Targeted sequencing primer composition and kit for tuberculosis-related pathogens

Abstract

The invention discloses a targeted sequencing primer composition for tuberculosis-related pathogens and a kit. The invention provides a mycobacterium tuberculosis targeting sequencing primer composition aiming at tuberculosis pathogens on the basis of a pathogen targeting sequencing technology. On the basis, a reliable basis is provided for better distinguishing tuberculosis from a'tuberculosis-like 'disease and clinical diagnosis and treatment of tuberculosis, non-tuberculosis mycobacteria and other pathogens capable of causing symptoms similar to tuberculosis after infection are incorporated, and a corresponding targeted sequencing primer composition and a kit are provided. The pathogens detected by the targeted sequencing primer composition and the kit for tuberculosis-related pathogens are relatively comprehensive, rapid and accurate screening and detection of mycobacterium tuberculosis and nontuberculosis mycobacterium infection are facilitated, and reliable basis can be provided for diagnosis and treatment of tuberculosis and other infection similar to tuberculosis; the important clinical significance is realized.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of gene detection services. More particularly, it relates to a target sequencing primer composition and kit for tuberculosis-related pathogens. BACKGROUND

[0002] Tuberculosis-related infection is one of the common lung diseases, mainly caused by Mycobacterium tuberculosis complex (MTBC) and non-tuberculous mycobacteria (NTM). Tuberculosis is still one of the top 10 fatal infectious diseases in the world, which seriously endangers human health, and accurate detection and diagnosis of tuberculosis are needed.

[0003] Non-tuberculous mycobacteria refers to all mycobacteria other than Mycobacterium tuberculosis complex and Mycobacterium leprae. The lung image of non-tuberculous mycobacterial infection is the same as that of tuberculosis, but the treatment plans are different, and accurate distinction is needed to adopt targeted treatment plan for timely and effective treatment. In addition to non-tuberculous mycobacteria, other pathogens can also cause symptoms similar to tuberculosis, leading to misdiagnosis. Such as Acinetobacter baumannii, Burkholderia mallei, etc. bacteria, Candida albicans, Nakamura glabrate and some DNA viruses and parasites.

[0004] Compared with culture method, morphological detection method and immunological detection method, nucleic acid detection better balances cost, detection speed and detection performance, and becomes the mainstream pathogen detection method. However, traditional nucleic acid detection technologies such as fluorescent PCR gradually cannot meet the detection needs of complex infections in clinic, and there are some shortcomings such as less types and quantity of detected pathogens, inability to cope with complex clinical infections, and difficulty in providing coherent diagnosis and medication guidance.

[0005] Pathogen-targeted sequencing (tNGS) is a new generation of sequencing technology based on ultra-multiplex PCR amplification (or target capture) and high-throughput sequencing. This technology does not rely on traditional microbial culture, can directly enrich dozens to hundreds of known pathogenic microorganisms in clinical samples, and through high-throughput sequencing and database comparison analysis, the types of pathogenic microorganisms contained in the sample are judged according to the sequence information obtained by comparison. Although pathogen-targeted sequencing can overcome the shortcomings of traditional nucleic acid detection technology such as less types and quantity of detected pathogens, it is not simple to provide ultra-multiplex PCR primers that can simultaneously detect hundreds of pathogens due to its dependence on ultra-multiplex PCR amplification. In addition, there is no report on pathogen-targeted sequencing technology for simultaneously detecting hundreds of tuberculosis-related pathogens. SUMMARY

[0006] In view of the problems existing in the prior art, the present application provides a target sequencing primer composition and kit for tuberculosis-related pathogens.

[0007] The first object of the present application is to provide a targeted sequencing primer composition of tuberculosis related pathogens.

[0008] The second object of the present application is to provide the use of the primer composition in the preparation of a kit for detecting Mycobacterium tuberculosis and / or non-tuberculosis mycobacteria.

[0009] The third object of the present application is to provide a targeted sequencing kit of tuberculosis related pathogens.

[0010] The above objects of the present application are achieved by the following technical solutions: The present application is based on pathogen targeted sequencing technology, and provides corresponding targeted sequencing primer compositions and kits for a total of 172 tuberculosis related pathogens, including Mycobacterium tuberculosis, non-tuberculosis mycobacteria and other pathogens that can cause similar symptoms to tuberculosis after infection. Using the primer compositions and kits of the present application, rapid and accurate screening and detection of Mycobacterium tuberculosis and non-tuberculosis mycobacteria infection can be performed, thereby providing a reliable basis for the diagnosis and treatment of tuberculosis and other infections similar to tuberculosis. Therefore, the primer compositions and kits are claimed in the present application.

[0011] The present application provides a targeted sequencing primer composition of tuberculosis related pathogens, which contains a sequencing primer composition targeting Mycobacterium tuberculosis, and includes the following components: (1) a sequencing primer targeting Mycobacterium tuberculosis, the sequence of the forward primer is shown in SEQ ID NO. 1, and the sequence of the reverse primer is shown in SEQ ID NO. 2; (2) a sequencing primer targeting Mycobacterium tuberculosis bovine variant BCG, the sequence of the forward primer is shown in SEQ ID NO. 3, and the sequence of the reverse primer is shown in SEQ ID NO. 4; (3) a sequencing primer targeting Mycobacterium tuberculosis bovine variant, the sequence of the forward primer is shown in SEQ ID NO. 5, and the sequence of the reverse primer is shown in SEQ ID NO. 6; (4) a sequencing primer targeting Mycobacterium tuberculosis African variant, the sequence of the forward primer is shown in SEQ ID NO. 7, and the sequence of the reverse primer is shown in SEQ ID NO. 8; (5) a sequencing primer targeting Mycobacterium tuberculosis goat variant, the sequence of the forward primer is shown in SEQ ID NO. 9, and the sequence of the reverse primer is shown in SEQ ID NO. 10; (6) a sequencing primer targeting Mycobacterium tuberculosis seal variant, the sequence of the forward primer is shown in SEQ ID NO. 11, and the sequence of the reverse primer is shown in SEQ ID NO. 12; (7) sequencing primer targeting M. xenopi, the sequence of the forward primer is shown as SEQ ID NO. 13, and the sequence of the reverse primer is shown as SEQ ID NO. 14; (8) sequencing primer targeting M. microti, the sequence of the forward primer is shown as SEQ ID NO. 15, and the sequence of the reverse primer is shown as SEQ ID NO. 16; (9) sequencing primer targeting M. vicentei, the sequence of the forward primer is shown as SEQ ID NO. 17, and the sequence of the reverse primer is shown as SEQ ID NO. 18; (10) sequencing primer targeting M. kansasii, the sequence of the forward primer is shown as SEQ ID NO. 19, and the sequence of the reverse primer is shown as SEQ ID NO. 20; (11) sequencing primer targeting M. tuberculosis complex, the sequence of the forward primer is shown as SEQ ID NO. 21, and the sequence of the reverse primer is shown as SEQ ID NO. 22.

[0012] The use of the primer composition described herein in the preparation of a kit for detecting M. tuberculosis is also within the protection scope of the present application.

