Method for detecting multi-target gene editing plant based on liquid-phase gene chip

By designing capture probes for liquid-phase chips in the detection of gene editing in wheat and soybeans, the problems of insufficient throughput, sensitivity and cost efficiency in existing technologies have been solved, achieving high-throughput and accurate multi-site detection, which is suitable for distinguishing gene-edited samples from multiple species.

CN121362849APending Publication Date: 2026-01-20INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511661834.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-13
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

Existing DNA sequencing and detection methods have significant shortcomings in terms of throughput, sensitivity, multi-site parallel detection, cross-species adaptability, and cost-effectiveness, and cannot accurately distinguish between edited and unedited samples.

Method used

A liquid-phase chip was designed to detect gene editing in wheat and soybeans by selecting target regions within a range of no more than 300 bp upstream and downstream of the target site on the reference genome and designing capture probes that specifically bind to the target regions.

Benefits of technology

It achieves high-throughput, accurate, efficient, multi-site, and multi-edit type detection, improves sequencing accuracy, reduces detection costs, and is applicable to gene editing detection in multiple species.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a method for detecting a multi-target gene editing plant based on a liquid-phase gene chip. The invention provides a liquid phase chip. The liquid phase chip comprises a capture probe, the capture probe is designed and synthesized according to the following method: a target region is selected within the upstream and downstream range of not more than 300bp at the position of a to-be-detected site on a reference genome, the target region covers the to-be-detected site, and the capture probe is designed for the target region; the number of the to-be-detected sites is one or more; the capture probe specifically binds to the target region. The capture probe disclosed by the invention is high in variation detection sensitivity, generally high in sequencing depth and reliable in result; variation at different positions of different chromosomes can be detected at the same time, and parallel detection is achieved. According to the detection method based on the liquid-phase gene chip, multi-site, multi-sample and cross-species parallel detection can be realized, and single base mutation can be accurately identified.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a method for detecting multi-target gene-edited plants based on liquid-phase gene chips. Background Technology

[0002] Plant gene editing technology is one of the core breakthroughs in modern agricultural technology, promoting efficient and sustainable agricultural development, ensuring food security, and enhancing industrial value. By improving crop traits through gene editing, it is possible to increase crop yield, enhance stress resistance, and improve quality characteristics, thus addressing the pain points of traditional breeding. For example, base editing technology can be used to edit the acetolactate synthase (ALS) and acetyl-CoA carboxylase genes (Rui Zhang et al., Nature Plants (2019) Genetically modified wheat germplasm with herbicide tolerance mutations was generated, conferring tolerance to sulfonylureas, imidazolides, and aryloxyphenoxypropionates. These herbicide tolerance traits provide a potentially powerful tool for weed management. In addition, gene editing of soybean endogenous fatty acid dehydrogenase significantly increased the oleic acid content in soybean seeds, reaching over 80%. Gene sequencing is the core method for validating and assessing the safety of gene-edited plants, mainly used to confirm the precise information of gene editing sites and to determine the existence of off-target effects.

[0003] Currently, the mainstream DNA sequencing technologies include Sanger sequencing, next-generation sequencing (NGS), molecular hybridization, and microarray hybridization, each with its own advantages and disadvantages in terms of throughput, sensitivity, cost, and application scope.

[0004] 1) Sanger sequencing uses the dideoxy chain termination method, which terminates DNA synthesis by introducing dideoxynucleotides (ddNTPs) lacking 3'-OH groups, and separates fragments of different lengths by gel electrophoresis to read the sequence. Although this method is highly accurate, it has low throughput and long cycle time, and is suitable for short fragment sequencing and single point mutation verification. It has insufficient sensitivity for detecting low-frequency mutations (e.g., mutation rate < 1%) and cannot meet the demand for large-scale sequencing. 2) High-throughput sequencing (NGS) can achieve parallel sequencing of a large number of DNA fragments. Although NGS significantly improves sequencing throughput, it still has the following shortcomings: PCR amplification during library construction can introduce errors and increase the proportion of repetitive sequences, resulting in waste of sequencing resources; the read length is short, limiting its effectiveness in complex structural regions or long read length applications; the amount of data is large, requiring high computing resources, storage and analysis capabilities; the parallel detection capability for multiple mutation sites is limited, and false positive results are prone to occur; and cross-species parallel detection is difficult. 3) Molecular hybridization methods include amplification refractory mutation system (ARMS-PCR) and quantitative PCR (qPCR), which are sensitive to single base mutation detection but difficult to achieve simultaneous detection of multiple sites, and require strict primer design and reaction conditions. 4) Chip hybridization techniques include solid-phase chips and liquid-phase chips. Solid-phase chips: probes are fixed on solid supports, and the complementary sequence is determined by hybridization fluorescence intensity, which can achieve multiple SNP detection, but the production process is complex, the development cost is high, and the cycle is long; liquid-phase chips: probes are fixed on microspheres, and are detected by fluorescent dye classification or combined with targeted capture and NGS library construction to improve capture efficiency, but still rely on complex probe design and hybridization condition optimization.

[0005] In summary, the existing sequencing and detection methods have significant shortcomings in throughput, sensitivity, multiple site parallel detection, cross-species adaptability, and cost efficiency, and cannot accurately distinguish between edited and unedited samples.

[0006] Therefore, there is an urgent need to develop a new base editing detection method to distinguish between edited and unedited samples. SUMMARY

[0007] The technical problem solved by the present application is how to identify plant gene editing materials.

[0008] To solve the above technical problems, the first aspect of the present application provides a liquid-phase chip comprising a capture probe; The capture probe is designed and synthesized as follows: a target region is selected within a range of not more than 300 bp upstream and downstream of the position of the to-be-tested site on the reference genome, the target region covers the to-be-tested site, and a capture probe is designed for the target region; the to-be-tested site is one or more; The capture probe specifically binds to the target region.

[0009] In the above, the to-be-tested site can be a site where a target gene is subjected to gene editing, and the target gene subjected to gene editing can be a SNP site mutation or deletion or insertion or replacement of one or more bases.

[0010] The range of not more than 300 bp upstream and downstream of the position where the to-be-tested site is located is a region of not more than 300 bp upstream of the position where the to-be-tested site is located and a region of not more than 300 bp downstream of the position where the to-be-tested site is located.

[0011] In the liquid chip described above, the liquid chip is a chip for detecting wheat, the reference genome is the reference genome of Chinese Spring wheat (Chinese Spring, version CS v1.1), and the to-be-tested site is a site or segment in the acetolactate synthase gene. The capture probe comprises probe A1, probe A2, and probe A3. The nucleotide sequence of the probe A1 comprises sequence 1. The nucleotide sequence of the probe A2 comprises sequence 2. The nucleotide sequence of the probe A3 comprises sequence 3.

