding functions, scientists call them “life clock”. In 1992, Herley CD proposed the telomere hypothesis, which believes that telomeres at the ends of chromosome arms are constantly shortened with cell division. When the telomere length is shortened to a certain threshold, the cell will be unable to continue to divide and enter death. Therefore, the telomere length has been considered an important indicator of human function, an important “mitotic clock” or “molecular clock”, which is closely related to health status, aging degree, tumor occurrence, etc. Therefore, establishing a general high-throughput telomere length detection method will greatly help in preventing aging and cancer intervention.

[0003] The method for measuring telomere length was first proposed by Harley et al. in 1990, that is, the length of terminal restriction fragment (TRF) is measured by Southern blot. Although the process is complicated and a large amount of DNA is required, it is still the "gold standard" for measuring telomere length. Subsequently, quantitative fluorescence in situ hybridization (Q-FISH) and flow fluorescence in situ hybridization (Flow-FISH) were proposed, but the comprehensive application was not high enough. In 2002, Cawthon Igl first proposed a method for measuring the relative length of telomere by fluorescence quantitative PCR, that is, the average telomere length is reflected by calculating the ratio of telomere copy number (T) to single copy gene copy number (S), but the amplification of telomere DNA and single copy gene in the method is carried out in different reaction tubes. The difference in the starting amount of template has an important influence on the variation of the results. In order to solve this problem, in 2009, Cawthon Igl also proposed a single-color multiplex quantitative PCR method (MMQPCR). The method has certain requirements for fluorescence quantitative PCR instrument, that is, it can collect SYBR Green fluorescence signal twice in one cycle, but the ABI series such as 7900HT and 7700 used in many domestic and foreign laboratories do not have this function. However, the method of fluorescence quantitative PCR can only evaluate the average telomere length like TRF, and the difference between samples and samples is still relatively high, and the results obtained by different laboratories are quite different. The coefficient of variation of TRF method is 1.74%, and the coefficient of variation of qPCR method is 6.45%, which shows that the accuracy and stability of qPCR method for analyzing telomere length are not high. At the same time, PCR is easily affected by exogenous DNA pollution, and requires a strict experimental operation environment, which limits its wide application in low-resource environment; at the same time, the inhibitory substances existing in complex samples may still interfere with the PCR reaction, and the further optimization of sample pretreatment and reaction system is still a problem to be solved. In addition, primer design, reaction system optimization and fluctuation of amplification efficiency may affect the accuracy of the detection results. SUMMARY

[0004] In order to solve the above problems, the present application provides a non-amplification telomere length detection method, which comprises the following steps: (1) obtaining a genomic DNA sample from a sample to be tested; (2) contacting the genomic DNA sample with a cascade signal amplification system to produce a detectable fluorescence signal; (3) collecting the fluorescence signal, and calculating the total length of telomere according to the established standard curve; In step (2), The cascade signal amplification system comprises a telomere probe capable of binding to a telomere repeat sequence, a nuclease and a reporter molecule, The nuclease comprises a primary nuclease or a secondary nuclease, when the genomic DNA sample is contacted with a cascade signal amplification system, the telomere probe capable of binding to the telomere repeat sequence binds to the telomere repeat sequence and forms a structure recognizable by a primary nuclease, the primary nuclease recognizes the structure recognizable by the primary nuclease and generates a cut at the structure, thereby generating a trigger fragment, the trigger fragment causes the reporter molecule to be cut by the primary nuclease or the secondary nuclease, thereby generating a detectable fluorescent signal.

[0005] Further, the telomere repeat sequence is TTAGGG.

[0006] Further, the telomere probe is capable of binding to one or more of the telomere repeat sequences.

[0007] Further, the secondary signal amplification system includes but is not limited to one or more of the following: a cascade nucleic acid invasion reaction system, a PfAgo signal amplification system, a CRISPR collateral cleavage system, a DNAzyme / RNAzyme system, a hairpin chain reaction system, or a cascade hybridization chain reaction system.

[0008] Further, the primary nuclease or the secondary nuclease is selected from but not limited to one or more of the following: an AP site cleavage enzyme, a mismatch recognition endonuclease, a damaged base cleavage enzyme, a flap structure recognition enzyme, an RNA-DNA hybridization recognition enzyme, an Argonaute nuclease, a PfAgo endonuclease, a CRISPR-Cas nuclease, APE 1, a mismatch endonuclease I, a T7 endonuclease I, an endonuclease III (Nth), a Tma endonuclease III, an endonuclease IV, an endonuclease V, a T4 PDG, an endonuclease VIII, an endonuclease Q, FEN1, Fpg, hAAG, hSMUG1, RNase H, OGG, Uracil-DNA glycosylase (UDG), USER.