[0013] Alternatively, the primer composition further comprises sequencing primer composition targeting non-tuberculosis mycobacteria, comprising the following components: (1) sequencing primer targeting M. marinum, the sequence of the forward primer is shown as SEQ ID NO. 23, and the sequence of the reverse primer is shown as SEQ ID NO. 24; (2) sequencing primer targeting M. ulcerans, the sequence of the forward primer is shown as SEQ ID NO. 25, and the sequence of the reverse primer is shown as SEQ ID NO. 26; (3) sequencing primer targeting M. ulcerans group, the sequence of the forward primer is shown as SEQ ID NO. 27, and the sequence of the reverse primer is shown as SEQ ID NO. 28; (4) sequencing primer targeting M. genevense, the sequence of the forward primer is shown as SEQ ID NO. 29, and the sequence of the reverse primer is shown as SEQ ID NO. 30; (5) sequencing primer targeting M. haedicopense, the sequence of the forward primer is shown as SEQ ID NO. 31, and the sequence of the reverse primer is shown as SEQ ID NO. 32; (6) sequencing primer targeting M. intermedius, the sequence of the forward primer is shown as SEQ ID NO. 33, and the sequence of the reverse primer is shown as SEQ ID NO. 34; (7) sequencing primer targeting M. kubicae, the sequence of the forward primer is shown as SEQ ID NO. 35, and the sequence of the reverse primer is shown as SEQ ID NO. 36; (8) sequencing primer targeting Mycobacterium lentiflavum, forward primer sequence as shown in SEQ ID NO. 37, reverse primer sequence as shown in SEQ ID NO. 38; (9) sequencing primer targeting Mycobacterium lacunae, forward primer sequence as shown in SEQ ID NO. 39, reverse primer sequence as shown in SEQ ID NO. 40; (10) sequencing primer targeting Mycobacterium peregrinum, forward primer sequence as shown in SEQ ID NO. 41, reverse primer sequence as shown in SEQ ID NO. 42; (11) sequencing primer targeting Mycobacterium simiae, forward primer sequence as shown in SEQ ID NO. 43, reverse primer sequence as shown in SEQ ID NO. 44; (12) sequencing primer targeting Mycobacterium shimegavi, forward primer sequence as shown in SEQ ID NO. 45, reverse primer sequence as shown in SEQ ID NO. 46; (13) sequencing primer targeting Mycobacterium triplex, forward primer sequence as shown in SEQ ID NO. 47, reverse primer sequence as shown in SEQ ID NO. 48; (14) sequencing primer targeting Mycobacterium orphneum, forward primer sequence as shown in SEQ ID NO. 49, reverse primer sequence as shown in SEQ ID NO. 50; (15) sequencing primer targeting Mycobacterium avium, forward primer sequence as shown in SEQ ID NO. 51, reverse primer sequence as shown in SEQ ID NO. 52; (16) sequencing primer targeting Mycobacterium avium complex, forward primer sequence as shown in SEQ ID NO. 53, reverse primer sequence as shown in SEQ ID NO. 54; (17) sequencing primer targeting Mycobacterium colombiense, forward primer sequence as shown in SEQ ID NO. 55, reverse primer sequence as shown in SEQ ID NO. 56; (18) sequencing primer targeting Mycobacterium intracellulare, forward primer sequence as shown in SEQ ID NO. 57, reverse primer sequence as shown in SEQ ID NO. 58; (19) sequencing primer targeting Mycobacterium intracellulare cymitans, forward primer sequence as shown in SEQ ID NO. 59, reverse primer sequence as shown in SEQ ID NO. 60; (20) sequencing primer targeting Mycobacterium leprae, forward primer sequence as shown in SEQ ID NO. 61, reverse primer sequence as shown in SEQ ID NO. 62; (21) sequencing primer targeting Mycobacterium asiaticum, forward primer sequence as shown in SEQ ID NO. 63, and reverse primer sequence as shown in SEQ ID NO. 64; (22) sequencing primer targeting Mycobacterium botuense, forward primer sequence as shown in SEQ ID NO. 65, and reverse primer sequence as shown in SEQ ID NO. 66; (23) sequencing primer targeting Mycobacterium abscessus, forward primer sequence as shown in SEQ ID NO. 67, and reverse primer sequence as shown in SEQ ID NO. 68; (24) sequencing primer targeting Mycobacterium branderi, forward primer sequence as shown in SEQ ID NO. 69, and reverse primer sequence as shown in SEQ ID NO. 70; (25) sequencing primer targeting Mycobacterium cryptosporidii, forward primer sequence as shown in SEQ ID NO. 71, and reverse primer sequence as shown in SEQ ID NO. 72; (26) sequencing primer targeting Mycobacterium conspicuum, forward primer sequence as shown in SEQ ID NO. 73, and reverse primer sequence as shown in SEQ ID NO. 74; (27) sequencing primer targeting Mycobacterium cookii, forward primer sequence as shown in SEQ ID NO. 75, and reverse primer sequence as shown in SEQ ID NO. 76; (28) sequencing primer targeting Mycobacterium abscessus subsp. abscessus, forward primer sequence as shown in SEQ ID NO. 77, and reverse primer sequence as shown in SEQ ID NO. 78; (29) sequencing primer targeting Mycobacterium gordonae, forward primer sequence as shown in SEQ ID NO. 79, and reverse primer sequence as shown in SEQ ID NO. 80; (30) sequencing primer targeting Mycobacterium abscessus subsp. bolletii, forward primer sequence as shown in SEQ ID NO. 81, and reverse primer sequence as shown in SEQ ID NO. 82; (31) sequencing primer targeting Mycobacterium abscessus subsp. massiliense, forward primer sequence as shown in SEQ ID NO. 83, and reverse primer sequence as shown in SEQ ID NO. 84; (32) sequencing primer targeting Mycobacterium chelonae, forward primer sequence as shown in SEQ ID NO. 85, and reverse primer sequence as shown in SEQ ID NO. 86; (33) sequencing primer targeting Mycobacterium salmoniphilum, forward primer sequence as shown in SEQ ID NO. 87, and reverse primer sequence as shown in SEQ ID NO. 88; (34) sequencing primer targeting Mycolicibacterium agri, forward primer sequence as shown in SEQ ID NO. 89, reverse primer sequence as shown in SEQ ID NO. 90; (35) sequencing primer targeting Mycolicibacterium haemophilum, forward primer sequence as shown in SEQ ID NO. 91, reverse primer sequence as shown in SEQ ID NO. 92; (36) sequencing primer targeting Mycolicibacterium heckshornense, forward primer sequence as shown in SEQ ID NO. 93, reverse primer sequence as shown in SEQ ID NO. 94; (37) sequencing primer targeting Mycolicibacterium kansasii, forward primer sequence as shown in SEQ ID NO. 95, reverse primer sequence as shown in SEQ ID NO. 96; (38) sequencing primer targeting Mycolicibacterium defluvii, forward primer sequence as shown in SEQ ID NO. 97, reverse primer sequence as shown in SEQ ID NO. 98; (39) sequencing primer targeting Mycolicibacterium lacunae, forward primer sequence as shown in SEQ ID NO. 99, reverse primer sequence as shown in SEQ ID NO. 100; (40) sequencing primer targeting Mycolicibacterium malmoense, forward primer sequence as shown in SEQ ID NO. 101, reverse primer sequence as shown in SEQ ID NO. 102; (41) sequencing primer targeting Mycolicibacterium obuense, forward primer sequence as shown in SEQ ID NO. 103, reverse primer sequence as shown in SEQ ID NO. 104; (42) sequencing primer targeting Mycolicibacterium aureum, forward primer sequence as shown in SEQ ID NO. 105, reverse primer sequence as shown in SEQ ID NO. 106; (43) sequencing primer targeting Mycolicibacterium mantuense, forward primer sequence as shown in SEQ ID NO. 107, reverse primer sequence as shown in SEQ ID NO. 108; (44) sequencing primer targeting Mycolicibacterium neumoniae, forward primer sequence as shown in SEQ ID NO. 109, reverse primer sequence as shown in SEQ ID NO. 110; (45) sequencing primer targeting Mycolicibacterium nassum, forward primer sequence as shown in SEQ ID NO. 111, reverse primer sequence as shown in SEQ ID NO. 112; (46) sequencing primer targeting Mycolicibacterium hiemalis, forward primer sequence as shown in SEQ ID NO. 113, reverse primer sequence as shown in SEQ ID NO. 114; (47) sequencing primer targeting Mycobacterium canettii, forward primer sequence as shown in SEQ ID NO. 115, and reverse primer sequence as shown in SEQ ID NO. 116; (48) sequencing primer targeting Mycobacterium kudirki, forward primer sequence as shown in SEQ ID NO. 117, and reverse primer sequence as shown in SEQ ID NO. 118; (49) sequencing primer targeting Mycobacterium luponei, forward primer sequence as shown in SEQ ID NO. 119, and reverse primer sequence as shown in SEQ ID NO. 120; (50) sequencing primer targeting Mycobacterium kochi, forward primer sequence as shown in SEQ ID NO. 121, and reverse primer sequence as shown in SEQ ID NO. 122; (51) sequencing primer targeting Mycobacterium diernae, forward primer sequence as shown in SEQ ID NO. 123, and reverse primer sequence as shown in SEQ ID NO. 124; (52) sequencing primer targeting Mycobacterium dorricum, forward primer sequence as shown in SEQ ID NO. 125, and reverse primer sequence as shown in SEQ ID NO. 126; (53) sequencing primer targeting Mycobacterium duvalii, forward primer sequence as shown in SEQ ID NO. 127, and reverse primer sequence as shown in SEQ ID NO. 128; (54) sequencing primer targeting Mycobacterium elephantis, forward primer sequence as shown in SEQ ID NO. 129, and reverse primer sequence as shown in SEQ ID NO. 130; (55) sequencing primer targeting Mycobacterium paraseoulense, forward primer sequence as shown in SEQ ID NO. 131, and reverse primer sequence as shown in SEQ ID NO. 132; (56) sequencing primer targeting Mycobacterium fallax, forward primer sequence as shown in SEQ ID NO. 133, and reverse primer sequence as shown in SEQ ID NO. 134; (57) sequencing primer targeting Mycobacterium lyogense, forward primer sequence as shown in SEQ ID NO. 135, and reverse primer sequence as shown in SEQ ID NO. 136; (58) sequencing primer targeting Mycobacterium incidentale, forward primer sequence as shown in SEQ ID NO. 137, and reverse primer sequence as shown in SEQ ID NO. 138; (59) sequencing primer targeting Mycobacterium frederiksbergense, forward primer sequence as shown in SEQ ID NO. 139, and reverse primer sequence as shown in SEQ ID NO. 140; (60) sequencing primer targeting Mycobacterium shahae, the forward primer sequence is shown as SEQ ID NO. 141, and the reverse primer sequence is shown as SEQ ID NO. 142; (61) sequencing primer targeting Mycobacterium gadiense, the forward primer sequence is shown as SEQ ID NO. 143, and the reverse primer sequence is shown as SEQ ID NO. 144; (62) sequencing primer targeting Mycobacterium abscessus, the forward primer sequence is shown as SEQ ID NO. 145, and the reverse primer sequence is shown as SEQ ID NO. 146; (63) sequencing primer targeting Mycobacterium flavescens, the forward primer sequence is shown as SEQ ID NO. 147, and the reverse primer sequence is shown as SEQ ID NO. 148; (64) sequencing primer targeting Mycobacterium gordonae, the forward primer sequence is shown as SEQ ID NO. 149, and the reverse primer sequence is shown as SEQ ID NO. 150; (65) sequencing primer targeting Mycobacterium hassiacum, the forward primer sequence is shown as SEQ ID NO. 151, and the reverse primer sequence is shown as SEQ ID NO. 152; (66) sequencing primer targeting Mycobacterium hodgkini, the forward primer sequence is shown as SEQ ID NO. 153, and the reverse primer sequence is shown as SEQ ID NO. 154; (67) sequencing primer targeting Mycobacterium holerae, the forward primer sequence is shown as SEQ ID NO. 155, and the reverse primer sequence is shown as SEQ ID NO. 156; (68) sequencing primer targeting Mycobacterium issoriae, the forward primer sequence is shown as SEQ ID NO. 157, and the reverse primer sequence is shown as SEQ ID NO. 158; (69) sequencing primer targeting Mycobacterium koreense, the forward primer sequence is shown as SEQ ID NO. 159, and the reverse primer sequence is shown as SEQ ID NO. 160; (70) sequencing primer targeting Mycobacterium madagascariense, the forward primer sequence is shown as SEQ ID NO. 161, and the reverse primer sequence is shown as SEQ ID NO. 162; (71) sequencing primer targeting Mycobacterium szaboi, the forward primer sequence is shown as SEQ ID NO. 163, and the reverse primer sequence is shown as SEQ ID NO. 164; (72) sequencing primer targeting Mycobacterium murale, the forward primer sequence is shown as SEQ ID NO. 165, and the reverse primer sequence is shown as SEQ ID NO. 166; (73) sequencing primer targeting Mycobacterium surugiyense, the forward primer sequence is shown as SEQ ID NO. 167, and the reverse primer sequence is shown as SEQ ID NO. 168; (74) sequencing primer targeting Mycobacterium moriokaense, the forward primer sequence is shown as SEQ ID NO. 169, and the reverse primer sequence is shown as SEQ ID NO. 170; (75) sequencing primer targeting Mycobacterium mucogenicum, the forward primer sequence is shown as SEQ ID NO. 171, and the reverse primer sequence is shown as SEQ ID NO. 172; (76) sequencing primer targeting Mycobacterium wallacei, the forward primer sequence is shown as SEQ ID NO. 173, and the reverse primer sequence is shown as SEQ ID NO. 174; (77) sequencing primer targeting Mycobacterium neocaprae, the forward primer sequence is shown as SEQ ID NO. 175, and the reverse primer sequence is shown as SEQ ID NO. 176; (78) sequencing primer targeting Mycobacterium newcastlense, the forward primer sequence is shown as SEQ ID NO. 177, and the reverse primer sequence is shown as SEQ ID NO. 178; (79) sequencing primer targeting Mycobacterium obuense, the forward primer sequence is shown as SEQ ID NO. 179, and the reverse primer sequence is shown as SEQ ID NO. 180; (80) sequencing primer targeting Mycobacterium palustre, the forward primer sequence is shown as SEQ ID NO. 181, and the reverse primer sequence is shown as SEQ ID NO. 182; (81) sequencing primer targeting Mycobacterium parafortuitum, the forward primer sequence is shown as SEQ ID NO. 183, and the reverse primer sequence is shown as SEQ ID NO. 184; (82) sequencing primer targeting Mycobacterium phlei, the forward primer sequence is shown as SEQ ID NO. 185, and the reverse primer sequence is shown as SEQ ID NO. 186; (83) sequencing primer targeting Mycobacterium ranuncicolum, the forward primer sequence is shown as SEQ ID NO. 187, and the reverse primer sequence is shown as SEQ ID NO. 188; (84) sequencing primer targeting Mycobacterium porcinum, the forward primer sequence is shown as SEQ ID NO. 189, and the reverse primer sequence is shown as SEQ ID NO. 190; (85) sequencing primers targeting Mycobacterium poriferae, the forward primer sequence of which is set forth in SEQ ID NO. 191, and the reverse primer sequence of which is set forth in SEQ ID NO. 192; (86) sequencing primers targeting Mycobacterium pulveris, the forward primer sequence of which is set forth in SEQ ID NO. 193, and the reverse primer sequence of which is set forth in SEQ ID NO. 194; (87) sequencing primers targeting Mycobacterium pyrenivorans, the forward primer sequence of which is set forth in SEQ ID NO. 195, and the reverse primer sequence of which is set forth in SEQ ID NO. 196; (88) sequencing primers targeting Mycobacterium parafredholmense, the forward primer sequence of which is set forth in SEQ ID NO. 197, and the reverse primer sequence of which is set forth in SEQ ID NO. 198; (89) sequencing primers targeting Mycobacterium arorescens, the forward primer sequence of which is set forth in SEQ ID NO. 199, and the reverse primer sequence of which is set forth in SEQ ID NO. 200; (90) sequencing primers targeting Mycobacterium minnesotense, the forward primer sequence of which is set forth in SEQ ID NO. 201, and the reverse primer sequence of which is set forth in SEQ ID NO. 202; (91) sequencing primers targeting Mycobacterium rhodesiae, the forward primer sequence of which is set forth in SEQ ID NO. 203, and the reverse primer sequence of which is set forth in SEQ ID NO. 204; (92) sequencing primers targeting Mycobacterium rubrum, the forward primer sequence of which is set forth in SEQ ID NO. 205, and the reverse primer sequence of which is set forth in SEQ ID NO. 206; (93) sequencing primers targeting Mycobacterium smegmatis, the forward primer sequence of which is set forth in SEQ ID NO. 207, and the reverse primer sequence of which is set forth in SEQ ID NO. 208; (94) sequencing primers targeting Mycobacterium sp., the forward primer sequence of which is set forth in SEQ ID NO. 209, and the reverse primer sequence of which is set forth in SEQ ID NO. 210; (95) sequencing primers targeting Mycobacterium nonchromogenicum, the forward primer sequence of which is set forth in SEQ ID NO. 211, and the reverse primer sequence of which is set forth in SEQ ID NO. 212; (96) sequencing primers targeting Mycobacterium gypseum, the forward primer sequence of which is set forth in SEQ ID NO. 213, and the reverse primer sequence of which is set forth in SEQ ID NO. 214; (97) sequencing primer targeting anti-thermo mycolic acid bacillus, the sequence of the forward primer is shown as SEQ ID NO. 215, and the sequence of the reverse primer is shown as SEQ ID NO. 216; (98) sequencing primer targeting Seoul National University mycolic acid bacillus, the sequence of the forward primer is shown as SEQ ID NO. 217, and the sequence of the reverse primer is shown as SEQ ID NO. 218; (99) sequencing primer targeting soil mycolic acid bacillus, the sequence of the forward primer is shown as SEQ ID NO. 219, and the sequence of the reverse primer is shown as SEQ ID NO. 220; (100) sequencing primer targeting East Sea mycolic acid bacillus, the sequence of the forward primer is shown as SEQ ID NO. 221, and the sequence of the reverse primer is shown as SEQ ID NO. 222; (101) sequencing primer targeting cow mycolic acid bacillus, the sequence of the forward primer is shown as SEQ ID NO. 223, and the sequence of the reverse primer is shown as SEQ ID NO. 224; (102) sequencing primer targeting leprosy Mycobacterium, the sequence of the forward primer is shown as SEQ ID NO. 225, and the sequence of the reverse primer is shown as SEQ ID NO. 226; (103) sequencing primer targeting Masa Mycobacterium, the sequence of the forward primer is shown as SEQ ID NO. 227, and the sequence of the reverse primer is shown as SEQ ID NO. 228; (104) sequencing primer targeting paracolon intracellular Mycobacterium, the sequence of the forward primer is shown as SEQ ID NO. 229, and the sequence of the reverse primer is shown as SEQ ID NO. 230; (105) sequencing primer targeting Rhone estuary Mycobacterium, the sequence of the forward primer is shown as SEQ ID NO. 231, and the sequence of the reverse primer is shown as SEQ ID NO. 232; (106) sequencing primer targeting Timone Mycobacterium, the sequence of the forward primer is shown as SEQ ID NO. 233, and the sequence of the reverse primer is shown as SEQ ID NO. 234; (107) sequencing primer targeting bacteremia Mycobacterium, the sequence of the forward primer is shown as SEQ ID NO. 235, and the sequence of the reverse primer is shown as SEQ ID NO. 236; (108) sequencing primer targeting extraneous Mycobacterium, the sequence of the forward primer is shown as SEQ ID NO. 237, and the sequence of the reverse primer is shown as SEQ ID NO. 238; (109) sequencing primer targeting stomach Mycobacterium, the sequence of the forward primer is shown as SEQ ID NO. 239, and the sequence of the reverse primer is shown as SEQ ID NO. 240; (110) sequencing primer targeting Mycobacterium immunogenum, forward primer sequence as shown in SEQ ID NO. 241, reverse primer sequence as shown in SEQ ID NO. 242; (111) sequencing primer targeting Mycobacterium kumamonoense, forward primer sequence as shown in SEQ ID NO. 243, reverse primer sequence as shown in SEQ ID NO. 244; (112) sequencing primer targeting Mycobacterium bohemicum, forward primer sequence as shown in SEQ ID NO. 245, reverse primer sequence as shown in SEQ ID NO. 246; (113) sequencing primer targeting Mycobacterium margaretense, forward primer sequence as shown in SEQ ID NO. 247, reverse primer sequence as shown in SEQ ID NO. 248; (114) sequencing primer targeting Mycobacterium ulcerans, forward primer sequence as shown in SEQ ID NO. 249, reverse primer sequence as shown in SEQ ID NO. 250.

