Application of CAPS molecular marker in identification of bitter gourd pulp thickness
By applying CAPS molecular markers to bitter melon pulp thickness and utilizing nucleotide sequence variation and restriction endonuclease PciI digestion, the problem of low efficiency in traditional identification methods was solved, achieving efficient and accurate pulp thickness identification and improving breeding efficiency.
Patent Information
- Application Number
- CN202511929736.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-19
- Publication Date
- 2026-01-20
- Estimated Expiration
- 2045-12-19
AI Technical Summary
Traditional methods are inefficient and time-consuming in identifying the thickness of bitter melon flesh. There are few reports on the use of CAPS molecular markers in identifying the thickness of bitter melon flesh, which affects breeding efficiency.
A CAPS molecular marker was developed. Primer pairs were designed using a variation at position 222 of the nucleotide sequence shown in SEQ ID NO.2, and the amplified products were digested with the restriction endonuclease PciI. The thickness of bitter melon pulp was identified by electrophoretic analysis.
It has achieved efficient and accurate early identification of bitter gourd flesh thickness, with genotype and phenotype consistency reaching 100%, thus improving the efficiency of genetic breeding.
Smart Images

Figure CN121362853A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular marker assisted breeding, and particularly relates to application of a CAPS molecular marker in identifying fruit flesh thickness of Momordica charantia. BACKGROUND
[0002] Momordica charantia L., also known as cool melon and leprosy melon, is a vine plant of the Cucurbitaceae family Momordica genus, and is mainly planted in tropical and subtropical regions. Momordica charantia is rich in vitamins, amino acids and various bioactive components, has pharmacological effects of antiviral, antitumor and blood sugar lowering, and is praised as a "medicinal vegetable" due to its significant health care and medicinal functions. Momordica charantia Fruit thickness refers to the thickness of the flesh of Momordica charantia, that is, the radial distance between the outer pericarp and the inner cavity (seed cavity) wall, and is one of the key indicators for evaluating the appearance quality and taste quality of Momordica charantia. This trait directly affects the edible value, commodity value and consumer acceptance. Thick-fleshed Momordica charantia usually has a more full, crisp or juicy taste, while thin-fleshed Momordica charantia is prone to dryness and obvious fiberization, and has a relatively low eating quality. In most Asian consumer markets including China, Japan and Southeast Asia, Momordica charantia with thick flesh and full shape is more popular, and the market price is also relatively high, which has become an important intuitive basis for buyers and consumers to judge the quality of Momordica charantia. In addition, under the premise that the single fruit length and transverse diameter are similar, the increase in fruit thickness often means higher single fruit weight and fruit flesh yield rate, which has a positive significance for improving unit area yield. Therefore, fruit thickness is considered as one of the core breeding targets for improving the quality of Momordica charantia, and has important significance for enhancing the economic benefits of the Momordica charantia industry.
[0003] The traditional method for identifying the fruit thickness of Momordica charantia mainly relies on phenotypic selection, which needs to be observed and screened after the fruiting of Momordica charantia, which not only consumes a large amount of time and labor, but also has low efficiency. Molecular marker assisted selection technology provides a new way for the genetic breeding of Momordica charantia. CAPS (Cleaved Amplified Polymorphic Sequences) marker is a molecular marker based on PCR technology, which amplifies genomic DNA by designing specific primers, then cuts the amplified product with a restriction enzyme, and detects the difference in DNA sequence by using the polymorphism of the enzyme digestion fragment length. It has the advantages of simple operation, good stability, high repeatability and easy analysis of results, and has been applied in the genetic breeding of many crops, but there are few reports on the identification of fruit thickness of Momordica charantia. Therefore, developing a CAPS molecular marker closely linked to the fruit thickness of Momordica charantia has important significance for improving the efficiency of genetic breeding of Momordica charantia and accelerating the breeding process of excellent varieties.
[0004] SUMMARY
[0005] In view of the above defects of the prior art, the application provides application of a CAPS molecular marker in identifying thickness of bitter gourd pulp to solve the problems in the background art.
[0006] To achieve the above object, the application provides the following technical scheme. A CAPS molecular marker for identifying thickness of bitter gourd pulp, wherein the CAPS molecular marker is located at position 222 of the nucleotide sequence shown in SEQ ID NO. 2, and a variation between C and CAGTGAA exists at the position.