[0012] In some embodiments, the nucleotide sequence of the probe A1 is sequence 1.

[0013] In some embodiments, the nucleotide sequence of the probe A2 is sequence 2.

[0014] In some embodiments, the nucleotide sequence of the probe A3 is sequence 3.

[0015] In some embodiments, the wheat described above is common wheat.

[0016] In some embodiments, the liquid chip described above is a chip for detecting whether the acetolactate synthase gene of wheat is subjected to gene editing. The gene editing can be a mutation of the target gene compared with the reference genome, and the mutation can be one or more base mutations. The mutation can be base substitution, deletion, or insertion.

[0017] In the liquid chip described above, the liquid chip is a chip for detecting soybean, the reference genome is the reference genome of Zhonghuang 13 soybean (version number glyma.Zh13.gnm1), and the to-be-tested site is a site or segment in the SoyZH13_10G256800 and / or SoyZH13_20G098800 gene. The capture probe comprises probe B1, probe B2, probe B3, and probe B4. The nucleotide sequence of the probe B1 comprises sequence 4. The nucleotide sequence of the probe B2 comprises sequence 5. The nucleotide sequence of probe B3 includes sequence 6; The nucleotide sequence of probe B4 includes sequence 7.

[0018] In some embodiments, the nucleotide sequence of probe B1 is sequence 4.

[0019] In some embodiments, the nucleotide sequence of probe B2 is sequence 5.

[0020] In some embodiments, the nucleotide sequence of probe B3 is sequence 6.

[0021] In some embodiments, the nucleotide sequence of probe B4 is sequence 7.

[0022] In a second aspect, the present invention provides a probe, which is the capture probe described in the first aspect.

[0023] Thirdly, the present invention provides the application of the probe described in the second aspect in the design, development or preparation of liquid-phase chips for detecting plant gene-editing materials.

[0024] Fourthly, the present invention provides the application of the liquid phase chip described in the first aspect or the probe described in the second aspect in any of the following: C1) Detect whether gene editing has occurred in plant materials or their offspring after gene editing; C2) Distinguish between gene-edited and unedited plant materials; C3) Prepare products to detect whether gene editing has occurred in plant materials or their offspring after gene editing; C4) Prepare products that distinguish between plant gene-edited materials and plant gene-unedited materials.

[0025] Fifthly, the present invention provides a method for detecting whether gene editing has occurred in plant materials or their offspring, comprising the following steps: using the liquid phase chip described in the first aspect to detect whether gene editing has occurred in the plant materials.

[0026] In a sixth aspect, the present invention provides a method for distinguishing between plant gene-edited materials and plant gene-unedited materials, comprising the following steps: using the liquid phase chip described in the first aspect to detect the plant to be tested, thereby distinguishing between plant gene-edited materials and plant gene-unedited materials.

[0027] In some embodiments, the plant is wheat; Alternatively, the plant gene-edited material or the plant to be tested may be wheat or its offspring after gene editing of the small acetyllactate synthase gene; Alternatively, the plant gene-editing material is wheat from which the acetolactate synthase gene has undergone gene editing; or, the plant gene unedited material is a wheat in which acetolactate synthase gene is not genetically edited; or, the liquid chip comprises capture probes comprising the probe A1, the probe A2 and the probe A3 in the first aspect.

[0028] In certain embodiments, the plant is soybean; or, the plant gene edited material or the plant to be tested is a soybean in which SoyZH13_10G256800 and SoyZH13_20G098800 genes are genetically edited or its offspring; or, the plant gene edited material is a soybean in which SoyZH13_10G256800 and SoyZH13_20G098800 genes are genetically edited; or, the liquid chip comprises capture probes comprising the probe B1, the probe B2, the probe B3 and the probe B4 in the first aspect.

[0029] In certain embodiments, whether the wheat gene edited material or its offspring is edited is whether the acetolactate synthase gene in the wheat genome is genetically edited or not.

[0030] In certain embodiments, the genetically edited acetolactate synthase gene is that the acetolactate synthase gene TaALS-A of bread wheat (Triticum aestivum) is genetically edited by mutating the CCC at the position 520441396-520441398 of chromosome 6A in the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) to TTT, mutating the CC at the position 565393903-565393904 of chromosome 6B in the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) to TT in the acetolactate synthase gene TaALS-B, and the nucleotide residues of the acetolactate synthase gene TaALS-D are the same as those in the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1). Triticum Aestivum In certain embodiments, the genetically edited acetolactate synthase gene is that the acetolactate synthase gene TaALS-A of bread wheat (Triticum aestivum) is genetically edited by mutating the CCC at the position 520441396-520441398 of chromosome 6A in the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) to TTT, mutating the CC at the position 565393903-565393904 of chromosome 6B in the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) to TT in the acetolactate synthase gene TaALS-B, and the nucleotide residues of the acetolactate synthase gene TaALS-D are the same as those in the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1).

[0031] In some embodiments, the wheat genome edited for the acetolactate synthase gene is a bread wheat (Triticum aestivum) genome edited for the acetolactate synthase gene TaALS-A, TaALS-B, and TaALS-D, wherein the CCC corresponding to the nucleotide sequence of chromosome 6A at positions 520441396-520441398 of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) is mutated to TTT in the acetolactate synthase gene TaALS-A, the CC corresponding to the nucleotide sequence of chromosome 6B at positions 565393903-565393904 of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) is mutated to TT in the acetolactate synthase gene TaALS-B, and the nucleotide sequence of chromosome 6D of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) is unchanged in the acetolactate synthase gene TaALS-D.

[0032] In some embodiments, the wheat genome edited for the acetolactate synthase gene is a bread wheat (Triticum aestivum) genome edited for the acetolactate synthase gene TaALS-A, TaALS-B, and TaALS-D, wherein the CCC corresponding to the nucleotide sequence of chromosome 6A at positions 520441396-520441398 of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) is mutated to TTT in the acetolactate synthase gene TaALS-A, the CC corresponding to the nucleotide sequence of chromosome 6B at positions 565393903-565393904 of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) is mutated to TT in the acetolactate synthase gene TaALS-B, and the nucleotide sequence of chromosome 6D of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) is unchanged in the acetolactate synthase gene TaALS-D. Triticum Aestivum ) (bread wheat) acetolactate synthase genes TaALS-A, TaALS-B, and TaALS-D, wherein the nucleotide sequence of chromosome 6A of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) is unchanged in the acetolactate synthase gene TaALS-A, the nucleotide sequence of chromosome 6B of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) is unchanged in the acetolactate synthase gene TaALS-B, and the nucleotide sequence of chromosome 6D of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) is unchanged in the acetolactate synthase gene TaALS-D.