[0014] The use of the primer composition described herein in the preparation of a kit for detecting Mycobacterium tuberculosis and / or non-tuberculous Mycobacterium should also be within the scope of the present application.

[0015] Alternatively, the primer composition further comprises sequencing primer compositions targeting bacteria that can cause symptoms similar to tuberculosis after infection, comprising the following components: (1) sequencing primer targeting Acinetobacter baumannii, forward primer sequence as shown in SEQ ID NO. 251, reverse primer sequence as shown in SEQ ID NO. 252; (2) sequencing primer targeting Burkholderia mallei, forward primer sequence as shown in SEQ ID NO. 253, reverse primer sequence as shown in SEQ ID NO. 254; (3) sequencing primer targeting Leptospira borgpetersenii, forward primer sequence as shown in SEQ ID NO. 255, reverse primer sequence as shown in SEQ ID NO. 256; (4) sequencing primer targeting Brucella, forward primer sequence as shown in SEQ ID NO. 257, reverse primer sequence as shown in SEQ ID NO. 258; (5) sequencing primer targeting Klebsiella oxytoca, forward primer sequence as shown in SEQ ID NO. 259, reverse primer sequence as shown in SEQ ID NO. 260; (6) sequencing primer targeting Escherichia coli, forward primer sequence as shown in SEQ ID NO. 261, reverse primer sequence as shown in SEQ ID NO. 262; (7) sequencing primer targeting Klebsiella pneumoniae, the sequence of the forward primer is shown as SEQ ID NO. 263, and the sequence of the reverse primer is shown as SEQ ID NO. 264; (8) sequencing primer targeting Moraxella catarrhalis, the sequence of the forward primer is shown as SEQ ID NO. 265, and the sequence of the reverse primer is shown as SEQ ID NO. 266; (9) sequencing primer targeting Haemophilus influenzae, the sequence of the forward primer is shown as SEQ ID NO. 267, and the sequence of the reverse primer is shown as SEQ ID NO. 268; (10) sequencing primer targeting Proteus mirabilis, the sequence of the forward primer is shown as SEQ ID NO. 269, and the sequence of the reverse primer is shown as SEQ ID NO. 270; (11) sequencing primer targeting Legionella pneumophila, the sequence of the forward primer is shown as SEQ ID NO. 271, and the sequence of the reverse primer is shown as SEQ ID NO. 272; (12) sequencing primer targeting Stenotrophomonas maltophilia, the sequence of the forward primer is shown as SEQ ID NO. 273, and the sequence of the reverse primer is shown as SEQ ID NO. 274; (13) sequencing primer targeting Pseudomonas aeruginosa, the sequence of the forward primer is shown as SEQ ID NO. 275, and the sequence of the reverse primer is shown as SEQ ID NO. 276; (14) sequencing primer targeting Leptospira interrogans, the sequence of the forward primer is shown as SEQ ID NO. 277, and the sequence of the reverse primer is shown as SEQ ID NO. 278; (15) sequencing primer targeting Acinetobacter baumannii, the sequence of the forward primer is shown as SEQ ID NO. 279, and the sequence of the reverse primer is shown as SEQ ID NO. 280; (16) sequencing primer targeting Enterobacter cloacae complex, the sequence of the forward primer is shown as SEQ ID NO. 281, and the sequence of the reverse primer is shown as SEQ ID NO. 282; (17) sequencing primer targeting Nocardia brasiliensis, the sequence of the forward primer is shown as SEQ ID NO. 283, and the sequence of the reverse primer is shown as SEQ ID NO. 284; (18) sequencing primer targeting Streptococcus pneumoniae, the sequence of the forward primer is shown as SEQ ID NO. 285, and the sequence of the reverse primer is shown as SEQ ID NO. 286; (19) sequencing primer targeting Staphylococcus aureus, the sequence of the forward primer is shown as SEQ ID NO. 287, and the sequence of the reverse primer is shown as SEQ ID NO. 288; (20) sequencing primer targeting Nocardia abscessus, the sequence of the forward primer is shown as SEQ ID NO. 289, and the sequence of the reverse primer is shown as SEQ ID NO. 290; (21) sequencing primer targeting Nocardia brasiliensis, the sequence of the forward primer is shown as SEQ ID NO. 291, and the sequence of the reverse primer is shown as SEQ ID NO. 292; (22) sequencing primer targeting Nocardia saintehubertii, the sequence of the forward primer is shown as SEQ ID NO. 293, and the sequence of the reverse primer is shown as SEQ ID NO. 294; (23) sequencing primer targeting Nocardia surumkundica, the sequence of the forward primer is shown as SEQ ID NO. 295, and the sequence of the reverse primer is shown as SEQ ID NO. 296; (24) sequencing primer targeting Nocardia asteroides, the sequence of the forward primer is shown as SEQ ID NO. 297, and the sequence of the reverse primer is shown as SEQ ID NO. 298; (25) sequencing primer targeting Nocardia asialica, the sequence of the forward primer is shown as SEQ ID NO. 299, and the sequence of the reverse primer is shown as SEQ ID NO. 300; (26) sequencing primer targeting Coxiella burnetii, the sequence of the forward primer is shown as SEQ ID NO. 301, and the sequence of the reverse primer is shown as SEQ ID NO. 302; (27) sequencing primer targeting Chlamydia pneumoniae, the sequence of the forward primer is shown as SEQ ID NO. 303, and the sequence of the reverse primer is shown as SEQ ID NO. 304; (28) sequencing primer targeting Mycoplasma pneumoniae, the sequence of the forward primer is shown as SEQ ID NO. 305, and the sequence of the reverse primer is shown as SEQ ID NO. 306; (29) sequencing primer targeting Chlamydophila psittaci, the sequence of the forward primer is shown as SEQ ID NO. 307, and the sequence of the reverse primer is shown as SEQ ID NO. 308.