[0009] Further, the reporter molecule comprises a fluorescent group and a quenching group, and the cutting of the reporter molecule causes the fluorescent group and the quenching group to separate, thereby generating a detectable fluorescent signal.

[0010] Further, the detection method further comprises simultaneously detecting the copy number of a reference gene to calculate the amount of sample added to the reaction system, which comprises using a detection probe and a reporter molecule for the reference gene, wherein the fluorescent group contained in the reporter molecule for the reference gene is different from the fluorescent group contained in the reporter molecule used for telomere length detection.

[0011] Further, the fluorescent group includes, but is not limited to, any one or more of FAM, HEX, ROX, CY5; and the quenching group includes, but is not limited to, any one or more of BHQ1, BHQ2, BHQ3.

[0012] In some embodiments, the cascade signal amplification system is a cascade nucleic acid invasion reaction system.

[0013] Further, the telomere probe capable of binding to the telomere repeat sequence is an upstream probe and a downstream probe, which bind to the telomere repeat sequence to form a three-base overlapping invasion structure, i.e., a flap structure.

[0014] Further, the structure recognizable by the primary nuclease is a flap structure.

[0015] Further, the nuclease includes a primary nuclease, and the primary nuclease is a FEN1 enzyme.

[0016] Further, the reporter molecule recognizes and binds to the trigger fragment to form a flap structure recognizable and cleaved by the FEN1 enzyme.

[0017] Further, the cleavage of the reporter molecule causes the fluorescent group contained therein to separate from the quenching group, thereby generating a detectable fluorescent signal.

[0018] In some embodiments, the cascade signal amplification system is a PfAgo signal amplification system Further, the telomere probe capable of binding to the telomere repeat sequence contains an AP site.

[0019] Further, the structure recognizable by the primary nuclease is an AP site in the double strand formed by the telomere probe and the target sequence.

[0020] Further, the primary nuclease is an APE1 enzyme.

[0021] Further, the secondary nuclease is a PfAgo enzyme.

[0022] Further, the trigger fragment serves as a gDNA guide sequence for the PfAgo enzyme to cleave the reporter molecule.

[0023] Further, the establishment of a standard curve is well known to those skilled in the art, for example, the method described in the present application can be performed using nucleic acid samples with different known telomere lengths, and the fluorescent signal is recorded to establish a standard curve.

[0024] The present application also provides a non-amplification telomere length detection kit, which comprises: (1) a telomere probe capable of binding to a telomere repeat sequence; (2) a nuclease; (3) a reporter molecule; (4) a reaction buffer.

[0025] Further, the kit also includes a detection probe for an internal reference gene and a reporter molecule such as a fluorescent probe.

[0026] Advantages of the present application The present application provides a simple new method for telomere length detection based on nucleic acid hybridization and fluorescence signal amplification system. Since this method does not use PCR technology, it does not involve the process of amplifying the telomere template, and directly hybridizes the telomere template. The results after hybridization are connected with the fluorescence signal amplification system, and the data are read by a fluorescence enzyme label instrument or any instrument that can read fluorescence (such as a conventional PCR instrument). According to the standard curve, the telomere length can be calculated, and the relative length can also be calculated. At the same time, it is calibrated by an internal reference gene. This method does not require complex amplification steps, so that the detection process can be carried out at constant temperature, the results are more stable, the repeatability is good, and it is suitable for POCT application. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 An overview of the amplification-free telomere length detection mechanism of the present application is shown.

[0028] Figure 2 The results of the fluorescence signal intensity change with time for the amplification-free detection of different concentrations of target nucleic acids in Example 1 are shown.

[0029] Figure 3 The results of the fluorescence signal intensity change with time for the amplification-free telomere detection of different concentrations of genomic DNA in Example 3 are shown, as well as the linear relationship between the fluorescence intensity and the sample concentration.

[0030] Figure 4 The results of the fluorescence signal intensity change with time for the amplification-free internal reference gene detection of different concentrations of genomic DNA in Example 4 are shown, as well as the linear relationship between the fluorescence intensity and the sample concentration. DETAILED DESCRIPTION