[0033] In some embodiments, the soybean genome edited for the SoyZH13_10G256800 and SoyZH13_20G098800 genes is edited for the SoyZH13_10G256800 gene corresponding to the G at position 51849167 of chromosome 10 of the reference genome (version number glyma.Zh13.gnm1) is mutated to GA, and the ATCTATTGGGTTCTCCAAGGTTGCCT at positions 51849113-51849167 of chromosome 10 of the reference genome (version number glyma.Zh13.gnm1) is mutated to GA, and the SoyZH13_20G098800 gene corresponding to the CATGGCCAATCT at position 39643612 of chromosome 20 of the reference genome (version number glyma.Zh13.gnm1) is mutated to C, and the CGA at positions 39643673-39643676 of chromosome 20 of the reference genome (version number glyma.Zh13.gnm1) is mutated to C.

[0034] In some embodiments, the SoyZH13_10G256800 and SoyZH13_20G098800 genes are edited for the SoyZH13_10G256800 gene corresponding to the G at position 51849167 of chromosome 10 of the reference genome (version number glyma.Zh13.gnm1) is mutated to GA, and the ATCTATTGGGTTCTCCAAGGTTGCCT at positions 51849113-51849167 of chromosome 10 of the reference genome (version number glyma.Zh13.gnm1) is mutated to GA, and the SoyZH13_20G098800 gene corresponding to the CATGGCCAATCT at position 39643612 of chromosome 20 of the reference genome (version number glyma.Zh13.gnm1) is mutated to C, and the CGA at positions 39643673-39643676 of chromosome 20 of the reference genome (version number glyma.Zh13.gnm1) is mutated to C.

[0035] In some embodiments, the soybean with gene editing of SoyZH13_10G256800 and SoyZH13_20G098800 is that the G at position 51849167 of chromosome 10 in the SoyZH13_10G256800 gene in the genome of Zhonghuang 42 soybean variety is changed to GA, other nucleotide residues remain unchanged, the ATCTATTGGGTTCTCCAAGGTTGCCT at position 51849113 of chromosome 10 is changed to GA, other nucleotide residues remain unchanged, the CATGGCCAATCT at position 39643612 of chromosome 20 in the SoyZH13_20G098800 gene in the soybean genome is changed to C, other nucleotide residues remain unchanged, and the CGA at position 39643673 of chromosome 20 is changed to C, other nucleotide residues remain unchanged.

[0036] In some embodiments, the soybean with no gene editing of SoyZH13_10G256800 and SoyZH13_20G098800 in the soybean genome is that the SoyZH13_10G256800 gene on chromosome 10 and the SoyZH13_20G098800 gene on chromosome 20 in the soybean genome are unchanged compared with the reference genome (Zhonghuang 13 soybean (version number glyma.Zh13.gnm1)).

[0037] The present application designs capture probes for detecting gene editing materials in different species, and constructs a liquid chip using the capture probes, to achieve the following effects: 1. High-throughput detection Traditional Sanger sequencing or PCR detection methods can only detect a single variation at a time, and it is difficult to cover multiple gene editing regions. The present application designs multiple specific probes in the liquid chip system, which can be designed for multiple sites and simultaneously detect multiple editing targets. It can detect single base variation while detecting multiple types of editing events, and perform precise, efficient, high-specificity, multi-site, and multi-editing type detection. It can simultaneously capture multiple gene editing sites and their adjacent regions in one detection, and perform high-throughput parallel detection.

[0038] 2. Increase the accuracy of data The application effectively improves the sequencing accuracy and the target region coverage, and enhances the reliability of the sequencing results by sequencing the DNA library captured by the liquid phase chip through a high-throughput sequencing platform and through a standardized bioinformatics analysis process. Compared with other sequencing methods, the sequencing coverage uniformity of the application is excellent, the Fold80 value is close to 1.00, and the accuracy of the sequencing data is ensured.

[0039] 3. Saving detection cost and reducing detection design investment Compared with Sanger sequencing and NGS sequencing, the application relies on probe capture of the target region, enriches the target region, and then performs sequencing. The application avoids multiple primer design, reduces the design time required, and does not need to establish a PCR system. Only the target material needs to be processed and the specific probe of the target region needs to be designed, which greatly reduces the reagent use and manual design investment.

[0040] 4. Widely applied to multi-species detection and having universality The application is not only suitable for single-species sequencing, but also can be used for sequencing of multiple species such as wheat and soybean, and is a universal gene editing event detection platform, which provides a reliable detection tool for agricultural molecular design breeding and promotes the development of molecular breeding.

[0041] In summary, the capture probe of the application has high detection sensitivity for variations, generally high sequencing depth, and reliable results. The application can simultaneously detect variations at different positions on different chromosomes and realize parallel detection. The detection method based on the liquid phase gene chip of the application can realize parallel detection of multiple sites, multiple samples, and cross-species, and can accurately identify single-base mutations. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 Probe position distribution and sequencing depth for the soybean gene editing case PROBE25.

[0043] Figure 2 Probe position distribution and sequencing depth for the soybean gene editing case PROBE26.

[0044] Figure 3 Probe position distribution and sequencing depth for the soybean gene editing case PROBE29.

[0045] Figure 4 Probe position distribution and sequencing depth for the soybean gene editing case PREOBE30.

[0046] Figure 5 Probe position distribution and sequencing depth for the wheat gene editing case PREOBE20.

[0047] Figure 6Probe position distribution and sequencing depth of PREOBE21 for wheat gene editing case.

[0048] Figure 7 Probe position distribution and sequencing depth of PREOBE19 for wheat gene editing case. DETAILED DESCRIPTION

[0049] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0050] The experimental methods in the following examples are all routine methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0051] The quantitative tests in the following examples are all set up with three repeated experiments, and the results are averaged, unless otherwise specified.

[0052] Example 1, Preparation of liquid gene chip for detecting wheat ALS gene editing material, establishment of method and detection of application of wheat gene editing I. Preparation of liquid gene chip for detecting wheat ALS gene editing material and establishment of method The acetyl-CoA carboxylase gene on the 3 chromosomes of wheat is named TaALS-A, TaALS-B and TaALS-D, respectively.

[0053] The GeneID of acetyl-CoA carboxylase gene TaALS-A on chromosome 6A of common wheat (Triticum aestivum) is TraesCS6A02G288000 (reference genome is Chinese Spring of common wheat, annotation version is CS v1.1, https: / / plants.ensembl.org / Multi / Search / Results?species=all;idx=;q=TraesCS6A02G288000;site=ensemblunit. Data download link is: http: / / ftp.ensemblgenomes.org / pub / plants / release-53 / fasta / triticum_aestivum / dna / ;), which is located at 6A:520440729-520443099.