[0007] A primer pair for amplifying the CAPS molecular marker, wherein the nucleotide sequences of the primer pair are shown in SEQ ID NO. 3 and SEQ ID NO. 4.
[0008] A kit for identifying thickness of bitter gourd pulp, wherein the kit contains the primer pair and the restriction endonuclease PciI.
[0009] Further, the application relates to application of the CAPS molecular marker, the primer pair or the kit in identifying thickness of bitter gourd pulp.
[0010] Further, the skilled in the art can identify the thickness of bitter gourd pulp by the following (I) or (II): (I) sequencing the sequence of SEQ ID NO. 2, if the base at position 222 of the nucleotide sequence shown in SEQ ID NO. 2 is C, the bitter gourd to be tested is thick-fleshed bitter gourd, and if the base at position 222 of the nucleotide sequence shown in SEQ ID NO. 2 is varied to CAGTGAA, the bitter gourd to be tested is thin-fleshed bitter gourd; (II) performing PCR amplification on the SEQ ID NO. 2, and then performing enzyme digestion on the amplification product by using the restriction endonuclease PciI, electrophoresis, and judging the thickness of the bitter gourd pulp according to the electrophoresis result; if bands of 221 bp and 125 bp are produced simultaneously, or bands of 221 bp, 125 bp and 346 bp are produced simultaneously, the bitter gourd to be tested is thick-fleshed bitter gourd; if only a band of 352 bp is produced, the bitter gourd to be tested is thin-fleshed bitter gourd; The thickness of the thick-fleshed bitter gourd is greater than or equal to 1.00 cm, and the thickness of the thin-fleshed bitter gourd is less than or equal to 0.75 cm.
[0011] Further, the application provides a method for identifying thickness of bitter gourd pulp, which comprises the following steps: (1) extracting genomic DNA of bitter gourd to be tested; (2) using the genomic DNA obtained in step (1) as a template, performing PCR amplification by using the primer pair to obtain an amplification product; (3) using restriction endonuclease PciI to cut the amplified product, electrophoresis, and judging the thickness of the fruit of Momordica charantia based on the electrophoresis result; if bands of 221bp and 125bp are generated simultaneously, or bands of 221bp, 125bp and 346bp are generated simultaneously, then the Momordica charantia to be tested is thick-fleshed Momordica charantia; if only bands of 352bp are generated, then the Momordica charantia to be tested is thin-fleshed Momordica charantia.
[0012] Further, 20 μL of PCR reaction system contains: 10 μL 2xHieff PCR Master Mix, 0.5 μL of forward primer and reverse primer respectively, 1 μL of DNA, and 8 μL of ddH2O. The concentration of the forward primer and the reverse primer is 10 μM respectively, and the concentration of the DNA is 50 ng / μL.
[0013] Further, the PCR amplification procedure is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 20 S, annealing at 56 ℃ for 30 S, and extension at 72 ℃ for 30 S, for 35 cycles; extension at 72 ℃ for 10 min, and keeping at 4 ℃ for 5 min.
[0014] Further, the Momordica charantia genomic DNA is derived from Momordica charantia seeds, Momordica charantia plants or Momordica charantia fruits.
[0015] The application also relates to a molecular assisted breeding method of thick-fleshed Momordica charantia varieties, which uses the aforementioned CAPS molecular marker to screen Momordica charantia breeding materials, and selects thick-fleshed Momordica charantia materials for subsequent breeding.
[0016] Compared with the prior art, the application has the following beneficial effects: (1) The application finds that the thin-fleshed Momordica charantia mutant M17 contains 6 base (AGTGAA) insertions at the 12132249th position of chromosome 6 through whole genome resequencing analysis. Further, the expression level of the gene Chr0601420 (the nucleotide sequence of which is shown as SEQ ID NO. 9) at the mutation site is analyzed by qPCR, and it is found that the expression level of the gene in M17 is significantly lower than that in Y52; (2) Based on the insertions, the application develops a CAPS (Cleaved Amplified Polymorphic Sequence) molecular marker based on restriction endonuclease PciI. The results show that the PCR amplification products of all Momordica charantia plants with thicker flesh can be cut into two fragments of 221bp and 125bp or three fragments of 221bp, 125bp and 346bp by PciI, while the single plants with thinner flesh cannot be cut. The genotype consistency rate with the phenotype is 100%.
