NGAstV and GoCV dual MIRA detection primer group, reagent and kit

Abstract

The invention belongs to the technical field of biological detection, and relates to a detection primer group, a reagent and a kit for detecting a novel goose astrovirus (NGAstV) and a goose circovirus (GoCV) by a multi-enzyme constant-temperature rapid amplification technology (MIRA). According to the invention, two dual MIRA detection methods aiming at NGAstV and GoCV are successfully established, and in a basic dual MIRA method, target genes of the two viruses can be simultaneously and stably amplified by reacting for 25 minutes at the constant temperature of 25 DEG C; according to the fluorescent dual MIRA, the FAM and ROX labeled probes are utilized, so that the reaction time of the detection method is further shortened to 20 minutes under the condition of 39 DEG C. The two dual MIRA detection methods have good specificity, the lowest detectable concentrations of NGAstV and GoCV in dual MIRA-qPCR detection are 1 * 10 < 1 > copies / L and 1 * 10 < 2 > copies / L respectively, and the requirements of clinical rapid, convenient, efficient and accurate pathogen detection can be met.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological detection, and particularly relates to a double MIRA detection primer set, reagent and kit for NGAstV and GoCV. BACKGROUND

[0002] Gout disease of gosling is a nutritional metabolic disease characterized by urate metabolic disorder, which is mainly manifested by a large amount of urate deposition in internal organs or joint cavities, and is thus divided into two types of internal organ type and joint type. Novel goose astrovirus (NGAstV) is a major exogenous pathogen causing gout in gosling, and poses the greatest threat to gosling under two weeks old. Gosling at the age of 5-13 days is the period of concentrated outbreak of the disease, and may die 3-7 days after infection, with a high incidence of up to 80% and a mortality rate of more than half. The infection rate of gosling at the age of 20 days decreases sharply, and the symptoms are significantly alleviated. Adult healthy geese, although without obvious symptoms, can become asymptomatic virus carriers. Goose circovirus (GoCV) is an immunosuppressive pathogen that mainly infects host lymphocytes, leading to decreased immune function, and generally does not directly cause animal death, but is prone to cause secondary infection with other pathogens, resulting in death. Geese of different ages, breeds and genders are susceptible to GoCV, and gosling, due to the incomplete development of the immune system, often has more severe symptoms after infection. GoCV and NGAstV are two viruses susceptible to geese, and have a higher risk of infection during the growth stage of gosling. In view of the immunosuppressive properties of GoCV and the potential pathogen of NGAstV causing gout in geese, the two viruses often appear simultaneously in cases, in a co-infection state.

[0003] Multienzyme isothermal rapid amplification (MIRA) is an isothermal amplification technology developed in recent years. Compared with traditional pathogen detection methods, MIRA has many advantages. The technology utilizes the synergistic effect of multiple enzymes to achieve efficient isothermal amplification of nucleic acids in a short time, and the amplification reaction can be completed within 30 min, greatly improving the detection efficiency. However, the development of rapid detection methods and corresponding reagents and kits for NGAstV and GoCV still needs further research. SUMMARY

[0004] As an immunosuppressive pathogen, GoCV causes the immune function of goose flocks to be impaired, and thus increases the risk of secondary infection of NGAstV, and has potential pathogenicity in triggering goose gout. The co-infection of NGAstV and GoCV increases the morbidity and mortality of goose flocks, and increases the difficulty of clinical diagnosis. In order to quickly and simultaneously detect the new goose astrovirus (NGAstV) and the goose circovirus (GoCV), the present inventors propose a method for detecting the new goose astrovirus (NGAstV) and the goose circovirus (GoCV) based on a double multi-enzyme constant temperature rapid amplification technology (MIRA) through extensive research, and develop the corresponding reagent and kit, thereby completing the present application.

[0005] Specifically, in one aspect of the present application, a method for detecting a new goose astrovirus (NGAstV) and a goose circovirus (GoCV) based on a double multi-enzyme constant temperature rapid amplification technology (MIRA) is disclosed, and the method comprises, (1) obtaining virus nucleic acid molecules in a sample to be detected; (2) adding the virus nucleic acid molecules and primer molecules to a MIRA reaction system to obtain a mixture; (3) incubating the mixture of step (2) at 25-40℃ for 20-35 min; (4) detecting the amplification product.