[0054] The gene ID of the acetolactate synthase gene TaALS-B on chromosome 6B of common wheat (Triticum aestivum) is TraesCS6B02G317400 (reference genome is common wheat Chinese spring, annotation version is CS v1.1; https: / / plants.ensembl.org / Multi / Search / Results?species=all;idx=;q=TraesCS6B02G317400;site=ensemblunit), located at 6B:565393388-565395328.

[0055] The gene ID of the acetolactate synthase gene TaALS-D on chromosome 6D of common wheat (Triticum aestivum) is TraesCS6D02G268700 (reference genome is common wheat Chinese Spring, annotation version is CS v1.1; https: / / plants.ensembl.org / Multi / Search / Results?species=all;idx=;q=TraesCS6D02G268700;site=ensemblunit), located at 6D:379048509-379051039.

[0056] The wheat gene-editing material is ordinary wheat ( Triticum Aestivum In the TaALS-A acetolactate synthase gene of wheat (common wheat, Chinese Spring, version CS v1.1), the CCC at positions 520441396-520441398 on chromosome 6A is mutated to TTT. In the TaALS-B acetolactate synthase gene, the CC at positions 565393903-565393904 on chromosome 6B is mutated to TT, while other nucleotide residues remain unchanged. In the TaALS-D acetolactate synthase gene, the nucleotide residues on chromosome 6D of the reference genome (common wheat, Chinese Spring, version CS v1.1) remain unchanged.

[0057] The acetolactate synthase gene editing sequence in wheat gene-edited materials is a sequence for editing the acetolactate synthase gene in common wheat ( Triticum AestivumCCC corresponding to positions 520441396-520441398 of chromosome 6A of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) in the acetolactate synthase gene TaALS-A of bread wheat (Triticum aestivum) is mutated to TTT, and CC corresponding to positions 565393903-565393904 of chromosome 6B of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) in the acetolactate synthase gene TaALS-B of bread wheat (Triticum aestivum) is mutated to TT, and the other nucleotide residues are unchanged, and the nucleotide residues in the acetolactate synthase gene TaALS-D corresponding to the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) of chromosome 6D are unchanged, and is denoted as the edited sequence.

[0058] Triticum aestivum (bread wheat) Triticum Aestivum The nucleotide sequences in the acetolactate synthase genes TaALS-A, TaALS-B and TaALS-D of bread wheat (Triticum aestivum) corresponding to the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) are denoted as the unedited sequence.

[0059] This example takes Kenong 199 as an example. The wheat gene editing material edits the acetolactate synthase gene in the Kenong 199 genome to obtain T0 generation gene editing wheat. After sequencing, the T0 generation gene editing wheat is obtained by selfing the plants with a sense mutation in TaALS-A and TaALS-B. The T1 generation gene editing wheat is obtained by selfing the plants without mutation in TaALS-A and TaALS-B in the T0 generation.

[0060] The T1 generation gene editing wheat is selfed to obtain T2 generation homozygous offspring. Sequencing of one T2 generation homozygous offspring shows that the CCC corresponding to positions 520441396-520441398 of chromosome 6A of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) in the acetolactate synthase gene TaALS-A of bread wheat (Triticum aestivum) is mutated to TTT, and CC corresponding to positions 565393903-565393904 of chromosome 6B of the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) in the acetolactate synthase gene TaALS-B of bread wheat (Triticum aestivum) is mutated to TT, and the other nucleotide residues are unchanged, and the nucleotide residues in the acetolactate synthase gene TaALS-D corresponding to the reference genome (Triticum aestivum cv. Chinese Spring, version CS v1.1) of chromosome 6D are unchanged.

[0061] The T2 generation homozygous offspring is selfed to obtain T5 generation homozygous offspring, denoted as TaMu-1, TaMu-2, TaMu-3, TaMu-4.

[0062] T1 generation of gene unedited wheat self-cross, until the T5 generation of homozygous offspring, recorded as TaWT-1, TaWT-2, TaWT-3, TaWT-4.

[0063] 1. Design probes for wild type sequence and edited sequence of gene editing The following multiple factors are considered in the probe design process: probe length, GC content, melting temperature (Tm value), and off-target efficiency, to ensure the stability and specificity of the probe. The design principles of the capture probe are as follows: the GC content index is highly positively correlated with the annealing temperature, and the GC content is preferably selected within the range of 45%-55%; in addition, the specific binding of the probe and the DNA template is checked by blast software, and the probe with high specificity is selected; in addition, the position of the probe in the target region, and the probe close to the target region is preferably selected. A set of scoring rules is obtained, and the probes with high scores are selected for synthesis and used in the next step.

[0064] Three probes are designed for wheat gene editing material detection, as follows: The present application first compares the wild type sequence and the edited sequence of the target gene according to the target gene sequence information, and designs the probe sequence corresponding to the editing region: 100bp is selected as the target region from the editing region of the wheat acetyl lactate synthase gene (TaALS-A, gene number TraesCS6A02G288000) on chromosome 6A; then capture probe PROBE19 is designed according to the target region, and the information is shown in Table 1, and the capture probe is combined with the corresponding target region.

[0065] 100bp is selected as the target region from the editing region of the wheat acetyl lactate synthase gene (TaALS-B, gene number TraesCS6B02G317400) on chromosome 6B; then capture probe PROBE20 is designed according to the target region, and the information is shown in Table 1, and the capture probe is combined with the corresponding target region.

[0066] 100bp is selected as the target region from the corresponding region of the wheat acetyl lactate synthase gene on chromosome 6D according to the similarity of the wheat acetyl lactate synthase gene on chromosome 6A and chromosome 6B; then off-target probe PROBE21 is designed according to the target region, and the information is shown in Table 1, and the off-target probe is combined with the corresponding target region.

[0067] The information of various target probes is shown in Table 1 as follows: Table 1 is the probe sequence of the present example

[0068] The information of various probe target regions is shown in Table 2 as follows: Table 2 capture probe design region information

[0069] 2. Preparation of liquid chip and high-throughput sequencing The probes in Table 1 above are subjected to single-stranded DNA synthesis, and a biotin modification is added to the 5' end to obtain a liquid chip for detecting wheat gene editing materials.

[0070] The genomic DNA of the material to be tested is subjected to ultrasonic or enzyme treatment to form short fragments (250 bp) of appropriate length, and a DNA sequencing library with adaptors is constructed. To prevent non-specific binding of the adaptors to the probes, blocking primers are added for blocking; then the liquid chip for detecting wheat gene editing materials is added to the system, and the complementary target sequences in the library hybridize under appropriate conditions; the complex formed by the probes and the target fragments is captured by streptavidin magnetic beads through the high affinity between biotin and streptavidin, and then the unbound non-target fragments are removed by magnetic separation. The fragments that fail to hybridize to the probes are washed away, and the target fragment DNA is enriched. Subsequently, the enriched product is sequenced by a high-throughput sequencing platform.