[0016] Optionally, the primer composition further comprises a sequencing primer composition targeting fungi that can cause symptoms similar to tuberculosis after infection, comprising the following components: (1) sequencing primer targeting Candida albicans, the sequence of the forward primer is shown as SEQ ID NO. 309, and the sequence of the reverse primer is shown as SEQ ID NO. 310; (2) sequencing primer targeting Nattrassia manginii, the sequence of the forward primer is shown as SEQ ID NO. 311, and the sequence of the reverse primer is shown as SEQ ID NO. 312; (3) sequencing primer targeting Aspergillus niger, the sequence of the forward primer is shown as SEQ ID NO. 313, and the sequence of the reverse primer is shown as SEQ ID NO. 314; (4) sequencing primer targeting Aspergillus flavus, the sequence of the forward primer is shown as SEQ ID NO. 315, and the sequence of the reverse primer is shown as SEQ ID NO. 316; (5) sequencing primer targeting Pichia kudriavzevii, the sequence of the forward primer is shown as SEQ ID NO. 317, and the sequence of the reverse primer is shown as SEQ ID NO. 318; (6) sequencing primer targeting Candida tropicalis, the sequence of the forward primer is shown as SEQ ID NO. 319, and the sequence of the reverse primer is shown as SEQ ID NO. 320; (7) sequencing primer targeting Aspergillus terreus, the sequence of the forward primer is shown as SEQ ID NO. 321, and the sequence of the reverse primer is shown as SEQ ID NO. 322; (8) sequencing primer targeting Cryptococcus neoformans, the sequence of the forward primer is shown as SEQ ID NO. 323, and the sequence of the reverse primer is shown as SEQ ID NO. 324; (9) sequencing primer targeting Aspergillus fumigatus, the sequence of the forward primer is shown as SEQ ID NO. 325, and the sequence of the reverse primer is shown as SEQ ID NO. 326; (10) sequencing primer targeting Pneumocystis jirovecii, the sequence of the forward primer is shown as SEQ ID NO. 327, and the sequence of the reverse primer is shown as SEQ ID NO. 328.

[0017] Alternatively, the primer composition further comprises a sequencing primer composition targeting DNA viruses that can cause symptoms similar to tuberculosis after infection, comprising the following components: (1) sequencing primer targeting human herpesvirus 4 (EBV), the sequence of the forward primer is shown as SEQ ID NO. 329, and the sequence of the reverse primer is shown as SEQ ID NO. 330; (2) sequencing primer targeting human herpesvirus 5 (CMV), the sequence of the forward primer is shown as SEQ ID NO. 331, and the sequence of the reverse primer is shown as SEQ ID NO. 332; (3) sequencing primer targeting human adenovirus B, the sequence of the forward primer is shown as SEQ ID NO. 333, and the sequence of the reverse primer is shown as SEQ ID NO. 334; (4) sequencing primer targeting human adenovirus C, the sequence of the forward primer is shown as SEQ ID NO. 335, and the sequence of the reverse primer is shown as SEQ ID NO. 336; (5) a sequencing primer targeting human adenovirus type E, wherein the sequence of the forward primer is shown as SEQ ID NO. 337, and the sequence of the reverse primer is shown as SEQ ID NO. 338.

[0018] Optionally, the primer composition further comprises a sequencing primer composition targeting parasites that can cause symptoms similar to tuberculosis after infection, and the sequencing primer composition comprises the following components: (1) a sequencing primer targeting Leishmania donovani complex, wherein the sequence of the forward primer is shown as SEQ ID NO. 339, and the sequence of the reverse primer is shown as SEQ ID NO. 340; (2) a sequencing primer targeting Plasmodium, wherein the sequence of the forward primer is shown as SEQ ID NO. 341, and the sequence of the reverse primer is shown as SEQ ID NO. 342; (3) a sequencing primer targeting Entamoeba histolytica, wherein the sequence of the forward primer is shown as SEQ ID NO. 343, and the sequence of the reverse primer is shown as SEQ ID NO. 344.

[0019] Specifically, the primer composition further comprises an internal standard primer, wherein the sequence of the forward primer is shown as SEQ ID NO. 345, and the sequence of the reverse primer is shown as SEQ ID NO. 346.

[0020] Specifically, the primers contained in the primer composition are all connected with a linker sequence.

[0021] In specific embodiments of the present application, the linker sequence is connected to the 5' end of the primer; wherein the sequence of the linker connected to the forward primer is shown as SEQ ID NO. 347, and the sequence of the linker connected to the reverse primer is shown as SEQ ID NO. 348.

[0022] The use of the above-mentioned primer composition in the preparation of a kit for detecting tuberculosis-related pathogens should also be within the protection scope of the present application.

[0023] The present application also provides a tuberculosis-related pathogen targeted sequencing kit, wherein the kit contains the above-mentioned primer composition of the present application.

[0024] Specifically, the kit further contains reagents required for pathogen-targeted sequencing.

[0025] In specific embodiments of the present application, the reagents required for pathogen-targeted sequencing include first-step amplification reagents and second-step amplification reagents; wherein the first-step amplification reagents include Reaction buffer, multiplex amplification enzyme and PIC; and the second-step amplification reagents include Hifi Mix reagent and linker primer.

[0026] Specifically, the kit also contains nuclease-free water.

[0027] The application also provides a method for detecting tuberculosis-related pathogens using the primer composition or the kit, comprising the following steps: S1. Extracting DNA of pathogens contained in the sample; S2. Constructing a library of pathogen DNA using a two-step amplification method using the primer composition or the kit of the application; S3. Preparing DNB for sequencing.

[0028] Optionally, the sample includes alveolar lavage fluid, sputum, oropharyngeal swab and blood.

[0029] Advantages: The application provides a sequencing primer composition for targeting Mycobacterium tuberculosis based on pathogen-targeted sequencing technology. On this basis, in order to better distinguish tuberculosis and "tuberculosis-like" diseases and provide reliable basis for clinical diagnosis and treatment of tuberculosis, the application includes non-tuberculosis mycobacteria and other pathogens that can cause symptoms similar to tuberculosis after infection, and provides corresponding targeted sequencing primer compositions and kits. The targeted sequencing primer composition and kit for tuberculosis-related pathogens of the application can detect a relatively more comprehensive pathogen, greatly increase the number of detected pathogens in a short time, reduce detection costs, and facilitate rapid and accurate screening and detection of Mycobacterium tuberculosis and non-tuberculosis mycobacteria infection, which can provide reliable basis for the diversion, diagnosis and treatment of tuberculosis and other infections similar to tuberculosis, and has important clinical significance. DETAILED DESCRIPTION

[0030] The application will be further described below in combination with specific examples, but the examples do not limit the application in any form. Unless otherwise specified, the reagents, methods and equipment used in the application are conventional reagents, methods and equipment in the technical field.

[0031] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0032] Example 1: Obtaining of the targeted sequencing primer composition for tuberculosis-related pathogens 1. Obtaining of the sequencing primer composition for targeting Mycobacterium tuberculosis Based on pathogen targeted sequencing technology, the application designs corresponding sequencing primers for Mycobacterium tuberculosis, Mycobacterium tuberculosis bovis Bacillus Calmette-Guerin, Mycobacterium tuberculosis bovis, Mycobacterium tuberculosis africanum, Mycobacterium tuberculosis caprae, Mycobacterium tuberculosis phoae, Mycobacterium genavense, Mycobacterium microti, Mycobacterium pinnipedii, Mycobacterium kansasii and Mycobacterium tuberculosis complex respectively, and evaluates, tests and screens the designed primers to obtain a sequencing primer composition targeting the Mycobacterium tuberculosis.

[0033] 2. Obtaining of a sequencing primer composition targeting non-tuberculosis mycobacteria Based on the obtained sequencing primer composition targeting Mycobacterium tuberculosis, the application also designs corresponding sequencing primers for non-tuberculosis mycobacteria respectively, and evaluates, tests and screens the designed primers to obtain a sequencing primer composition which can simultaneously detect the Mycobacterium tuberculosis and non-tuberculosis mycobacteria in the same reaction system with the above-mentioned sequencing primer composition targeting Mycobacterium tuberculosis.

[0034] The non-tuberculous mycobacteria targeted by the present invention include: M. marinum, M. ulcerans, M. ulcerans group, M. genavense, M. haedickei, M. intermedius, M. kubicae, M. luteum, M. palustre, M. parmense, M. simiae, M. triviale, M. triplicata, M. orhum, M. avium, M. avium complex, M. colombiense, M. intracellulare, M. intracellulare ssp. chimera, M. leprae, M. asiaticum, M. botnense, M. abscessus, M. branderi, M. cryptosporium, M. excellens, M. cookii, M. abscessus ssp. abscessus, M. gordonae, M. abscessus ssp. bolleanum, M. abscessus ssp. massiliense, M. chelonae, M. piscicola, M. agri, M. haemolyticum, M. heckshoi, M. kansasii, M. defluvii, M. lacunae, M. malmoense, M. obuense, M. aurum, M. mantuense, M. neumoniae, M. sudorale, M. hiemalis, M. canariense, M. chitae, M. cobrense, M. diernhoferi, M. dorripiense, M. duvalii, M. elephantis, M. paraseoulense, M. fallax, M. jordanovense, M. occipitalis, M. frederiksbergense, M. shahii, M. gaditium, M. gordonae, M. gypseum, M. immunoassayable, M. kumamotoense,Mycobacterium bovis, Mycobacterium gordonae, Mycobacterium kansasii, Mycobacterium szulgai, Mycobacterium terrae, Mycobacterium ulcerans, Mycobacterium xenopi, and 114 non-tuberculosis mycobacteria.

[0035] 3. Sequencing primer composition targeting other pathogens that can cause symptoms similar to tuberculosis after infection In addition to the relevant infection caused by Mycobacterium tuberculosis, some bacteria, fungi, DNA viruses and parasites can also cause symptoms similar to tuberculosis. In order to provide more accurate guidance for the diagnosis and treatment of tuberculosis, the present application further designs corresponding sequencing primers for other pathogens that can cause symptoms similar to tuberculosis after infection on the basis of the sequencing primer composition obtained in the foregoing, and evaluates, tests and screens the designed primers, thereby obtaining a sequencing primer composition that can simultaneously detect the Mycobacterium tuberculosis, non-tuberculosis mycobacteria and other pathogens that can cause symptoms similar to tuberculosis after infection in the same reaction system as the above-mentioned sequencing primer composition.

[0036] The other pathogens that can cause symptoms similar to tuberculosis after infection targeted by the present application are shown in Table 1.