[0031] The amplification-free nucleic acid detection method of the present application is generally achieved by cascade signal amplification: for example, cascade nucleic acid invasion reaction is a signal amplification method that uses 5' exonuclease or flap endonuclease to specifically recognize the single-base invasion structure formed between DNA strands, and performs enzyme cutting at the invasion base position. By cascading two-step cascade nucleic acid invasion reaction, 10 7The secondary cascade nucleic acid invasion reaction has no relation with the target sequence and can be used as a universal detection. In addition to the cascade nucleic acid invasion reaction, the SHERLOCK and DETECTR technologies based on CRISPR-Cas enzyme, the Argonaute nuclease-mediated amplification-free nucleic acid detection technology and the like have a universal secondary amplification process and exhibit high sensitivity. The primary reaction is sequence recognition specific to the target sequence, and the key to determining the high specificity of detection is to cut the specific product to trigger the secondary reaction. The fragment capable of triggering the secondary reaction is not limited to the methods mentioned above, but can also be obtained by AP site cleavage enzyme, special structure cleavage enzyme and mismatch recognition cleavage enzyme (for example: APE 1, Mismatch Endonuclease I, T7 Endonuclease I, Endonuclease III (Nth), Tma Endonuclease III, Endonuclease IV, Endonuclease V, T4 PDG, Endonuclease VIII, Endonuclease Q, FEN1, Fpg, hAAG, hSMUG1, RNase H, OGG, Uracil-DNA Glycosylase (UDG), USER) to catalyze the enzyme cutting. We can couple the method capable of obtaining the triggering of the secondary reaction with the universal secondary signal amplification system, and of course the secondary signal system can be coupled to realize the tertiary signal amplification, so that a more sensitive and diverse nucleic acid template direct detection technology method can be obtained.

[0032] For detecting low copy templates, the method of the present application can be combined with PCR amplification to improve the detection sensitivity. For high copy sequences, not only including highly repetitive telomeres, but also short tandem repeat sequences or scattered highly repetitive rDNA, Alu and the like, the method of the present application can directly detect without the need for an amplification step.

[0033] Cascade nucleic acid invasion reaction In one specific embodiment, the present application provides an amplification-free telomere length detection method which utilizes a cascade nucleic acid invasion reaction to realize primary sequence-specific cleavage and secondary universal signal amplification.

[0034] In such embodiments, the cascade nucleic acid invasion reaction generally involves the upstream probe and the downstream probe labeled with a flap sequence to form a three-base overlap invasion structure under the guidance of the target. The FEN1 enzyme is precisely cut by structure-specific recognition, generating a flap fragment with a single-base end. After the amplification ends, the free flap fragment binds to the fluorescent probe through base complementary pairing, again forming an invasion structure. The FEN1 enzyme specifically cuts this structure, separating the fluorescent group from the quencher group, thereby completing the secondary cascade nucleic acid invasion reaction.

[0035] As an example, the cascade nucleic acid invasion reaction can include an upstream probe UP, a downstream probe DP, a nuclease, and a hairpin probe HP, wherein the upstream probe UP and the downstream probe DP are designed according to the sequence of the target, the Tm value of the upstream probe is higher than the temperature of the cascade nucleic acid invasion reaction, and the 3' end contains an invasion base that is not complementary to the target; and the Tm value of the downstream probe is close to the temperature of the cascade nucleic acid invasion reaction, and the 5' end contains a flap fragment, and the 3' end is phosphorylated (-PO3). When UP and DP are hybridized to the target at the same time, a three-base overlap structure is formed, which is recognized and cut by the nuclease to cut the flap fragment of DP, causing DP to dissociate due to the decrease in Tm, and then new DP binds to the target, and this cycle continues until DP is completely consumed. The released flap fragment further invades the universal hairpin probe, again forming a three-base structure and triggering nuclease cleavage, achieving signal cascade amplification.

[0036] Secondary amplification system based on Argonaute nuclease In a specific embodiment, the present application provides a non-amplification telomere length detection method, which uses a PfAgo signal amplification system to achieve primary sequence-specific cleavage and secondary universal signal amplification.

[0037] In such embodiments, a primary probe containing an AP site is first used to specifically recognize the telomere sequence, and then the AP site is cut by the APE1 enzyme to release a nucleic acid fragment that can be used as a gDNA guide sequence for the PfAgo nuclease. The PfAgo nuclease activated by gDNA then cuts the fluorescent probe, emitting a fluorescent signal, thereby achieving signal cascade amplification.

[0038] The present application will be further described in conjunction with specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present application are conventional reagents, methods, and equipment in the technical field.