[0071] The material to be tested is the homozygous offspring of known wheat gene editing materials and the homozygous offspring of known wheat gene unedited materials. TaMu-1, TaMu-2, TaMu-3, and TaMu-4 are T5 generation homozygous offspring samples (10 mixed samples) of wheat gene editing materials. TaWT-1, TaWT-2, TaWT-3, and TaWT-4 are T5 generation homozygous offspring (10 mixed samples) of wheat gene unedited materials. The T5 generation homozygous offspring of the wheat gene editing material changes the CCC mutation to TTT in the acetyl-CoA synthase gene TaALS-A in the Kenong 199 genome corresponding to the 520441396-520441398 position of chromosome 6A of the reference genome (common wheat Chinese Spring, version CS v1.1), and changes the CC mutation to TT in the acetyl-CoA synthase gene TaALS-B corresponding to the 565393903-565393904 position of chromosome 6B of the reference genome (common wheat Chinese Spring, version CS v1.1), and the other nucleotide residues remain unchanged, and the nucleotide residues in the acetyl-CoA synthase gene TaALS-D corresponding to the reference genome (common wheat Chinese Spring, version CS v1.1) of chromosome 6D remain unchanged.

[0072] The T5 generation homozygous offspring of the wheat gene unedited material is the acetyl-CoA synthase gene TaALS-A, TaALS-B, and TaALS-D in the Kenong 199 genome corresponding to the reference genome (common wheat Chinese Spring, version CS v1.1) unchanged.

[0073] In subsequent applications, the material to be tested can be wheat or its offspring after gene editing on the wheat acetolactate synthase gene.

[0074] In the present application, multiple probes are designed to simultaneously detect multiple sites and efficiently and specifically enrich.

[0075] After sequencing, the sequencing data is analyzed using bioinformatics analysis procedures: first, the sequencing data is quality controlled and low-quality reads are removed. Then the reads are aligned to the reference genome, and the editing event occurrence and InDel situation in the probe targeting region are analyzed, the type and frequency of gene editing events are determined, and low-frequency variations are also captured sensitively. By synchronous verification of the target site and the upstream and downstream coverage area, the sensitivity and accuracy of detection can be improved, and unexpected InDel event occurrence can also be detected.

[0076] The sequencing results of the three probe targeting regions are visualized using IGV visualization software, as shown in Figures 5-7 It can be seen that PROBE19, PROBE20 and PROBE21 can realize detection of wheat gene editing materials.

[0077] II. Liquid chip detection of wheat gene editing materials 1. Liquid chip detection of wheat gene editing materials According to the method of 2 of 1, the prepared liquid chip for detecting wheat gene editing materials is used to detect the wheat to be tested, and the sequencing results of different materials are obtained.

[0078] The wheat to be tested is the homozygous offspring of known wheat gene editing materials and the homozygous offspring of known wheat gene unedited materials.

[0079] TaMu-1, TaMu-2, TaMu-3 and TaMu-4 are respectively T5 generation homozygous offspring samples (10 mixed samples) of wheat gene editing materials.

[0080] TaWT-1, TaWT-2, TaWT-3 and TaWT-4 are respectively T5 generation homozygous offspring (10 mixed samples) of wheat gene unedited materials.

[0081] The T5 generation homozygous offspring of the wheat gene editing material all have the CCC mutation changed to TTT in the acetyl-CoA synthase gene TaALS-A in the Kengen 199 genome corresponding to the 520441396-520441398 position of chromosome 6A of the reference genome (common wheat Chinese Spring, version CS v1.1), and the CC mutation changed to TT in the acetyl-CoA synthase gene TaALS-B corresponding to the 565393903-565393904 position of chromosome 6B of the reference genome (common wheat Chinese Spring, version CS v1.1), and the other nucleotide residues are unchanged, and the nucleotide residues in the acetyl-CoA synthase gene TaALS-D corresponding to the reference genome (common wheat Chinese Spring, version CS v1.1) of chromosome 6D are unchanged.

[0082] The T5 generation homozygous offspring of the wheat gene unedited material all have the acetyl-CoA synthase gene TaALS-A, TaALS-B and TaALS-D in the Kengen 199 genome corresponding to the reference genome (common wheat Chinese Spring, version CS v1.1) unchanged.

[0083] 2, Efficiency verification of capture probe The sequencing results obtained in the above 1 were subjected to the mem module of the bwa software (0.7.17-r1198), and the sequencing data subjected to data cleaning was aligned to the reference genome; the original aligned bam file was subjected to merging, sorting, indexing, etc. by the samtools v1.8 software, to obtain basic alignment data information.

[0084] The capture efficiency of the PROBE19, PROBE20 and PROBE21 probe capture probe is shown in Table 3. It can be seen that the proportion of sequencing data aligned to the genome is 99.96%, and the alignment quality is excellent; since the probe sequence is only used to capture the target sequence in the library, the target sequence is often much longer than the probe binding target region, so the proportion of each sample falling in the probe binding target region is 0.01% on average; considering the upstream and downstream 100bp of the probe binding target region, the proportion falling in the region is 0.08% on average; the depth of each sample falling in the probe binding target region is 402.95 on average, and the coverage of the probe target binding region is 100%; Fold80 is an important index for probe design capture, representing the average sequencing depth multiple required to reach 80% uniform coverage, and is used to measure the uniformity of sequencing. In this experiment, Fold80 is 1.07 on average, and the capture coverage uniformity is very good; and the proportion of target region coverage depth exceeding 90x is 100.00% on average, and the coverage depth and uniformity are very good.

[0085] Table 3 is the capture efficiency statistics of the PROBE19, PROBE20 and PROBE21 probe

[0086] 3. Variant detection The bam file obtained in 1 above, combined with the bed file of the target editing region, was subjected to identification of the SNP / INDEL of the editing region by GATK (v 4.1.2) software and bedtools software.

[0087] The variant detection results of the PEOBE19 and PROBE20 capture probes are shown in Table 4, TaMu-1-4 is a gene editing variety, and TaWT-1-4 is a wild type variety. It can be seen that the base editing product is successfully detected, and no InDel is generated. The specific information of PEOBE19 is as shown in Table 6. Figure 7 , and the specific information of PEOBE20 is as shown in Table 7. Figure 5 .

[0088] Table 4 is the SNP / INDEL results of the target region captured by the PEOBE19 and PROBE20 probes

[0089] In the above table, from left to right, the SNP / INDEL in the captured target region, the physical position, the reference genome base type (the base on the wild type common wheat), the variant base type (the base of the wheat gene editing material), and the variant type of the SNP / INDEL in TaMu-1-4 and TaWT-1-4 are sequentially arranged. In the variant type, the last two numbers represent the read number of the reference genome base type and the variant base type supporting the variant, respectively. For example, “C / C:250,0” indicates that the base type of this material is C / C, and 250 reads support the base type (C) of the reference genome at this position; no read supports the variant base type (T) at this position.