[0017] (3) The application provides a high-efficiency and accurate molecular marker, which can be used for early identification and assisted selection breeding of the fruit thickness trait of Momordica charantia, and provides important technical support for improving the breeding efficiency of Momordica charantia quality. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 Fig. 1 is a fruit cross-section diagram of the thick-flesh Momordica charantia inbred line Y52 and the thin-flesh Momordica charantia mutant M17; Figure 2 Fig. 3 is a qPCR analysis of the gene expression amount of Chr0601420; Figure 3 Fig. 4 is a CAPS molecular marker analysis of the F3 generation Momordica charantia single plant. DETAILED DESCRIPTION
[0019] In order for those skilled in the art to better understand the technical content of the application, the technical solutions of the application will be further described in detail in combination with specific implementation manners. The process, conditions, experimental methods and reagents for implementing the application are all general knowledge in the art and market conventional products.
[0020] Example 1 1.1 Experimental method Ethyl methanesulfonate is used for seed mutagenesis of the Momordica charantia inbred line Y52 (fruit thickness 1.13 cm), and a thin-flesh Momordica charantia mutant M17 (fruit thickness 0.75 cm) is screened in the M2 generation (see Table 1). Figure 1 The F1 generation is obtained by crossing M17 and the original parent Y52, the F2 generation is obtained by selfing the F1 generation, and the F2 generation segregation population is constructed. 50 thick-flesh Momordica charantia single plants and 50 thin-flesh Momordica charantia single plants are selected from the F2 generation, respectively, the DNA of each single plant is extracted, the DNA concentration is adjusted to be consistent, and then equal amounts are mixed to construct a DNA mixed pool. It is found through whole genome resequencing analysis that the M17 mutant contains 6 bases (AGTGAA) inserted at the 12132249th position of chromosome 6, and there is a site variation (C→CAGTGAA) in this segment which is closely linked to the fruit thickness trait of Momordica charantia.
[0021] SEQ ID NO. 1 (M17) ATCCCACATTCATAACTTTTCAACCCATTTCCTACACGTGAATAGTTAATAAATATTTTTTCTTTTATATTAAAATATTATTTTTTACTATGTTAATAATGCGTAAGATGGGGTTTCACTTTTTAAAATTTTTTTTTTTTTTTGAAATTATTGGGATGACGGCACAATTTTGTTTTATAAATTTTCTTAGTACTTTGGATTTTGATTTTTTGATATGTCAACA GTGAA ATGTGTGTGATATGGAAATTAACAAAAATATGTATTTCTTGATTACTGCATATTGTATTCATGTGAGTCACTAATTTTAACTTAATTTTAACATATTATTTTTTTTAGATTTGACTTCTTAGAT SEQ ID NO. 2 (Y52) ATCCCACATTCATAACTTTTCAACCCATTTCCTACACGTGAATAGTTAATAAATATTTTTTCTTTTATATTAAAATATTATTTTTTACTATGTTAATAATGCGTAAGATGGGGTTTCACTTTTTAAAATTTTTTTTTTTTTTTGAAATTATTGGGATGACGGCACAATTTTGTTTTATAAATTTTCTTAGTACTTTGGATTTTGATTTTTTGATATGTCAA C ATGTGTGTGATATGGAAATTAACAAAAATATGTATTTCTTGATTACTGCATATTGTATTCATGTGAGTCACTAATTTTAACTTAATTTTAACATATTATTTTTTTTAGATTTGACTTCTTAGAT To further verify the effectiveness of CAPS marker, the F2 generation obtained by crossing M17 and Y52 was selfed to produce F3 generation, and 46 single plants with basically consistent fruit thickness were selected from F2 and F3 generations, and the fruit thickness of single plants in F3 generation was counted (Table 1) and CAPS molecular marker analysis (see Figure 3 , Note:The 45th sample in Table 1 was not clear in the initial electrophoresis band, and after repeated experiments, it was verified to produce 221bp, 125bp and 346bp bands). Figure 3
[0022] The CAPS molecular marker analysis method is as follows: (1) Extract the DNA of Momordica charantia using Kangwei Century DNA extraction kit (item number: CW0531M), and adjust the DNA concentration to 50 ng / μL; (2) The primers synthesized by Shanghai Shengong Biological Company are as follows: McChr06_12132249F: ATCCCACATTCATAACTTTTCAACC (SEQ ID NO. 3); McChr06_12132249R: ATCTAAGAAGTCAAATCTAAAAAAA (SEQ ID NO. 4); The primer concentration was diluted to 10 μΜ, and the DNA of Momordica charantia was used as a template for PCR amplification using the above primers. (3) The PCR reaction system was 20 μΐ^: 2 x Hieff PCR Master Mix (Shanghai Yixing Biotechnology Co., Ltd.) 10 μΐ^, forward and reverse primers were 0.5 μΐ^, DNA 1 μΐ^, and ddH2O 8 μΐ^.