[0037] Table 1 Pathogens that can cause symptoms similar to tuberculosis after infection

[0038] The nucleotide sequences of the sequencing primers contained in the sequencing primer composition (including internal standard primers) targeting Mycobacterium tuberculosis, non-tuberculosis mycobacteria and other pathogens that can cause symptoms similar to tuberculosis after infection according to the present application are shown in Table 2.

[0039] Table 2 Nucleotide sequences of sequencing primers contained in the sequencing primer composition

[0040] The primer composition shown in Table 2 of the present application needs to be connected with a linker sequence during use. The universal linker sequence used is as follows: Universal linker sequence of forward primer (SEQ ID NO. 347): CACAGAACGACATGGCTACGATCCGACTT+F; Universal adaptor sequence of the forward primer (SEQ ID NO. 348): TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT+R.

[0041] Example 2: Targeted sequencing kit for tuberculosis-related pathogens Based on the primer composition obtained in Example 1 (shown in Table 2), the present application also provides a targeted sequencing kit for tuberculosis-related pathogens, which contains the primer composition. Different primers can be selected for the detection of different targets. For example, if Mycobacterium tuberculosis is the target to be detected, only the sequencing primer for Mycobacterium tuberculosis can be used to obtain the detection result by pathogen targeted sequencing technology.

[0042] In this embodiment, the kit comprises the following components: the primer composition (the primer 5' end is connected with the adaptor sequence) shown in Table 2, the first-step amplification reagent, the second-step amplification reagent, and nuclease-free water. The first-step amplification reagent comprises 5 × Reaction buffer, multiplex amplification enzyme, and PIC; the second-step amplification reagent comprises 2 × Hifi Mix and adaptor primer.

[0043] Based on the kit described above, the present application also provides a method for detecting tuberculosis-related pathogens, which mainly comprises the following steps: Step 1: Extracting the DNA of the pathogen contained in the sample (the sample includes alveolar lavage fluid, sputum, oropharyngeal swab, and blood); Step 2: Using the primer composition or kit of the present application, and using two-step amplification method to construct the library of pathogen DNA; Step 3: Preparing DNB for sequencing.

[0044] The method for detecting tuberculosis-related pathogens specifically comprises the following steps: S1. Extracting the pathogen DNA; Any method that can extract the pathogen DNA can be used, as long as the quality and concentration of the extracted DNA can meet the requirements of pathogen targeted sequencing technology.

[0045] The pathogen DNA extraction method used in the present application is as follows: (1) Take a clean broken wall tube (MP Lysing Matrix E tube), and add 1000 μL of lysis solution; (2) Shake and mix the sample, and transfer 400 μL of the sample into a cell disruption tube. Perform cell disruption on a cell disruptor (operation program: vibration intensity (SPEED) M / S = 6.0, operation time 30 s, pause time 30 s, cycle number 8); (3) High-speed centrifugation at 12000 rcf for 1 min, and take the supernatant (about 1.0 mL) to a new 2.0 mL tube for extraction; (4) Add 30 μL of extraction magnetic beads and 40 μL of proteinase K to the 2 mL centrifuge tube containing the sample, and vortex to mix; (5) Place in a 70°C constant temperature shaking metal bath for 10 min at a speed of 1200 rpm, and then centrifuge immediately; (6) Place the centrifuge tube in a magnetic stand, and carefully remove the liquid with a pipette when the magnetic beads are completely adsorbed; (7) Add 800 μL of washing solution 1, vortex to mix for 1 min, and centrifuge immediately; (8) Place the centrifuge tube in a magnetic stand, and carefully remove the liquid with a pipette when the magnetic beads are completely adsorbed; (9) Add 800 μL of washing solution 2, vortex to mix for 1 min, and centrifuge immediately; (10) Place the centrifuge tube in a magnetic stand, and carefully remove the liquid with a pipette when the magnetic beads are completely adsorbed, and repeat once; (11) Centrifuge for 10 s, place the tube back in the magnetic stand tube hole, and when the magnetic beads are completely adsorbed, remove the liquid at the bottom of the tube with a 10 μL gun, and place the centrifuge tube in a magnetic stand and dry at room temperature; (12) Add 50 μL of elution solution, vortex to mix, centrifuge immediately, incubate at room temperature for 5 min, and then place in a magnetic stand and stand still; (13) When the magnetic beads are completely adsorbed, transfer the nucleic acid solution to a new 1.5 mL EP tube.

[0046] S2. First step PCR amplification; (1) Shake and mix the pathogen DNA extraction product, and centrifuge immediately; (2) Prepare the first step PCR amplification reaction system, and the PCR amplification reaction system is shown in Table 3; Table 3 First step PCR amplification reaction system

[0047] (3) Place the prepared first step PCR amplification reaction system into a conventional PCR instrument, and the reaction program is shown in Table 4; Table 4 First step PCR amplification reaction program

[0048] S3. First step magnetic bead purification; (1) 30 min before the first round of magnetic bead purification, place the purification magnetic beads at room temperature to balance the temperature to room temperature; (2) Transfer the first step PCR amplification product to a new EP tube, supplement 30 μL Nuclease-free water, and add 60 μL DNA purification magnetic beads; (3) After mixing evenly, place at room temperature for 5 min, and after brief centrifugation, place on the magnetic stand for 3-5 min to separate the magnetic beads; (4) After the supernatant is completely clear, remove the supernatant; (5) Add 200 μL of freshly prepared 80% ethanol to the remaining magnetic beads, and place at room temperature for 30 s, remove the supernatant; repeat the 80% ethanol cleaning once; (6) After brief centrifugation, place on the magnetic stand to completely absorb the remaining ethanol, and place at room temperature for 2-3 min to dry the magnetic beads; (7) Add 23 μL of Nuclease-free water to resuspend the magnetic beads, and place at room temperature for 2 min, after brief centrifugation, place on the magnetic stand for 2 min to separate the magnetic beads; (8) Take 20 μL of the supernatant into a new 200 μL PCR tube, label it, and place the product at 4°C for use, and store the sample at -20°C.

[0049] S4. Second step PCR amplification; (1) Shake, mix and centrifuge the pathogen first round magnetic bead purification product; (2) Prepare the second step PCR amplification reaction system, mix gently, and centrifuge briefly; the second step PCR amplification reaction system is shown in Table 5; Table 5 Second step PCR amplification reaction system

[0050] (3) Place the prepared second step PCR amplification reaction system into a conventional PCR instrument, and the reaction program is shown in Table 6; Table 6 Second step PCR amplification reaction program

[0051] S5. Second step magnetic bead purification; (1) After the second step PCR amplification is completed, briefly centrifuge the reaction tube, supplement 50 μL of Nuclease-free water, and add 75 μL of DNA purification magnetic beads to the PCR product, mix, and place at room temperature for 5 min; (2) Briefly centrifuge, place the eight-tube tube on the magnetic stand, after the supernatant is completely clear, transfer the supernatant to the PCR tube containing 15 μL of DNA purification magnetic beads, mix well, and stand at room temperature for 5 min; (3) Briefly centrifuge, place the eight-tube tube on the magnetic stand, after the supernatant is completely clear, discard the supernatant, add 200 μL of 80% ethanol, stand for 30 s, discard the supernatant, and repeat the 80% ethanol cleaning once; (4) Centrifuge for 5 s, place the eight-tube tube on the magnetic stand, and discard the residual liquid; (5) Air dry the magnetic beads, add 40 μL of Nuclease-free water to resuspend the magnetic beads, mix well, and stand for 2 min; (6) After briefly centrifuging, place the eight-tube tube on the magnetic stand, and transfer 38 μL of the supernatant to a new low-absorption tube; (7) Shake and mix the purification product, centrifuge instantly, and then measure the DNA concentration to obtain the library library.

[0052] S6. Library mixing and DNB reaction First, mix the library library, and then use the Huada Zhi Zao DNB kit set for DNB reaction to obtain the qualified final product for machine.

[0053] S7. High-throughput sequencer machine sequencing According to the instructions, use the qualified final product of the DNB reaction on the Huada Zhi Zao MGISEQ series sequencer for machine sequencing.

[0054] Test Example 1: High-throughput detection of tuberculosis-related pathogens 1. Experimental method Using the kit and method described in Example 2, known positive samples of Mycobacterium tuberculosis complex, avian Mycobacterium complex, Mycoplasma pneumoniae, Candida albicans, and human herpesvirus type 4 (EBV) within the detection range were detected.

[0055] 2. Experimental results The results are shown in Table 7 below. Using the kit and method described in the application, five known positive samples of Mycobacterium tuberculosis complex, avian Mycobacterium complex, Mycoplasma pneumoniae, Candida albicans, and human herpesvirus type 4 were detected, and the five pathogens were effectively detected, indicating that the kit and method described in the application can accurately detect pathogens within the detection range.

[0056] Table 7: High-throughput detection results of tuberculosis-related pathogens

[0057] Test Example 2: High-throughput detection of tuberculosis-related infection clinical specimens 1. Experimental method Using the kit and method described in Example 2, three clinical specimens of tuberculosis-related infection were detected, and the detection results were compared with the results of the metagenomic detection method.

[0058] 2. Experimental results The results are shown in Table 8 below. The kit and method of the present application can accurately detect tuberculosis-related pathogens within the detection range, and the detection results are consistent with the results of the metagenomic detection method. Compared with the metagenomic detection method, the kit and method of the present application can replace the metagenomic detection method and save costs.

[0059] Table 8 High-throughput detection results of clinical specimens of tuberculosis-related infection

[0060] Test Example 3 High-throughput detection of clinical specimens of Mycobacterium tuberculosis infection 1. Experimental method Using the kit and method described in Example 2, three clinical specimens of Mycobacterium tuberculosis infection were detected, and the detection results were compared with the results of the real-time fluorescent PCR method.

[0061] 2. Experimental results The results are shown in Table 9 below. The kit and method of the present application can accurately detect Mycobacterium tuberculosis within the detection range, and the detection results are accurate.

[0062] Table 9 High-throughput detection results of clinical specimens of Mycobacterium tuberculosis infection

[0063] The above examples are preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples. Any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application are equivalent replacement methods and are included in the protection scope of the present application.