[0090] The variant detection results of the PROBE21 capture probe are shown in Table 5, TaMu-1-4 is a gene editing variety, and TaWT-1-4 is a wild type variety. It can be seen that the base editing product is successfully detected, and no InDel is generated. The specific information is as shown in Table 8. Figure 6 .

[0091] Table 5 is the SNP / INDEL results of the target region captured by the PEOBE21 probe

[0092] In the above table, from left to right, the chromosome on which the SNP / INDEL of the target region is located, the physical position, the reference genome base type (the base of wild type common wheat), the variant base type (the base of the wheat gene editing material), and the variation type of the SNP / INDEL in TaMu-1-4 and TaWT-1-4 are sequentially arranged. In the variation type: the last two numbers represent the read number of the reference genome base type and the variant base type supporting the variation, respectively. For example, "C / C: 250, 0" indicates that the base type of this material is C / C, and 250 reads support the base type (C) of the reference genome at this position; no read supports the variant base type (T) at this position.

[0093] As can be seen from the above, the chip of the application can accurately detect gene edited wheat and gene unedited wheat, and can simultaneously detect off-target effects.

[0094] Example 2, preparation of a soybean gene editing material liquid phase chip, establishment of a method, and application of the soybean gene editing material liquid phase chip in detecting soybean gene editing I. Preparation of a soybean gene editing material liquid phase chip and establishment of a method The Gene ID of SoyZH13_10G256800 on chromosome 10 of soybean is SoyZH13_10G256800 (the reference genome is Zhonghuang 13 soybean, and the version number is glyma.Zh13.gnm1), which is located at 10: 51848550-51850193, see https: / / www.soybase.org / tools / search / gene.html?identifier=SoyZH13_10G2568000&searchSubmit= for details.

[0095] The Gene ID of SoyZH13_20G098800 on chromosome 20 of soybean is SoyZH13_20G098800 (the reference genome is Zhonghuang 13 soybean, and the version number is glyma.Zh13.gnm1), which is located at 20: 39641295-39644694, see https: / / www.soybase.org / tools / search / gene.html?identifier=SoyZH13_20G098800&searchSubmit= for details.

[0096] The soybean gene editing material is that the G mutation corresponding to the 10th chromosome 51849167 in the reference genome (version number is glyma.Zh13.gnm1) in the SoyZH13_10G256800 gene in the soybean genome is changed to GA, other nucleotide residues are unchanged, and the ATCTATTGGGTTCTCCAAGGTTGCCT mutation from the 10th chromosome 51849113 is changed to GA, other nucleotide residues are unchanged, and the CATGGCCAATCT mutation from the 20th chromosome 39643612 in the SoyZH13_20G098800 gene in the soybean genome corresponding to the reference genome (version number is glyma.Zh13.gnm1) is changed to C, other nucleotide residues are unchanged, and the CGA mutation from the 20th chromosome 39643673 is changed to C, other nucleotide residues are unchanged.

[0097] The soybean gene editing material is that the SoyZH13_10G256800 gene and the SoyZH13_20G098800 gene in the soybean genome of the Zhonghuang 42 soybean variety are edited to obtain T0 generation gene editing soybeans, and sequencing shows that the SoyZH13_10G256800 gene and the SoyZH13_20G098800 gene in the T0 generation have sense mutations, and the plants are self-crossed to obtain T1 generation gene editing soybeans, and the plants with TaALS-A and TaALS-B in the T0 generation do not have mutations, and the plants are self-crossed to obtain T1 generation gene editing soybeans.

[0098] The T1 generation gene editing soybeans are self-crossed to obtain T2 generation homozygous offspring, and sequencing of one T2 generation homozygous offspring shows that the G mutation corresponding to the 10th chromosome 51849167 in the reference genome (version number is glyma.Zh13.gnm1) in the SoyZH13_10G256800 gene in the T2 generation gene editing soybean is changed to GA, other nucleotide residues are unchanged, and the ATCTATTGGGTTCTCCAAGGTTGCCT mutation from the 10th chromosome 51849113 is changed to GA, other nucleotide residues are unchanged, and the CATGGCCAATCT mutation from the 20th chromosome 39643612 in the SoyZH13_20G098800 gene in the reference genome (version number is glyma.Zh13.gnm1) is changed to C, other nucleotide residues are unchanged, and the CGA mutation from the 20th chromosome 39643673 is changed to C, other nucleotide residues are unchanged.

[0099] The T2 generation homozygous offspring is self-crossed to obtain T7 generation homozygous offspring, which is recorded as P16-2, P16-3, P16-4, and P16-5.

[0100] T1 generation of gene unedited soybean self-crossing to obtain T7 generation of homozygous offspring, denoted as S1, S2, S3, S4.

[0101] The reference genome is selected from the published ZH13 soybean genome (https: / / ngdc.cncb.ac.cn / gwh / Assembly / 125 / show).

[0102] The soybean variety Zhonghuang 42 contains the SoyZH13_10G256800 and SoyZH13_20G098800 genes, and the sequence is the gene editing wild type sequence, which is the nucleotide sequence of the SoyZH13_10G256800 gene corresponding to the 10th chromosome of the reference genome (version number glyma.Zh13.gnm1) unchanged, and the nucleotide sequence of the SoyZH13_20G098800 gene corresponding to the 20th chromosome of the reference genome (version number glyma.Zh13.gnm1) unchanged. The soybean gene editing material contains the SoyZH13_10G256800 and SoyZH13_20G098800 gene editing sequences, which are the nucleotide sequence of the SoyZH13_10G256800 gene corresponding to the 10th chromosome of the reference genome (version number glyma.Zh13.gnm1) at position 51849167 G mutated to GA, other nucleotide residues unchanged, and the ATCTATTGGGTTCTCCAAGGTTGCCT at position 51849113 of the 10th chromosome mutated to GA, other nucleotide residues unchanged, and the CATGGCCAATCT at position 39643612 of the 20th chromosome of the SoyZH13_20G098800 gene corresponding to the reference genome (version number glyma.Zh13.gnm1) mutated to C, other nucleotide residues unchanged, and the CGA at position 39643673 of the 20th chromosome mutated to C, other nucleotide residues unchanged.

[0103] 1. Design probes for the wild type sequence and the edited sequence The present application compares the wild type sequence and the edited sequence, and designs a probe sequence corresponding to the editing region: 21bp is selected as the target region from the editing region of the SoyZH13_10G256800 gene of the 10th chromosome; then capture probes PROBE25 and PROBE26 are designed according to the target region, the information is shown in Table 6, and the capture probes are combined with the corresponding target region.