[0023] (4) PCR amplification: 94°C pre-denaturation, 5 min; 94°C denaturation, 20 s, 56°C annealing, 30 s, 72°C extension, 30 s, 35 cycles; 72°C extension, 10 min, 4°C incubation for 5 min.
[0024] (5) The PCR product was added to 0.5 μΐ^ of endonuclease PciI, and mixed by blowing and sucking with a pipette. Enzymatic digestion was performed at 37°C overnight.
[0025] (6) 1% agarose gel was prepared, and the enzyme digestion product was analyzed by agarose gel electrophoresis. The fruit thickness of the sample was detected according to the electrophoresis band.
[0026] 1.2 Experimental results The results showed that the PCR amplification products of all F2 single plants with thick fruit (fruit thickness greater than or equal to 1.00 cm) could be digested by PciI into two fragments of 221 bp and 125 bp or three fragments of 221 bp, 125 bp and 346 bp, while the PCR amplification product size of single plants with thin fruit (fruit thickness less than or equal to 0.75 cm) was 352 bp and could not be digested. The consistency rate of genotype and phenotype reached 100%, indicating that the insertion of 6 bases at position 12132249 of chromosome 6 of Y52 plant was closely linked to the thin fruit trait type.
[0027] Table 1 Fruit thickness statistics of F3 single plants
[0028] Further illustration: Based on the above findings, the skilled person can also use conventional sequencing methods to sequence the sequences of SEQ ID NO. 1 and SEQ ID NO. 2 above, and directly identify the thickness of the bitter gourd flesh through the sequencing results. Although the sequencing method is relatively complex (compared to the aforementioned enzyme digestion method), the sequencing technology can provide more accurate and detailed sequence information, and can clearly determine the key sites related to the thickness of the bitter gourd flesh. Therefore, the skilled person can flexibly choose to identify the thickness of the bitter gourd flesh by sequencing or enzyme digestion based on different experimental purposes and experimental conditions.
[0029] Example 2 Expression level of gene Chr0601420 Analysis found that gene Chr0601420 is located upstream of the mutation site described in Example 1, and there may be a strong correlation between the gene and the mutation site. This embodiment further uses qPCR to analyze the effect of the mutation site on the expression level of gene Chr0601420.
[0030] 2.1 Experimental method (1) Use TAKARA's RNA extraction kit (item number: 9769) to extract the RNA of bitter gourd pollinated for 6 days and 10 days, respectively; (2) Take 1 μg of RNA from each sample, and use TOKOYO's reverse transcription kit (item number: FSQ-201) to reverse transcribe the RNA into cDNA, and dilute 5 times with ddH2O; (3) Synthesize the qPCR primers of gene Chr0601420 and the internal reference gene in Shanghai Shengong Biological Company, as follows: Chr0601420-RTF: TCATTATCCGTCGATGCCCA (SEQ ID NO. 5); Chr0601420-RTR: GCAAGCAGAGCAGGTCATAC (SEQ ID NO. 6); McPP2A-RTF: TGTGAGGGACAAAGCTGTGG (SEQ ID NO. 7); McPP2A-RTR: ATGAAACAGCCCACATGCAG (SEQ ID NO. 8); Dilute the primer concentration to 10 μM, use the above primer pair for qPCR reaction with bitter gourd cDNA as the template; (4) The reaction system 10 μL was prepared by using the fluorescence quantitative kit of TAKARA (No. RR420A): cDNA 1 μL, forward and reverse primers (10 μM) 0.2 μL each, DyeII 0.2 μL, 2×Premix EX Taq 5 μL, ddH2O 3.4 μL, and placed in a qPCR instrument; (5) Reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 3 s, 60℃ annealing and extension for 25 s, 40 cycles.
[0031] Each experiment was set for 3 repetitions, the relative expression amount was analyzed by using the ΔΔCt method, and the significance was evaluated by using the single factor variance analysis method.
[0032] 2.2 Experimental results The qPCR analysis result shows that the expression level of the gene in M17 is significantly lower than that in Y52 (see Table 1 for details Figure 2 ).