[0006] The primer molecules comprise primers NGAstV-F and NGAstV-R for NGAstV, and primers GoCV-F and GoCV-R for GoCV; wherein the sequence of NGAstV-F is TCTGGCGGATACGACAGATGCGTTACTT, the sequence of NGAstV-R is TCGGCAATGACCCATGCTGTTTCCAATA, the sequence of GoCV-F is GATAACTGACGTGGCCCGGAAGTAC, and the sequence of GoCV-R is TATACCAATCACGCGGCTCCCTATT.

[0007] Preferably, in one embodiment, the reaction time of step (3) is 25 min, 30 min, 35 min, and preferably 25 min. Preferably, in one embodiment, the reaction temperature of step (3) is 25, 30, 35 or 40℃, and preferably 25℃.

[0008] In one aspect of the present application, a primer set for double MIRA detection of new goose astrovirus (NGAstV) and goose circovirus (GoCV) is disclosed, characterized in that the primer set comprises primers for detecting NGAstV and primers for detecting GoCV, wherein the NGAstV primers comprise NGAstV-F and NGAstV-R, the sequence of NGAstV-F is TCTGGCGGATACGACAGATGCGTTACTT, and the sequence of NGAstV-R is TCGGCAATGACCCATGCTGTTTCCAATA; the GoCV primers comprise GoCV-F and GoCV-R, the sequence of GoCV-F is GATAACTGACGTGGCCCGGAAGTAC, and the sequence of GoCV-R is TATACCAATCACGCGGCTCCCTATT.

[0009] In one embodiment, the detection probes are also included in the double MIRA detection, and the probes are NGAstV-P and GoCV-P, wherein the sequence of NGAstV-P is ACACCACAGCTTAAGAAACTCTATGATTGGTA[FAM-dT][THF][BHQ1-dT]TAAAAACCTAGTTGA-[C3spacer], and the sequence of GoCV-P is ggttgcgtcagctgatcgtggagaccgc[ROX-dT]c[THF][BHQ2-dT]gattggaagacgga-[C3spacer].

[0010] In the probes, FAM-dT and ROX-dT are fluorescent reporter groups, BHQ1-dT and BHQ2-dT are fluorescent quenching groups, and C3Spacer is a group that prevents polymerase extension or amplification. The fluorescent reporter group in the probe provides a reversible fluorescent signal, the fluorescent quenching group achieves efficient quenching, THF regulates the distance through conformational change, and target detection is achieved in cooperation. Through such design, the specificity and sensitivity of molecular detection can be significantly improved.

[0011] In one aspect of the present application, a reagent for double MIRA detection of new goose astrovirus (NGAstV) and goose circovirus (GoCV) is disclosed, and the reagent comprises the primer set described above. In one embodiment, the reagent also comprises the probes described above. Those skilled in the art can understand that, for MIRA detection, the reagent also comprises enzymes, buffers, and sterile double distilled water for PCR amplification.

[0012] In one aspect of the present application, a kit for detecting a novel goose astrovirus (NGAstV) and goose circovirus (GoCV) by double MIRA is disclosed, the kit comprising the primer set described above, and in one embodiment, the kit further comprises the probe described above. Those skilled in the art can understand that, for MIRA detection, the reagent further comprises enzymes, buffers, sterile double distilled water for PCR amplification, and instructions for how to perform double MIRA detection. Advantages

[0013] (1) The core advantage of the established basic and fluorescent double MIRA detection technology of the present application lies in the combination of isothermal amplification and multiplex detection, realizing the simultaneous, isothermal and rapid amplification of NGAstV and GoCV double targets; the traditional PCR usually takes more than 2 hours, while the double MIRA detection method only takes 20-25 minutes, reducing the cost of diagnosis time and significantly improving the efficiency of pathogen detection.