[0104] The 21 bp of the editing region of the SoyZH13_20G098800 gene from chromosome 20 was selected as the target region; then the capture probes PROBE29 and PROBE30 were designed according to the target region, and the information is shown in Table 6, and the capture probes are combined with the corresponding target region.

[0105] The information of various probes is shown in Table 6: Table 6 is the probe design information

[0106] 2. Preparation of liquid chip and high-throughput sequencing The probes in Table 6 in the above 1 were subjected to single-stranded DNA synthesis, and biotin modification was added to the 5' end to obtain a liquid chip for detecting soybean gene editing materials.

[0107] The genomic DNA of the material to be tested was subjected to ultrasonic or enzyme treatment to form short fragments (250 bp) with appropriate length, and a DNA sequencing library with a linker was constructed. In order to prevent non-specific binding of the linker to the probe, blocking primers were added for blocking; then the liquid chip for detecting soybean gene editing materials was added to the system, and hybridization occurred between the complementary target sequences in the library under appropriate conditions; the complex formed by the probe and the target fragment was captured by streptavidin magnetic beads through the high affinity between biotin and streptavidin, and then the unbound non-target fragments were removed by magnetic separation; the fragments that failed to hybridize with the probe were washed away, and the target fragment DNA was enriched; then the high-throughput sequencing platform was used to sequence the enrichment product.

[0108] The above-mentioned to-be-tested materials are homozygous offspring of known soybean gene editing materials and homozygous offspring of known soybean gene unedited materials. P16-2, P16-3, P16-4 and P16-5 are respectively T7 generation homozygous offspring samples (10 strains of mixed samples) of soybean gene editing materials. S1, S2, S3 and S4 are respectively T7 generation homozygous offspring (10 strains of mixed samples) of soybean gene unedited materials. The T7 generation homozygous offspring of the soybean gene editing material is that the G mutation corresponding to the 10th chromosome 51849167 in the reference genome (version number is glyma.Zh13.gnm1) in the SoyZH13_10G256800 gene in the Zhonghuang 42 soybean variety genome is changed to GA, other nucleotide residues are unchanged, and the ATCTATTGGGTTCTCCAAGGTTGCCT mutation from the 10th chromosome 51849113 is changed to GA, other nucleotide residues are unchanged, and the CATGGCCAATCT mutation from the 20th chromosome 39643612 in the SoyZH13_20G098800 gene in the soybean genome corresponding to the reference genome (version number is glyma.Zh13.gnm1) is changed to C, other nucleotide residues are unchanged, and the CGA mutation from the 20th chromosome 39643673 is changed to C, other nucleotide residues are unchanged.

[0109] The T7 generation homozygous offspring of the soybean gene unedited material is that the nucleotide sequence of the 10th chromosome in the SoyZH13_10G256800 gene in the Zhonghuang 42 soybean variety genome corresponding to the reference genome (version number is glyma.Zh13.gnm1) is unchanged, and the nucleotide sequence of the 20th chromosome in the SoyZH13_20G098800 gene corresponding to the reference genome (version number is glyma.Zh13.gnm1) is unchanged.

[0110] In subsequent applications, the to-be-tested material can be a soybean or its offspring after gene editing on the soybean SoyZH13_10G256800 and SoyZH13_20G098800 genes.

[0111] In the present application, multiple probes are designed to simultaneously detect multiple editing sites and efficiently and specifically enrich.

[0112] After sequencing, the sequencing data is analyzed by bioinformatics analysis process: first, the sequencing data is subjected to quality control, and low-quality reads are removed. Then, the reads are aligned to the reference genome, and the editing event occurrence and InDel situation in the probe targeting region are analyzed, the type and frequency of gene editing events are determined, and low-frequency variations are also sensitively captured. Through synchronous verification of the target site and the upstream and downstream coverage area, the sensitivity and accuracy of detection can be improved, and unexpected InDel event occurrence can also be detected.

[0113] The sequencing results of the four probe targeting regions were visualized using IGV visualization software.

[0114] The visualization screenshot is shown in Figures 1-4 As can be seen from the visualization screenshot, PROBE25, PROBE26, PROBE29 and PROBE30 can capture the gene editing target for verifying the occurrence of the gene editing event.

[0115] II. Application of soybean gene editing material in liquid chip detection of wheat gene editing 1. Liquid chip detection of soybean gene editing material According to the method of 2 of the above 1, the prepared liquid chip of soybean gene editing material was used to detect the soybean to be tested, and the sequencing results of different materials were obtained.

[0116] The soybean to be tested was the homozygous offspring of the known soybean gene editing material and the homozygous offspring of the known soybean gene unedited material.

[0117] P16-2, P16-3, P16-4 and P16-5 are T7 generation homozygous offspring samples (10 strains of mixed samples) of soybean gene editing materials, respectively.

[0118] S1, S2, S3 and S4 are T7 generation homozygous offspring (10 strains of mixed samples) of soybean gene unedited materials, respectively.

[0119] The T7 generation homozygous offspring of the soybean gene editing material is the soybean variety Zhonghuang 42, in which the G mutation corresponding to the 10th chromosome 51849167 in the reference genome (version number glyma.Zh13.gnm1) in the SoyZH13_10G256800 gene is changed to GA, other nucleotide residues remain unchanged, and the ATCTATTGGGTTCTCCAAGGTTGCCT mutation from the 10th chromosome 51849113 is changed to GA, other nucleotide residues remain unchanged, and the CATGGCCAATCT mutation corresponding to the 20th chromosome 39643612 in the reference genome (version number glyma.Zh13.gnm1) in the SoyZH13_20G098800 gene is changed to C, other nucleotide residues remain unchanged, and the CGA mutation from the 20th chromosome 39643673 is changed to C, other nucleotide residues remain unchanged.

[0120] The T7 generation of the homozygous offspring of the soybean gene unedited material is Zhonghuang 42 variety, and the nucleotide sequence corresponding to the reference genome (version number is glyma.Zh13.gnm1) of the 10th chromosome in the SoyZH13_10G256800 gene in the soybean genome is unchanged, and the nucleotide sequence corresponding to the reference genome (version number is glyma.Zh13.gnm1) of the 20th chromosome in the SoyZH13_20G098800 gene is unchanged.