[0039] Example 1: Use of a two-step nucleic acid invasion signal amplification reaction detection method to achieve sensitive detection of an artificial synthetic oligonucleotide fragment This embodiment tested different concentrations of artificially synthesized single-stranded DNA targets to verify the feasibility of the nucleic acid detection method described in this invention and to examine the sensitivity of the method. Reaction conditions: The reaction system included: 10 mM MOPS (pH 7.5), 0.05% Tween-20, 0.05% Nonidet P-40 (NP-40), 4% polyethylene glycol (PEG), 100 mM KCl, 6-12 mM MgSO4, 2-4 U FEN1 enzyme, upstream intrusion probe 1 (GtaacggcagacttctcctcaggagtA) 0.02-0.08 µM, and downstream detection probe 2 (cCTCCGCCCCTAACagatgcaccatggtgtc) -[C6NH2]) 0.5-1.0µM, universal probe 3 (FAM-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGAGTTAGGGGCGGAGg) 0.3-1µM, and synthesized single-stranded template (CCTCTGGGTCCAAGGGTAGACCACCAGCAGCCTAAGGGTGGGA) at different concentrations were added to 1µL, and water was added to make up the system to 20µL. Reaction conditions: 63 degrees Celsius for 60 minutes, with fluorescence collected once per minute. The instrument used in this example was a SLAN96P real-time fluorescence PCR instrument (Shanghai Hongshi Medical Technology Co., Ltd.).

[0040] The results of Example 1 are shown in Appendix Figure 2 middle. Figure 2 The results showed that the method described in this invention selected the fluorescence signal at 60 minutes in the absence of the target nucleic acid as the baseline. Based on whether there was a significant difference between the fluorescence signal generated by different concentrations of DNA target and the baseline signal, it can be concluded that the detection limit of the method described in this invention for the artificially synthesized oligonucleotide fragment used is 5 pM, and the sensitivity should meet the requirements for the direct detection of multicopy genes such as telomeres.

[0041] Example 2: Sensitive detection of artificially synthesized oligonucleotide fragments by coupling APE1 enzyme with a universal PfAgo signal amplification system. This embodiment tested different concentrations of artificially synthesized single-stranded DNA targets to verify the feasibility of the nucleic acid detection method described in this invention and to examine the sensitivity of the method. Reaction conditions: The reaction system comprises: 10x reaction buffer, probe 4 (TTAGGGTTAGGGTTAGGGTTAGGG, the underlined is a depyrimidinyl base) 0.02-0.08 µM, APE1 0.5mU-1U, different concentrations of single-stranded template 1ul, after 20 minutes of reaction at 42 degrees, 10ul PfAgo signal amplification system is added: 20mM HEPES pH 7.5, 250mM NaCl, 2.5-5mM MnCl2, 200-500nM PfAgo, 200-500nM probe 5 (FAM-TTCCCTAACCCTAACCCTAATT-BHQ1). The reaction condition is: 60 minutes of reaction at 90 degrees, fluorescence is collected once per minute, and the instrument used in this embodiment is SLAN96P fluorescent real-time PCR instrument (Shanghai Hongshi Medical Technology Co., Ltd.).

[0042] The results of example 2 are similar to the results of example 1, and the single-stranded template of 5pM can also be detected.

[0043] Example 3: Coupling of APE1 enzyme and universal PfAgo signal amplification system to realize accurate detection of genome telomere sequence length The reaction system and reaction condition are the same as those in example 2, the sample is human peripheral blood genome DNA extracted by a kit, and 16, 8, 4, 2 and 1ng of five doubling dilution concentrations are used, and three repeats are made for each concentration, and the results are shown in the following table: Figure 3 It can be seen that there is a very good linear relationship between the fluorescence value and the sample concentration, and the correlation coefficient R 2 is 0.998. If a synthetic known length plasmid is used for a standard curve, the total length of the telomere of the sample to be tested can be directly read.

[0044] Example 4: Based on example 1 or 2, the telomere length and internal reference gene copy number can be simultaneously detected in the same reaction system.

[0045] The reaction system and reaction condition are the same as those in example 1 or 2, the telomere selects the FAM channel, and the internal reference selects the ROX channel. 20 blood samples of different ages are mixed and genome DNA is extracted by a kit, and 16, 8, 4, 2 and 1ng of five doubling dilution concentrations are used, and three repeats are made for each concentration to make a standard curve, and four different age samples are simultaneously tested. This experiment is independently repeated three times.

[0046] The results show that the telomere length and internal reference copy number have a linear relationship with the fluorescence value, and the R2 of the standard curve of the five points is all above 0.9 ( Figure 3 , Figure 4). The sample concentration was calculated according to the average value of the ROX channel fluorescence value of the sample minus the water control fluorescence value, and the sample concentration was brought into the standard curve formula of the telomere to calculate the theoretical telomere fluorescence value. Finally, the relative standard telomere length (T / R) value can be obtained by the actual telomere fluorescence value / theoretical telomere (FAM) channel fluorescence value (Tables 1-3). Three repeated experiments show that the repeatability of the telomere detection method described in the present application is very good, and the CV value is between 1.06-3.27 (see Table 4).