[0014] (2) The nucleic acid amplification process of the method of the present application does not require repeated temperature changes, has low requirements for instruments and equipment, and is convenient for popularization at the grassroots level; the amplification product can distinguish NGAstV and GoCV single or mixed infection through the color difference of fluorescence imaging, providing a more intuitive method for clinical diagnosis. The double MIRA detection technology has the advantages of good specificity, high sensitivity, rapid reaction, simple operation, low equipment cost, etc., and is especially suitable for grassroots laboratories. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 , using recombinant plasmids pUC57-NGAstV and pUC57-GoCV as templates, the primers and probes were verified by single MIRA and MIRA-qPCR methods. Among them, (A) verification of basic MIRA primers for NGAstV and GoCV, M is a DNA molecular weight marker (DL2000), 1-4 are GoCV, NGAstV, GoCV negative control and NGAstV negative control, respectively; (C, D) verification of MIRA-qPCR primers and probes for NGAstV and GoCV, 1 and 2 are standard plasmids and negative controls, respectively; (B) MIRA-qPCR fluorescence imaging of NGAstV and GoCV, 1-4 are pUC57-GoCV plasmid, pUC57-NGAstV plasmid, GoCV negative control, and NGAstV negative control, respectively.

[0016] Figure 2, Optimization of reaction temperature and time of basic double MIRA, where (A) optimization of reaction time, M is DNA molecular weight marker (DL2000), 1-5 are 15 min, 20 min, 25 min, 30 min, 35 min, respectively; (B) optimization of reaction temperature, M is DNA molecular weight marker (DL2000), 1-6 are 15℃, 20℃, 25℃, 30℃, 35℃, 40℃, respectively.

[0017] Figure 3 , Six viruses (AIV-H9, FAdV-4, DEV, MDRV, DTMUV and GPV) were used to evaluate the specificity of basic double MIRA and double MIRA-qPCR method. Among them, (A) specificity of NGAstV and GoCV double basic MIRA method, M is DNA molecular weight marker (DL2000), 1-11 are NGAstV+GoCV (standard plasmid), NGAstV+GoCV, NGAstV, GoCV, GPV, DTMUV, MDRV, FAdV-4, DEV, AIV-H9, negative control, respectively; (B) specificity of NGAstV and GoCV double MIRA-qPCR method, 1-10 are GoCV, NGAstV, GoCV+NGAstV, AIV-H9, DEV, FAdV-4, MDRV, GPV, DTMUV, negative control, respectively; (C) fluorescence imaging map, 1-10 are GoCV+NGAstV, NGAstV, GoCV, AIV-H9, DEV, FAdV-4, MDRV, GPV, DTMUV, negative control, respectively.

[0018] Figure 4 , 10-fold dilution of plasmid as template was used to evaluate the sensitivity of double MIRA detection. Among them (A) specificity of NGAstV and GoCV double basic MIRA method, M is DNA molecular weight marker (DL2000), 1-7 are 1×10 7 copies / µL-1×10 1 copies / µL of NGAstV and GoCV mixed standard plasmid, 8 is negative control; (B) sensitivity of NGAstV and GoCV double MIRA-qPCR, 1-7 are 1×10 7 copies / µL-1×10 1 copies / µL of NGAstV and GoCV mixed standard plasmid, 8 is negative control; (C) fluorescence imaging map, 1-7 are 1×10 7 copies / µL-1×10 1copies / µL of NGAstV and GoCV mixed standard plasmid, 8 is negative control. DETAILED DESCRIPTION

[0019] In order to make the objects, technical solutions and advantages of the present application clearer, the present application will be further described in detail below in combination with embodiments. The equipment and reagents used in each embodiment and test example can be obtained from commercial channels unless otherwise specified. The reagents used in the present application are all analytical grade reagents unless otherwise specified. The specific embodiments described herein are only used to explain the present application and do not limit the present application.