Claims

1. A targeted sequencing primer composition of a tuberculosis associated pathogen, characterized in that, The composition comprises the following components: (1) a sequencing primer targeting Mycobacterium tuberculosis, the sequence of the forward primer being shown in SEQ ID NO. 1, and the sequence of the reverse primer being shown in SEQ ID NO. 2; (2) a sequencing primer targeting Mycobacterium tuberculosis bovine variant vaccine, the sequence of the forward primer being shown in SEQ ID NO. 3, and the sequence of the reverse primer being shown in SEQ ID NO. 4; (3) a sequencing primer targeting Mycobacterium tuberculosis bovine variant, the sequence of the forward primer being shown in SEQ ID NO. 5, and the sequence of the reverse primer being shown in SEQ ID NO. 6; (4) a sequencing primer targeting Mycobacterium tuberculosis African variant, the sequence of the forward primer being shown in SEQ ID NO. 7, and the sequence of the reverse primer being shown in SEQ ID NO. 8; (5) a sequencing primer targeting Mycobacterium tuberculosis goat variant, the sequence of the forward primer being shown in SEQ ID NO. 9, and the sequence of the reverse primer being shown in SEQ ID NO. 10; (6) a sequencing primer targeting Mycobacterium tuberculosis seal variant, the sequence of the forward primer being shown in SEQ ID NO. 11, and the sequence of the reverse primer being shown in SEQ ID NO. 12; (7) a sequencing primer targeting Mycobacterium lepromatosis, the sequence of the forward primer being shown in SEQ ID NO. 13, and the sequence of the reverse primer being shown in SEQ ID NO. 14; (8) a sequencing primer targeting Mycobacterium tuberculosis vole variant, the sequence of the forward primer being shown in SEQ ID NO. 15, and the sequence of the reverse primer being shown in SEQ ID NO. 16; (9) a sequencing primer targeting Mycobacterium shawi, the sequence of the forward primer being shown in SEQ ID NO. 17, and the sequence of the reverse primer being shown in SEQ ID NO. 18; (10) a sequencing primer targeting Mycobacterium canetti, the sequence of the forward primer being shown in SEQ ID NO. 19, and the sequence of the reverse primer being shown in SEQ ID NO. 20; (11) a sequencing primer targeting Mycobacterium tuberculosis complex, the sequence of the forward primer being shown in SEQ ID NO. 21, and the sequence of the reverse primer being shown in SEQ ID NO.

22.