[0047]

[0048]

[0049]

[0050]

[0051] It should be noted that the specification and drawings of the present application give the preferred embodiments of the present application, but the present application can be realized in many different forms, and is not limited to the embodiments described in the specification, and these embodiments are not additional limitations on the content of the present application, and the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive. Furthermore, the above technical features continue to combine, form various embodiments not listed above, which are considered to be within the scope of the present application; further, for those skilled in the art, the above description can be improved or changed, and all these improvements and changes should be within the scope of protection of the appended claims of the present application.

Claims

1. A method for telomere length detection without amplification, characterized by, The method comprises the following steps: (1) obtaining a genomic DNA sample from a sample to be tested; (2) contacting the genomic DNA sample with a cascade signal amplification system to generate a detectable fluorescent signal; (3) collecting the fluorescent signal and calculating the total length or relative length of telomeres according to an established standard curve; wherein in step (2), the cascade signal amplification system comprises a telomere probe capable of binding to a telomere repeat sequence, a nuclease, and a reporter molecule, the nuclease comprises a primary nuclease or a secondary nuclease, when the genomic DNA sample is contacted with the cascade signal amplification system, the telomere probe capable of binding to the telomere repeat sequence binds to the telomere repeat sequence and forms a structure that can be recognized by the primary nuclease, the primary nuclease recognizes the structure that can be recognized by the primary nuclease and generates a cut at the structure, thereby generating a trigger fragment, the trigger fragment causes the reporter molecule to be cut by the primary nuclease or the secondary nuclease, thereby generating a detectable fluorescent signal.

2. The detection method according to claim 1, characterized in that, The telomere repeat sequence is TTAGGG; Further, the telomere probe is capable of binding to one or more of the telomere repeat sequences.

3. The method of claim 1, wherein The cascade signal amplification system comprises one or more of the following: a cascade nucleic acid invasion reaction system, a PfAgo signal amplification system, a CRISPR collateral cleavage system, a DNAzyme / RNAzyme system, a hairpin chain reaction system, or a cascade hybridization chain reaction system.

4. The method of claim 1, wherein The primary nuclease or secondary nuclease is selected from one or more of the following: an AP site cleavage enzyme, a mismatch recognition endonuclease, a damaged base cleavage enzyme, a flap structure recognition enzyme, an RNA-DNA hybrid recognition enzyme, an Argonaute nuclease, a PfAgo endonuclease, a CRISPR-Cas nuclease, APE 1, mismatch endonuclease I, T7 endonuclease I, endonuclease III (Nth), Tma endonuclease III, endonuclease IV, endonuclease V, T4 PDG, endonuclease VIII, endonuclease Q, FEN1, Fpg, hAAG, hSMUG1, RNaseH, OGG, Uracil-DNA glycosylase (UDG), USER.

5. The method of claim 1, wherein The reporter molecule comprises a fluorescent group and a quenching group, and the cleavage of the reporter molecule causes the fluorescent group and the quenching group to separate, thereby generating a detectable fluorescent signal.

6. The method of claim 1, wherein, The detection method further comprises simultaneously detecting the copy number of a reference gene to calculate the relative length of telomeres.

7. The method of claim 1, wherein, The cascade signal amplification system is a cascade nucleic acid invasion reaction system; The telomere probe capable of binding to the telomere repeat sequence is an upstream probe and a downstream probe, which bind to the telomere repeat sequence to form a three-base overlapping invasion structure, i.e., a flap structure; The structure that can be recognized by the primary nuclease is a flap structure; The nuclease comprises a primary nuclease, and the primary nuclease is a FEN1 enzyme; The reporter recognizes and binds the trigger fragment to form a flap structure that can be recognized and cleaved by FEN1 enzyme.

8. The method of claim 1, wherein, The cascade signal amplification system is a PfAgo signal amplification system; The telomere probe capable of binding to the telomere repeat sequence comprises an AP site; The structure that can be recognized by the primary nuclease is an AP site in the double strand formed by the telomere probe and the target sequence; The primary nuclease is an APE1 enzyme; The secondary nuclease is a PfAgo enzyme; The trigger fragment serves as a gDNA guide sequence for the PfAgo enzyme to cleave the reporter.

9. An amplification-free telomere length detection kit, characterized by, Comprise: (1) a telomere probe capable of binding to a telomere repeat sequence; (2) a nuclease; (3) a reporter; (4) a reaction buffer.

10. The kit of claim 9, wherein Also include a detection probe and a fluorescent probe for the internal reference gene.

Images