[0020] Sources of materials used in the present application: New goose astrovirus (NGAstV), goose circovirus (GoCV), goose parvovirus (GPV), duck Tembusu virus (DTMUV), H9 subtype avian influenza virus (AIV-H9), duck plague virus (DEV), avian adenovirus type 4 (FAdV-4), and muscovy duck reovirus (MDRV) were all preserved by the Institute of Animal Husbandry and Veterinary Medicine, Anhui Academy of Agricultural Sciences. The clinical samples were suspected NGAstV and GoCV infected waterfowl samples sent by waterfowl farms in Anhui Province. Example 1 1.1 Design and synthesis of primers and probes

[0021] In order to obtain a better diagnostic target of NGAstV and GoCV, EditSeq and Megalign software were used to analyze and compare multiple sequences of NGAstV and GoCV. Finally, the conserved nucleotide region of the gene of NGAstV (NCBI accession number: OM273303.1) ORF1b and the highly conserved Rep gene sequence of GoCV (NCBI accession number: MG649068.1) were used to design MIRA primer pairs and probes. All primers and probes were synthesized by Shengong Bioengineering (Shanghai) Co., Ltd. The specific information is shown in Table 1.

[0022] Table 1 NGAstV and GoCV MIRA primers and probes ; 1.2 Extraction of RNA and DNA

[0023] Commercial viral DNA / RNA nucleic acid co-extraction kit was used to extract viral nucleic acid. Commercial cDNA first strand synthesis kit was used to reverse transcribe RNA samples into cDNA. All nucleic acids were stored at -80℃. 1.3 Preparation of standard plasmid

[0024] The NGAstV and GoCV target gene sequences were connected to the pUC57 vector by ShangHai Bioengineering Co., Ltd. to synthesize pUC57-NGAstV and pUC57-GoCV standard plasmids, which were stored at -20°C for standby. 1.4 Establishment of MIRA detection method

[0025] The basic MIRA detection used a commercial basic DNA isothermal rapid amplification kit (Weifang Amp Future Biotechnology Co., Ltd., WLB8201KIT). Each 50 µL duplex reaction system was: buffer A 29.4 µL, each pair of upstream and downstream primers 1 µL (10 µM), each DNA template 2.5 µL, ddH2O 9.1 µL, buffer B 2.5 µL. The reaction solution was heated at 39°C for 30 min, the resulting product was mixed with 8 μL 6×Loading buffer loading buffer, heated in a 56°C water bath for 5 min, then 5 μL of the mixture was subjected to 2% agarose gel electrophoresis, and the optimal primers were selected according to the detection results.

[0026] The duplex MIRA-qPCR detection used a commercial fluorescent DNA isothermal rapid amplification kit (Weifang Amp Future Biotechnology Co., Ltd., WLE8202KIT). Each 50 µL duplex reaction system included: buffer A 29.4 µL, each pair of upstream and downstream primers 1 µL (10 µM), probe 0.3 µL (10 µM), DNA template 2.5 µL, ddH2O 8.5 µL, buffer B 2.5 µL. The mixture was transferred to the reaction tube, and the fluorescence quantitative instrument was used for amplification at 39°C for 20 min, and the fluorescence was detected once every 30 sec. After the reaction was completed, the Ct value, amplification curve and fluorescence imaging results were observed, and the feasibility of the primer pair and probe was verified according to the detection results.

[0027] Results, see Figure 1 As shown in Figure 1 , the primers of NGAstV and GoCV in the basic MIRA method produced amplicons consistent with the expected size, and the amplification efficiency was good. The MIRA-qPCR detection results showed that the primer pairs of the two viruses had typical "S" amplification curves ( Figure 1 Figs. B and C), and the fluorescence imaging function showed that GoCV single positive amplification showed red fluorescence, and NGAstV single positive amplification showed green light ( Figure 1 Fig. D). The negative controls had no non-specific amplification and showed colorless transparent state under fluorescence imaging. Therefore, the primer pairs and probes can be used for the establishment of the subsequent duplex MIRA method. 1.5 Optimization of basic duplex MIRA method

[0028] The effects of different temperatures (15, 20, 25, 30, 35 and 40℃) and times (15, 20, 25, 30 and 35 min) on the basic dual MIRA method were set to determine the optimal reaction conditions, and the specific reaction system is shown in Section 1.4.