2. The primer composition of claim 1, wherein The composition comprises the following components: (1) a sequencing primer targeting Mycobacterium marinum, the sequence of the forward primer being shown in SEQ ID NO. 23, and the sequence of the reverse primer being shown in SEQ ID NO. 24; (2) a sequencing primer targeting Mycobacterium ulcerans, the sequence of the forward primer being shown in SEQ ID NO. 25, and the sequence of the reverse primer being shown in SEQ ID NO. 26; (3) a sequencing primer targeting Mycobacterium ulcerans group, the sequence of the forward primer being shown in SEQ ID NO. 27, and the sequence of the reverse primer being shown in SEQ ID NO. 28; (4) a sequencing primer targeting Mycobacterium genavense, the sequence of the forward primer being shown in SEQ ID NO. 29, and the sequence of the reverse primer being shown in SEQ ID NO. 30; (5) sequencing primer targeting Mycobacterium haibergense, the forward primer sequence is shown as SEQ ID NO. 31, and the reverse primer sequence is shown as SEQ ID NO. 32; (6) sequencing primer targeting Mycobacterium intermediatum, the forward primer sequence is shown as SEQ ID NO. 33, and the reverse primer sequence is shown as SEQ ID NO. 34; (7) sequencing primer targeting Mycobacterium kubicae, the forward primer sequence is shown as SEQ ID NO. 35, and the reverse primer sequence is shown as SEQ ID NO. 36; (8) sequencing primer targeting Mycobacterium lentiflavum, the forward primer sequence is shown as SEQ ID NO. 37, and the reverse primer sequence is shown as SEQ ID NO. 38; (9) sequencing primer targeting Mycobacterium palustre, the forward primer sequence is shown as SEQ ID NO. 39, and the reverse primer sequence is shown as SEQ ID NO. 40; (10) sequencing primer targeting Mycobacterium parmense, the forward primer sequence is shown as SEQ ID NO. 41, and the reverse primer sequence is shown as SEQ ID NO. 42; (11) sequencing primer targeting Mycobacterium simiae, the forward primer sequence is shown as SEQ ID NO. 43, and the reverse primer sequence is shown as SEQ ID NO. 44; (12) sequencing primer targeting Mycobacterium triplex, the forward primer sequence is shown as SEQ ID NO. 45, and the reverse primer sequence is shown as SEQ ID NO. 46; (13) sequencing primer targeting Mycobacterium triplex, the forward primer sequence is shown as SEQ ID NO. 47, and the reverse primer sequence is shown as SEQ ID NO. 48; (14) sequencing primer targeting Mycobacterium orphium, the forward primer sequence is shown as SEQ ID NO. 49, and the reverse primer sequence is shown as SEQ ID NO. 50; (15) sequencing primer targeting Mycobacterium avium, the forward primer sequence is shown as SEQ ID NO. 51, and the reverse primer sequence is shown as SEQ ID NO. 52; (16) sequencing primer targeting Mycobacterium avium complex, the forward primer sequence is shown as SEQ ID NO. 53, and the reverse primer sequence is shown as SEQ ID NO. 54; (17) sequencing primer targeting Mycobacterium colombiense, the forward primer sequence is shown as SEQ ID NO. 55, and the reverse primer sequence is shown as SEQ ID NO. 56; (18) sequencing primer targeting Mycobacterium intracellulare, the forward primer sequence is shown as SEQ ID NO. 57, and the reverse primer sequence is shown as SEQ ID NO. 58; (19) sequencing primer targeting Mycobacterium intracellulare cymitans, the forward primer sequence is shown as SEQ ID NO. 59, and the reverse primer sequence is shown as SEQ ID NO. 60; (20) sequencing primer targeting Mycobacterium leprae, the forward primer sequence is shown as SEQ ID NO. 61, and the reverse primer sequence is shown as SEQ ID NO. 62; (21) sequencing primer targeting Mycobacterium asiaticum, the sequence of the forward primer is shown as SEQ ID NO. 63, and the sequence of the reverse primer is shown as SEQ ID NO. 64; (22) sequencing primer targeting Mycobacterium botuense, the sequence of the forward primer is shown as SEQ ID NO. 65, and the sequence of the reverse primer is shown as SEQ ID NO. 66; (23) sequencing primer targeting Mycobacterium abscessus, the sequence of the forward primer is shown as SEQ ID NO. 67, and the sequence of the reverse primer is shown as SEQ ID NO. 68; (24) sequencing primer targeting Mycobacterium branderi, the sequence of the forward primer is shown as SEQ ID NO. 69, and the sequence of the reverse primer is shown as SEQ ID NO. 70; (25) sequencing primer targeting Mycobacterium cryptosporidii, the sequence of the forward primer is shown as SEQ ID NO. 71, and the sequence of the reverse primer is shown as SEQ ID NO. 72; (26) sequencing primer targeting Mycobacterium excellentum, the sequence of the forward primer is shown as SEQ ID NO. 73, and the sequence of the reverse primer is shown as SEQ ID NO. 74; (27) sequencing primer targeting Mycobacterium cookii, the sequence of the forward primer is shown as SEQ ID NO. 75, and the sequence of the reverse primer is shown as SEQ ID NO. 76; (28) sequencing primer targeting Mycobacterium abscessus subsp. abscessus, the sequence of the forward primer is shown as SEQ ID NO. 77, and the sequence of the reverse primer is shown as SEQ ID NO. 78; (29) sequencing primer targeting Mycobacterium gordonae, the sequence of the forward primer is shown as SEQ ID NO. 79, and the sequence of the reverse primer is shown as SEQ ID NO. 80; (30) sequencing primer targeting Mycobacterium abscessus subsp. bolletii, the sequence of the forward primer is shown as SEQ ID NO. 81, and the sequence of the reverse primer is shown as SEQ ID NO. 82; (31) sequencing primer targeting Mycobacterium abscessus subsp. massiliense, the sequence of the forward primer is shown as SEQ ID NO. 83, and the sequence of the reverse primer is shown as SEQ ID NO. 84; (32) sequencing primer targeting Mycobacterium chelonae, the sequence of the forward primer is shown as SEQ ID NO. 85, and the sequence of the reverse primer is shown as SEQ ID NO. 86; (33) sequencing primer targeting Mycobacterium salmonipis, the sequence of the forward primer is shown as SEQ ID NO. 87, and the sequence of the reverse primer is shown as SEQ ID NO. 88; (34) sequencing primer targeting Mycobacterium agri, the sequence of the forward primer is shown as SEQ ID NO. 89, and the sequence of the reverse primer is shown as SEQ ID NO. 90; (35) sequencing primer targeting Mycobacterium haemophilum, the sequence of the forward primer is shown as SEQ ID NO. 91, and the sequence of the reverse primer is shown as SEQ ID NO. 92; (36) sequencing primer targeting Mycobacterium haemophilum, the sequence of the forward primer is shown as SEQ ID NO. 93, and the sequence of the reverse primer is shown as SEQ ID NO. 94; (37) sequencing primer targeting Mycobacterium kansasii, forward primer sequence as shown in SEQ ID NO. 95, reverse primer sequence as shown in SEQ ID NO. 96; (38) sequencing primer targeting Mycobacterium diemysinum, forward primer sequence as shown in SEQ ID NO. 97, reverse primer sequence as shown in SEQ ID NO. 98; (39) sequencing primer targeting Mycobacterium lacunae, forward primer sequence as shown in SEQ ID NO. 99, reverse primer sequence as shown in SEQ ID NO. 100; (40) sequencing primer targeting Mycobacterium malmoense, forward primer sequence as shown in SEQ ID NO. 101, reverse primer sequence as shown in SEQ ID NO. 102; (41) sequencing primer targeting Mycobacterium obuense, forward primer sequence as shown in SEQ ID NO. 103, reverse primer sequence as shown in SEQ ID NO. 104; (42) sequencing primer targeting Mycobacterium aurum, forward primer sequence as shown in SEQ ID NO. 105, reverse primer sequence as shown in SEQ ID NO. 106; (43) sequencing primer targeting Mycobacterium mantouxii, forward primer sequence as shown in SEQ ID NO. 107, reverse primer sequence as shown in SEQ ID NO. 108; (44) sequencing primer targeting Mycobacterium neumoniae, forward primer sequence as shown in SEQ ID NO. 109, reverse primer sequence as shown in SEQ ID NO. 110; (45) sequencing primer targeting Mycobacterium africanum, forward primer sequence as shown in SEQ ID NO. 111, reverse primer sequence as shown in SEQ ID NO. 112; (46) sequencing primer targeting Mycobacterium vinteri, forward primer sequence as shown in SEQ ID NO. 113, reverse primer sequence as shown in SEQ ID NO. 114; (47) sequencing primer targeting Mycobacterium canariense, forward primer sequence as shown in SEQ ID NO. 115, reverse primer sequence as shown in SEQ ID NO. 116; (48) sequencing primer targeting Mycobacterium chitae, forward primer sequence as shown in SEQ ID NO. 117, reverse primer sequence as shown in SEQ ID NO. 118; (49) sequencing primer targeting Mycobacterium tusciae, forward primer sequence as shown in SEQ ID NO. 119, reverse primer sequence as shown in SEQ ID NO. 120; (50) sequencing primer targeting Mycobacterium koblenzense, forward primer sequence as shown in SEQ ID NO. 121, reverse primer sequence as shown in SEQ ID NO. 122; (51) sequencing primer targeting Mycobacterium diernii, forward primer sequence as shown in SEQ ID NO. 123, reverse primer sequence as shown in SEQ ID NO. 124; (52) sequencing primer targeting Doramycelamcoccus durancinum, the sequence of the forward primer is shown as SEQ ID NO. 125, and the sequence of the reverse primer is shown as SEQ ID NO. 126; (53) sequencing primer targeting Doramycelamcoccus durancinum, the sequence of the forward primer is shown as SEQ ID NO. 127, and the sequence of the reverse primer is shown as SEQ ID NO. 128; (54) sequencing primer targeting Elephantomyces elephantidis, the sequence of the forward primer is shown as SEQ ID NO. 129, and the sequence of the reverse primer is shown as SEQ ID NO. 130; (55) sequencing primer targeting Mycolicibacter paraseoulensis, the sequence of the forward primer is shown as SEQ ID NO. 131, and the sequence of the reverse primer is shown as SEQ ID NO. 132; (56) sequencing primer targeting Mycolicibacter fallax, the sequence of the forward primer is shown as SEQ ID NO. 133, and the sequence of the reverse primer is shown as SEQ ID NO. 134; (57) sequencing primer targeting Mycolicibacter lyaedensis, the sequence of the forward primer is shown as SEQ ID NO. 135, and the sequence of the reverse primer is shown as SEQ ID NO. 136; (58) sequencing primer targeting Mycolicibacter incidentis, the sequence of the forward primer is shown as SEQ ID NO. 137, and the sequence of the reverse primer is shown as SEQ ID NO. 138; (59) sequencing primer targeting Mycolicibacter frederiksbergensis, the sequence of the forward primer is shown as SEQ ID NO. 139, and the sequence of the reverse primer is shown as SEQ ID NO. 140; (60) sequencing primer targeting Mycolicibacter shahii, the sequence of the forward primer is shown as SEQ ID NO. 141, and the sequence of the reverse primer is shown as SEQ ID NO. 142; (61) sequencing primer targeting Mycolicibacter gadi, the sequence of the forward primer is shown as SEQ ID NO. 143, and the sequence of the reverse primer is shown as SEQ ID NO. 144; (62) sequencing primer targeting Mycolicibacter scrofulaceus, the sequence of the forward primer is shown as SEQ ID NO. 145, and the sequence of the reverse primer is shown as SEQ ID NO. 146; (63) sequencing primer targeting Mycolicibacter luteus, the sequence of the forward primer is shown as SEQ ID NO. 147, and the sequence of the reverse primer is shown as SEQ ID NO. 148; (64) sequencing primer targeting Mycolicibacter goudii, the sequence of the forward primer is shown as SEQ ID NO. 149, and the sequence of the reverse primer is shown as SEQ ID NO. 150; (65) sequencing primer targeting Mycolicibacter hessorgensis, the sequence of the forward primer is shown as SEQ ID NO. 151, and the sequence of the reverse primer is shown as SEQ ID NO. 152; (66) sequencing primer targeting Mycolicibacter houtenae, the sequence of the forward primer is shown as SEQ ID NO. 153, and the sequence of the reverse primer is shown as SEQ ID NO. 154; (67) sequencing primer targeting Mycobacterium holstaie, the forward primer sequence as shown in SEQ ID NO. 155, the reverse primer sequence as shown in SEQ ID NO. 156; (68) sequencing primer targeting Mycobacterium kansasii, the forward primer sequence as shown in SEQ ID NO. 157, the reverse primer sequence as shown in SEQ ID NO. 158; (69) sequencing primer targeting Mycobacterium koreense, the forward primer sequence as shown in SEQ ID NO. 159, the reverse primer sequence as shown in SEQ ID NO. 160; (70) sequencing primer targeting Mycobacterium madagascariense, the forward primer sequence as shown in SEQ ID NO. 161, the reverse primer sequence as shown in SEQ ID NO. 162; (71) sequencing primer targeting Mycobacterium shimegenesis, the forward primer sequence as shown in SEQ ID NO. 163, the reverse primer sequence as shown in SEQ ID NO. 164; (72) sequencing primer targeting Mycobacterium murale, the forward primer sequence as shown in SEQ ID NO. 165, the reverse primer sequence as shown in SEQ ID NO. 166; (73) sequencing primer targeting Mycobacterium surgasi, the forward primer sequence as shown in SEQ ID NO. 167, the reverse primer sequence as shown in SEQ ID NO. 168; (74) sequencing primer targeting Mycobacterium moriokaense, the forward primer sequence as shown in SEQ ID NO. 169, the reverse primer sequence as shown in SEQ ID NO. 170; (75) sequencing primer targeting Mycobacterium mucogenicum, the forward primer sequence as shown in SEQ ID NO. 171, the reverse primer sequence as shown in SEQ ID NO. 172; (76) sequencing primer targeting Mycobacterium paracunicum, the forward primer sequence as shown in SEQ ID NO. 173, the reverse primer sequence as shown in SEQ ID NO. 174; (77) sequencing primer targeting Mycobacterium neocaprae, the forward primer sequence as shown in SEQ ID NO. 175, the reverse primer sequence as shown in SEQ ID NO. 176; (78) sequencing primer targeting Mycobacterium newcastlense, the forward primer sequence as shown in SEQ ID NO. 177, the reverse primer sequence as shown in SEQ ID NO. 178; (79) sequencing primer targeting Mycobacterium obuense, the forward primer sequence as shown in SEQ ID NO. 179, the reverse primer sequence as shown in SEQ ID NO. 180; (80) sequencing primer targeting Mycobacterium pallidoflavum, the forward primer sequence as shown in SEQ ID NO. 181, the reverse primer sequence as shown in SEQ ID NO. 182; (81) sequencing primer targeting Mycobacterium parafortuitum, the forward primer sequence as shown in SEQ ID NO. 183, the reverse primer sequence as shown in SEQ ID NO. 184; (82) sequencing primer targeting Mycolicibacterium phlei, the forward primer sequence is as shown in SEQ ID NO. 185, and the reverse primer sequence is as shown in SEQ ID NO. 186; (83) sequencing primer targeting Mycolicibacterium ranae, the forward primer sequence is as shown in SEQ ID NO. 187, and the reverse primer sequence is as shown in SEQ ID NO. 188; (84) sequencing primer targeting Mycolicibacterium suis, the forward primer sequence is as shown in SEQ ID NO. 189, and the reverse primer sequence is as shown in SEQ ID NO. 190; (85) sequencing primer targeting Mycolicibacterium poriforum, the forward primer sequence is as shown in SEQ ID NO. 191, and the reverse primer sequence is as shown in SEQ ID NO. 192; (86) sequencing primer targeting Mycolicibacterium pulveris, the forward primer sequence is as shown in SEQ ID NO. 193, and the reverse primer sequence is as shown in SEQ ID NO. 194; (87) sequencing primer targeting Mycolicibacterium pyrenovenulosum, the forward primer sequence is as shown in SEQ ID NO. 195, and the reverse primer sequence is as shown in SEQ ID NO. 196; (88) sequencing primer targeting Mycolicibacterium parvum, the forward primer sequence is as shown in SEQ ID NO. 197, and the reverse primer sequence is as shown in SEQ ID NO. 198; (89) sequencing primer targeting Mycolicibacterium arothoei, the forward primer sequence is as shown in SEQ ID NO. 199, and the reverse primer sequence is as shown in SEQ ID NO. 200; (90) sequencing primer targeting Mycolicibacterium minnesotae, the forward primer sequence is as shown in SEQ ID NO. 201, and the reverse primer sequence is as shown in SEQ ID NO. 202; (91) sequencing primer targeting Mycolicibacterium rhodesiae, the forward primer sequence is as shown in SEQ ID NO. 203, and the reverse primer sequence is as shown in SEQ ID NO. 204; (92) sequencing primer targeting Mycolicibacterium rubrum, the forward primer sequence is as shown in SEQ ID NO. 205, and the reverse primer sequence is as shown in SEQ ID NO. 206; (93) sequencing primer targeting Mycolicibacterium smegmatis, the forward primer sequence is as shown in SEQ ID NO. 207, and the reverse primer sequence is as shown in SEQ ID NO. 208; (94) sequencing primer targeting Mycolicibacterium sp., the forward primer sequence is as shown in SEQ ID NO. 209, and the reverse primer sequence is as shown in SEQ ID NO. 210; (95) sequencing primer targeting Mycolicibacterium nonchromogenicum, the forward primer sequence is as shown in SEQ ID NO. 211, and the reverse primer sequence is as shown in SEQ ID NO. 212; (96) sequencing primer targeting Mycolicibacterium peatophilum, the forward primer sequence is as shown in SEQ ID NO. 213, and the reverse primer sequence is as shown in SEQ ID NO. 214; (97) sequencing primer targeting anti-thermo mycolic acid bacillus, the sequence of the forward primer is as shown in SEQ ID NO. 215, and the sequence of the reverse primer is as shown in SEQ ID NO. 216; (98) sequencing primer targeting Seoul National University mycolic acid bacillus, the sequence of the forward primer is as shown in SEQ ID NO. 217, and the sequence of the reverse primer is as shown in SEQ ID NO. 218; (99) sequencing primer targeting soil mycolic acid bacillus, the sequence of the forward primer is as shown in SEQ ID NO. 219, and the sequence of the reverse primer is as shown in SEQ ID NO. 220; (100) sequencing primer targeting East Sea mycolic acid bacillus, the sequence of the forward primer is as shown in SEQ ID NO. 221, and the sequence of the reverse primer is as shown in SEQ ID NO. 222; (101) sequencing primer targeting cow mycolic acid bacillus, the sequence of the forward primer is as shown in SEQ ID NO. 223, and the sequence of the reverse primer is as shown in SEQ ID NO. 224; (102) sequencing primer targeting leprosy Mycobacterium, the sequence of the forward primer is as shown in SEQ ID NO. 225, and the sequence of the reverse primer is as shown in SEQ ID NO. 226; (103) sequencing primer targeting M. massiliense, the sequence of the forward primer is as shown in SEQ ID NO. 227, and the sequence of the reverse primer is as shown in SEQ ID NO. 228; (104) sequencing primer targeting M. parafortuitum, the sequence of the forward primer is as shown in SEQ ID NO. 229, and the sequence of the reverse primer is as shown in SEQ ID NO. 230; (105) sequencing primer targeting M. rhodochrous, the sequence of the forward primer is as shown in SEQ ID NO. 231, and the sequence of the reverse primer is as shown in SEQ ID NO. 232; (106) sequencing primer targeting M. timonense, the sequence of the forward primer is as shown in SEQ ID NO. 233, and the sequence of the reverse primer is as shown in SEQ ID NO. 234; (107) sequencing primer targeting M. tuberculosis, the sequence of the forward primer is as shown in SEQ ID NO. 235, and the sequence of the reverse primer is as shown in SEQ ID NO. 236; (108) sequencing primer targeting M. xenopi, the sequence of the forward primer is as shown in SEQ ID NO. 237, and the sequence of the reverse primer is as shown in SEQ ID NO. 238; (109) sequencing primer targeting M. gastri, the sequence of the forward primer is as shown in SEQ ID NO. 239, and the sequence of the reverse primer is as shown in SEQ ID NO. 240; (110) sequencing primer targeting M. immunogenum, the sequence of the forward primer is as shown in SEQ ID NO. 241, and the sequence of the reverse primer is as shown in SEQ ID NO. 242; (111) sequencing primer targeting M. kumamotoense, the sequence of the forward primer is as shown in SEQ ID NO. 243, and the sequence of the reverse primer is as shown in SEQ ID NO. 244; (112) sequencing primer targeting Mycobacterium bohemicum, the sequence of forward primer is as shown in SEQ ID NO. 245, and the sequence of reverse primer is as shown in SEQ ID NO. 246; (113) sequencing primer targeting Mycobacterium mageritense, the sequence of forward primer is as shown in SEQ ID NO. 247, and the sequence of reverse primer is as shown in SEQ ID NO. 248; (114) sequencing primer targeting Mycobacterium ulcerans, the sequence of forward primer is as shown in SEQ ID NO. 249, and the sequence of reverse primer is as shown in SEQ ID NO.