[0033] The above merely describes the preferred embodiments of the present application and is not intended to limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. Use of a CAPS molecular marker in identifying the thickness of the fruit flesh of Momordica charantia L., characterized by, The CAPS molecular marker is located at position 222 of the nucleotide sequence shown in SEQ ID NO. 2, and a mutation exists between C and CAGTGAA.
2. Use according to claim 1, characterized in that, The thickness of the fruit pulp of Momordica charantia is identified by the following (i) or (ii): (i) sequencing the sequence of SEQ ID NO. 2, if the base at position 222 of the nucleotide sequence shown in SEQ ID NO. 2 is C, the Momordica charantia to be tested is thick-pulp Momordica charantia, and if the base at position 222 of the nucleotide sequence shown in SEQ ID NO. 2 is mutated to CAGTGAA, the Momordica charantia to be tested is thin-pulp Momordica charantia; (ii) PCR amplification of SEQ ID NO. 2, and then cutting the amplification product with restriction endonuclease PciI, electrophoresis, and determining the thickness of the fruit pulp of Momordica charantia according to the electrophoresis result; if bands of 221 bp and 125 bp are produced simultaneously, or bands of 221 bp, 125 bp and 346 bp are produced simultaneously, the Momordica charantia to be tested is thick-pulp Momordica charantia; if only a band of 352 bp is produced, the Momordica charantia to be tested is thin-pulp Momordica charantia; The fruit pulp thickness of the thick-pulp Momordica charantia is greater than or equal to 1.00 cm, and the fruit pulp thickness of the thin-pulp Momordica charantia is less than or equal to 0.75 cm.
3. A primer pair for amplifying the CAPS molecular marker of claim 1, wherein, The nucleotide sequences of the primer pair are shown in SEQ ID NO. 3 and SEQ ID NO.
4.
4. A kit for identifying the thickness of the fruit pulp of Momordica charantia, characterized by, The kit contains the primer pair and the restriction endonuclease PciI according to claim 3.
5. A method for identifying the thickness of the fruit flesh of Momordica charantia L., characterized by, The method comprises the following steps: (1) extracting the genomic DNA of the Momordica charantia to be tested; (2) using the genomic DNA obtained in step (1) as a template, and performing PCR amplification using the primer pair according to claim 3 to obtain an amplification product; (3) cutting the amplification product with restriction endonuclease PciI, electrophoresis, and determining the thickness of the fruit pulp of Momordica charantia according to the electrophoresis result; if bands of 221 bp and 125 bp are produced simultaneously, or bands of 221 bp, 125 bp and 346 bp are produced simultaneously, the Momordica charantia to be tested is thick-pulp Momordica charantia; if only a band of 352 bp is produced, the Momordica charantia to be tested is thin-pulp Momordica charantia; the fruit pulp thickness of the thick-pulp Momordica charantia is greater than or equal to 1.00 cm, and the fruit pulp thickness of the thin-pulp Momordica charantia is less than or equal to 0.75 cm.
6. The method of claim 5, wherein, Each 20 μL of the PCR reaction system contains: 10 μL 2×Hieff PCR Master Mix, 0.5 μL of forward primer and reverse primer respectively, 1 μL of DNA, and 8 μL of ddH2O; the concentrations of the forward primer and the reverse primer are 10 μM respectively, and the concentration of the DNA is 50 ng / μL.
7. The method of claim 5, wherein, The PCR amplification procedure is: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 20 s, annealing at 56 ℃ for 30 s, and extension at 72 ℃ for 30 s, for 35 cycles; extension at 72 ℃ for 10 min, and keeping at 4 ℃ for 5 min.
8. The method of claim 5, wherein, The genomic DNA of Momordica charantia is derived from the seeds, plants or fruits of Momordica charantia.
9. A method of molecular assisted breeding of thick-fleshed Momordica charantia varieties, characterized by, The method according to any one of claims 5-8 is used to screen Momordica charantia breeding materials, and thick-pulp Momordica charantia materials are selected for subsequent breeding.
Citation Information
Patent Citations
Momordica charantia root knot nematode disease resistance SNP marker and application thereof
CN116445644A
Molecular marker, method, primer pair and kit for identifying pulp thickness character of muskmelon and application of molecular marker, method, primer pair and kit
CN117106955A
Molecular marker linked with yellow peel of bitter gourd and application of molecular marker
CN120210424A