[0121] 2. Efficiency verification of capture probe The sequencing results obtained in the above 1 were subjected to the mem module of the bwa software (0.7.17-r1198) to align the data cleaning sequencing data to the reference genome; the original aligned bam file was subjected to merging, sorting, indexing, etc. by the samtools v1.8 software to obtain basic alignment data information. The capture efficiency of the capture probe is shown in Table 6. It can be seen that the proportion of sequencing data aligned to the genome is 99.98%, and the alignment quality is excellent; since the probe sequence is only used to capture the target sequence in the library, the target sequence is often much longer than the probe binding target region, so the proportion of each sample falling in the probe binding target region is 1.00% on average; considering the upstream and downstream 100bp of the probe binding target region, the proportion falling in the region is 21.88% on average; the depth of each sample falling in the probe binding target region is 2255.81 on average, and the coverage of the probe binding target region is 97.92%. It is worth noting that the coverage reaches 100% in the wild type sample, which is inferred from the sequencing results that the probe covers the missing part of the short fragment in the library, resulting in a decrease in coverage. For example, PROBE29 detects an 11bp short fragment deletion, and PROBE30 detects a 2bp short fragment deletion, which partially overlaps with the probe binding target region; Fold80 is an important indicator for probe design capture, representing the average sequencing depth fold required to achieve 80% uniform coverage, and is used to measure the uniformity of sequencing. In this experiment, the Fold80 is 1.01 on average, and the capture coverage uniformity is very good; and the proportion of target region coverage depth exceeding 90x is 95.14% on average, and the coverage depth and uniformity are good.

[0122] Table 7 is the capture efficiency statistics of PROBE25, PROBE26, PROBE29 and PROBE30 probes

[0123] 3. Variation event detection The bam file obtained in the above 2 was combined with the bed file of the target editing region, and the SNP / INDEL of the editing region was identified by GATK (v 4.1.2) software and bedtools software.

[0124] The variant event detection results of the capture probes are shown in Table 8, P16-2, P16-3, P16-4, P16-5 are gene editing varieties, and S1, S2, S3 and S4 are wild type varieties. It can be seen that the base editing product is successfully detected by using the application. The specific information of PROBE25 and PROBE30 is shown in the following table Figure 1 and Figure 4 The specific information of PROBE26 and PROBE29 is shown in the following table Figure 2 and Figure 3 .

[0125] Table 8 is the SNP / INDEL results of the target region captured by PROBE25, PROBE26, PROBE29 and PROBE30 probes

[0126] In the above table, from left to right, the SNP / INDEL in the captured target region is in the chromosome, the physical position (the position of the first base as the physical position), the reference genome base type (the base of the wild type soybean), the variant base type (the base of the soybean gene editing material) and the SNP / INDEL variation type in P16-2, P16-3, P16-4 and P16-5. In the variation type, the last two numbers represent the read number of the reference genome base type and the variant base type supporting the variation. For example, "G / G:250,0" indicates that the base type of this material is G / G, of which 250 reads support the base type of this position as the reference genome (G); no read supports the base type of this position as the variant base type (GA); wt / wt represents the base type as the reference genome base type.

[0127] As can be seen from the above, the chip of the application successfully detects a variety of types of variations, including fragment deletion, base insertion or deletion (InDel) and the like. For example, single base insertion, 2bp, 11bp and 25bp short fragment deletion in this example. This example proves that the application has high detection sensitivity for variations, generally high sequencing depth, reliable results; can simultaneously detect multiple different types of variations at different positions, and realize parallel detection.

[0128] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a specific example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. A liquid-phase chip, comprising a capture probe; The capture probe is designed and synthesized as follows: a target region is selected within a range of no more than 300 bp upstream and downstream of the location of the target site on the reference genome, the target region covering the target site, and a capture probe is designed for the target region; the target site may be one or more. The capture probe specifically binds to the target region.

2. The liquid phase chip according to claim 1, characterized in that: The liquid phase chip is a chip used for detecting wheat, the reference genome is the reference genome of Chinese spring wheat, and the site to be tested is a site or segment in the acetolactate synthase gene; The capture probes include probe A1, probe A2, and probe A3. The nucleotide sequence of probe A1 includes sequence 1; The nucleotide sequence of probe A2 includes sequence 2; The nucleotide sequence of probe A3 includes sequence 3.

3. The liquid phase chip according to claim 1, characterized in that: The liquid phase chip is a chip used to detect soybeans, the reference genome is the reference genome of Zhonghuang 13 soybean, and the site to be tested is a site or segment in the SoyZH13_10G256800 and / or SoyZH13_20G098800 gene. The capture probes include probe B1, probe B2, probe B3, and probe B4. The nucleotide sequence of probe B1 includes sequence 4; The nucleotide sequence of probe B2 includes sequence 5; The nucleotide sequence of probe B3 includes sequence 6; The nucleotide sequence of probe B4 includes sequence 7.

4. A probe, which is the capture probe as described in any one of claims 1-3.

5. The use of the probe of claim 4 in the design, development or preparation of liquid-phase chips for detecting plant gene-editing materials.

6. The application of any one of the liquid phase chips of claims 1-3 or the probe of claim 4 in any of the following: C1) Detect whether gene editing has occurred in plant materials or their offspring after gene editing; C2) Distinguish between gene-edited and unedited plant materials; C3) Prepare products to detect whether gene editing has occurred in plant materials or their offspring after gene editing; C4) Prepare products that distinguish between plant gene-edited materials and plant gene-unedited materials.

7. A method for detecting whether gene editing has occurred in plant materials or their progeny, comprising the following steps: using a liquid phase chip according to any one of claims 1-3 to detect whether gene editing has occurred in the plant material.

8. A method for distinguishing between plant gene-edited materials and plant gene-unedited materials, comprising the following steps: using a liquid phase chip as described in any one of claims 1-3 to detect the plant to be tested, thereby distinguishing between plant gene-edited materials and plant gene-unedited materials.

9. The application according to claim 5 or 6, or the method according to claim 7 or 8, characterized in that: The plant in question is wheat; Alternatively, the plant gene-edited material or the plant to be tested may be wheat or its offspring after gene editing of the acetolactate synthase gene; Alternatively, the plant gene-editing material is wheat from which the acetolactate synthase gene has undergone gene editing; Alternatively, the unedited plant gene material is wheat from which the acetolactate synthase gene has not been edited; The liquid-phase chip includes a capture probe, which includes probe A1, probe A2 and probe A3 as described in any one of claims 1-3.

10. The application according to claim 5 or 6, or the method according to claim 7 or 8, characterized in that: The plant in question is soybean; Alternatively, the plant gene-edited material or the plant to be tested may be soybean or its offspring after gene editing of the SoyZH13_10G256800 and SoyZH13_20G098800 genes. Alternatively, the plant gene-editing material is soybean with gene-edited SoyZH13_10G256800 and SoyZH13_20G098800 genes; Alternatively, the unedited plant gene material is wheat in which the SoyZH13_10G256800 and SoyZH13_20G098800 genes have not been edited; The liquid-phase chip includes a capture probe, which includes probe B1, probe B2 and probe B3 as described in any one of claims 1-3.