250.

3. The primer composition of claim 1, wherein Also contains sequencing primer composition targeting bacteria that can cause similar symptoms to tuberculosis after infection, the sequencing primer composition targeting bacteria that can cause similar symptoms to tuberculosis after infection comprises the following components: (1) sequencing primer targeting Acinetobacter baumannii, the sequence of forward primer is as shown in SEQ ID NO. 251, and the sequence of reverse primer is as shown in SEQ ID NO. 252; (2) sequencing primer targeting Burkholderia mallei, the sequence of forward primer is as shown in SEQ ID NO. 253, and the sequence of reverse primer is as shown in SEQ ID NO. 254; (3) sequencing primer targeting Borrelia burgdorferi, the sequence of forward primer is as shown in SEQ ID NO. 255, and the sequence of reverse primer is as shown in SEQ ID NO. 256; (4) sequencing primer targeting Brucella, the sequence of forward primer is as shown in SEQ ID NO. 257, and the sequence of reverse primer is as shown in SEQ ID NO. 258; (5) sequencing primer targeting Klebsiella pneumoniae, the sequence of forward primer is as shown in SEQ ID NO. 259, and the sequence of reverse primer is as shown in SEQ ID NO. 260; (6) sequencing primer targeting Escherichia coli, the sequence of forward primer is as shown in SEQ ID NO. 261, and the sequence of reverse primer is as shown in SEQ ID NO. 262; (7) sequencing primer targeting Klebsiella pneumoniae, the sequence of forward primer is as shown in SEQ ID NO. 263, and the sequence of reverse primer is as shown in SEQ ID NO. 264; (8) sequencing primer targeting Moraxella catarrhalis, the sequence of forward primer is as shown in SEQ ID NO. 265, and the sequence of reverse primer is as shown in SEQ ID NO. 266; (9) sequencing primer targeting Haemophilus influenzae, the sequence of forward primer is as shown in SEQ ID NO. 267, and the sequence of reverse primer is as shown in SEQ ID NO. 268; (10) sequencing primer targeting Proteus mirabilis, the sequence of forward primer is as shown in SEQ ID NO. 269, and the sequence of reverse primer is as shown in SEQ ID NO. 270; (11) sequencing primer targeting Legionella pneumophila, the sequence of forward primer is as shown in SEQ ID NO. 271, and the sequence of reverse primer is as shown in SEQ ID NO. 272; (12) sequencing primer targeting Stenotrophomonas maltophilia, the sequence of forward primer is as shown in SEQ ID NO. 273, and the sequence of reverse primer is as shown in SEQ ID NO. 274; (13) sequencing primer targeting Pseudomonas aeruginosa, the forward primer sequence is shown as SEQ ID NO. 275, and the reverse primer sequence is shown as SEQ ID NO. 276; (14) sequencing primer targeting Leptospira interrogans, the forward primer sequence is shown as SEQ ID NO. 277, and the reverse primer sequence is shown as SEQ ID NO. 278; (15) sequencing primer targeting Acinetobacter baumannii, the forward primer sequence is shown as SEQ ID NO. 279, and the reverse primer sequence is shown as SEQ ID NO. 280; (16) sequencing primer targeting Enterobacter cloacae complex, the forward primer sequence is shown as SEQ ID NO. 281, and the reverse primer sequence is shown as SEQ ID NO. 282; (17) sequencing primer targeting Nocardia brasiliensis, the forward primer sequence is shown as SEQ ID NO. 283, and the reverse primer sequence is shown as SEQ ID NO. 284; (18) sequencing primer targeting Streptococcus pneumoniae, the forward primer sequence is shown as SEQ ID NO. 285, and the reverse primer sequence is shown as SEQ ID NO. 286; (19) sequencing primer targeting Staphylococcus aureus, the forward primer sequence is shown as SEQ ID NO. 287, and the reverse primer sequence is shown as SEQ ID NO. 288; (20) sequencing primer targeting Nocardia abscessus, the forward primer sequence is shown as SEQ ID NO. 289, and the reverse primer sequence is shown as SEQ ID NO. 290; (21) sequencing primer targeting Nocardia farcinica, the forward primer sequence is shown as SEQ ID NO. 291, and the reverse primer sequence is shown as SEQ ID NO. 292; (22) sequencing primer targeting Nocardia saintejeromeana, the forward primer sequence is shown as SEQ ID NO. 293, and the reverse primer sequence is shown as SEQ ID NO. 294; (23) sequencing primer targeting Nocardia surumferi, the forward primer sequence is shown as SEQ ID NO. 295, and the reverse primer sequence is shown as SEQ ID NO. 296; (24) sequencing primer targeting Nocardia asteroides, the forward primer sequence is shown as SEQ ID NO. 297, and the reverse primer sequence is shown as SEQ ID NO. 298; (25) sequencing primer targeting Nocardia asiatica, the forward primer sequence is shown as SEQ ID NO. 299, and the reverse primer sequence is shown as SEQ ID NO. 300; (26) sequencing primer targeting Coxiella burnetii, the forward primer sequence is shown as SEQ ID NO. 301, and the reverse primer sequence is shown as SEQ ID NO. 302; (27) sequencing primer targeting Chlamydia pneumoniae, the forward primer sequence is shown as SEQ ID NO. 303, and the reverse primer sequence is shown as SEQ ID NO. 304; (28) sequencing primer targeting Mycoplasma pneumoniae, the forward primer sequence is shown as SEQ ID NO. 305, and the reverse primer sequence is shown as SEQ ID NO. 306; (29) a sequencing primer targeting Chlamydophila psittaci, wherein a forward primer has the sequence of SEQ ID NO. 307, and a reverse primer has the sequence of SEQ ID NO.

308.

4. The primer composition of claim 1, wherein Also contained is a sequencing primer composition targeting fungi that can cause symptoms similar to tuberculosis after infection, the sequencing primer composition targeting fungi that can cause symptoms similar to tuberculosis after infection comprising the following components: (1) a sequencing primer targeting Candida albicans, wherein a forward primer has the sequence of SEQ ID NO. 309, and a reverse primer has the sequence of SEQ ID NO. 310; (2) a sequencing primer targeting Nakagamiia pranqachibi, wherein a forward primer has the sequence of SEQ ID NO. 311, and a reverse primer has the sequence of SEQ ID NO. 312; (3) a sequencing primer targeting Aspergillus niger, wherein a forward primer has the sequence of SEQ ID NO. 313, and a reverse primer has the sequence of SEQ ID NO. 314; (4) a sequencing primer targeting Aspergillus flavus, wherein a forward primer has the sequence of SEQ ID NO. 315, and a reverse primer has the sequence of SEQ ID NO. 316; (5) a sequencing primer targeting Pichia kudriavzevii, wherein a forward primer has the sequence of SEQ ID NO. 317, and a reverse primer has the sequence of SEQ ID NO. 318; (6) a sequencing primer targeting Candida tropicalis, wherein a forward primer has the sequence of SEQ ID NO. 319, and a reverse primer has the sequence of SEQ ID NO. 320; (7) a sequencing primer targeting Aspergillus terreus, wherein a forward primer has the sequence of SEQ ID NO. 321, and a reverse primer has the sequence of SEQ ID NO. 322; (8) a sequencing primer targeting Cryptococcus neoformans, wherein a forward primer has the sequence of SEQ ID NO. 323, and a reverse primer has the sequence of SEQ ID NO. 324; (9) a sequencing primer targeting Aspergillus fumigatus, wherein a forward primer has the sequence of SEQ ID NO. 325, and a reverse primer has the sequence of SEQ ID NO. 326; (10) a sequencing primer targeting Pneumocystis jirovecii, wherein a forward primer has the sequence of SEQ ID NO. 327, and a reverse primer has the sequence of SEQ ID NO.

328.

5. The primer composition of claim 1, wherein Also contained is a sequencing primer composition targeting DNA viruses that can cause symptoms similar to tuberculosis after infection, the sequencing primer composition targeting DNA viruses that can cause symptoms similar to tuberculosis after infection comprising the following components: (1) a sequencing primer targeting Human herpesvirus 4, wherein a forward primer has the sequence of SEQ ID NO. 329, and a reverse primer has the sequence of SEQ ID NO. 330; (2) a sequencing primer targeting Human herpesvirus 5, wherein a forward primer has the sequence of SEQ ID NO. 331, and a reverse primer has the sequence of SEQ ID NO. 332; (3) a sequencing primer targeting Human adenovirus B, wherein a forward primer has the sequence of SEQ ID NO. 333, and a reverse primer has the sequence of SEQ ID NO. 334; (4) sequencing primer targeting human adenovirus type C, the sequence of the forward primer is shown as SEQ ID NO. 335, and the sequence of the reverse primer is shown as SEQ ID NO. 336; (5) sequencing primer targeting human adenovirus type E, the sequence of the forward primer is shown as SEQ ID NO. 337, and the sequence of the reverse primer is shown as SEQ ID NO.

338.

6. The primer composition of claim 1, wherein Also containing a sequencing primer composition targeting parasites that can cause symptoms similar to tuberculosis after infection, the sequencing primer composition targeting parasites that can cause symptoms similar to tuberculosis after infection comprises the following components: (1) sequencing primer targeting Leishmania donovani complex, the sequence of the forward primer is shown as SEQ ID NO. 339, and the sequence of the reverse primer is shown as SEQ ID NO. 340; (2) sequencing primer targeting Plasmodium, the sequence of the forward primer is shown as SEQ ID NO. 341, and the sequence of the reverse primer is shown as SEQ ID NO. 342; (3) sequencing primer targeting Entamoeba histolytica, the sequence of the forward primer is shown as SEQ ID NO. 343, and the sequence of the reverse primer is shown as SEQ ID NO.

344.

7. The primer composition according to any one of claims 1 to 6, characterized in that, Also containing an internal standard primer, the sequence of the forward primer is shown as SEQ ID NO. 345, and the sequence of the reverse primer is shown as SEQ ID NO.

346.

8. The primer composition according to claim 7, characterized in that, The primers are connected with linker sequences; wherein the sequence of the linker connected with the forward primer is shown as SEQ ID NO. 347, and the sequence of the linker connected with the reverse primer is shown as SEQ ID NO.

348.

9. Use of the primer composition according to any one of claims 1-8 in the preparation of a kit for detecting Mycobacterium tuberculosis and / or non-tuberculosis Mycobacterium.

10. A targeted sequencing kit of a tuberculosis associated pathogen, characterized in that, Containing the primer composition according to any one of claims 1-8.

Images