[0029] Results: see Figure 2 As shown in Figure 2 A, the double-target purpose band appeared after 15 min of reaction; the band brightness was enhanced at 20 min; the amplification reached the plateau after 25 min of reaction, and there was no obvious difference in the brightness of the bands amplified at 25, 30 and 35 min. Considering the detection efficiency and energy economy, 25 min was selected as the optimal reaction time of NGAstV and GoCV basic dual MIRA. As shown in Figure 2 B, the amplification band appeared from 20℃, and the amplification effect at 25, 30, 35 and 40℃ was better than that at 20℃, but there was no obvious difference in the amplification efficiency of these four groups of temperature, so 25℃ was selected as the optimal reaction temperature of the basic dual MIRA. 1.6 Specificity test of two MIRA detection methods

[0030] The nucleic acids of AIV-H9, FAdV-4, DEV, MDRV, DTMUV and GPV were used as templates to evaluate the specificity of the basic dual MIRA and dual MIRA-qPCR reaction, and ddH2O was used as negative control for each detection, and the specific reaction system is shown in Section 1.4.

[0031] Results: see Figure 3 As shown in Figure 3 A and 3B, both dual MIRA detection methods could detect NGAstV and GoCV mixed infection and single infection, and had no cross reaction with other pathogens, and there was no amplification in the negative control; using the fluorescence imaging function, the positive amplification product of dual MIRA-qPCR NGAstV and GoCV mixed infection showed yellow, and NGAstV and GoCV single infection showed green and red respectively Figure 3 C). The test results showed that the specificity of the two detection methods was good. 1.7 Sensitivity test of two MIRA detection methods

[0032] The pUC57-NGAstV and pUC57-GoCV plasmids were diluted by 10 times with ddH2O, and the copy number was 1×10 9 copies / µL to 1×10 1copies / µL of two plasmid mixture as template, ddH2O as negative control, to detect the sensitivity of basic double MIRA and double MIRA-qPCR reaction, and determine the minimum detection concentration of two detection methods.

[0033] Results: see Figure 4 As shown in Figure 4 A, the minimum detection limit of NGAstV and GoCV of basic double MIRA method was 1×10 2 copies / µL and 1×10 3 copies / µL, respectively. 2 The results of GoCV and NGAstV double MIRA-qPCR detection showed that the minimum detection limit of GoCV was 1×10 1 copies / µL, while the detection sensitivity of NGAstV was higher, and the minimum detection limit could reach 1×10 Figure 4 copies / µL.

[0034] The double MIRA-qPCR detection method showed that the fluorescence intensity of the amplification product was gradiently attenuated with the decrease of template concentration in fluorescence imaging. In the range of 1×10 7 -1×10² copies / µL dilution, it showed typical yellow fluorescence characteristics of mixed infection. When the copy number of GoCV and NGAstV plasmid was reduced to 1×10¹ copies / µL, double MIRA-qPCR system only detected NGAstV, showing a single green fluorescence signal. Figure 4 1.8 Evaluation of clinical samples

[0035] In order to verify the clinical applicability of the two double MIRA detection methods established, 50 clinical samples suspected to be infected with NGAstV and GoCV were detected. The positive detection rates of NGAstV and GoCV nucleic acids of three detection methods were compared, and the positive amplification products were sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing and analysis verification.

[0036] ​The results are shown in Table 2. The positive detection rates of the basic double MIRA and double MIRA-qPCR methods were the same. There were 18 cases of GoCV positive detection (detection rate of 36.0%), 15 cases of NGAstV positive detection (30.0%), and 9 cases of mixed infection samples (18.0%). In contrast, the traditional PCR method showed 16 cases of GoCV positive detection (32.0%), 12 cases of NGAstV positive detection (24.0%), and 8 cases of mixed infection (16.0%). The two double MIRA detection methods established in this study improved the sensitivity of target pathogen detection compared with the traditional PCR method. At the same time, the method is simple in operation process and short in reaction time, and is more suitable for efficient detection of the two pathogens in production.

[0037] Table 2 Comparison of detection results of clinical samples ; In summary, the present application successfully establishes two double MIRA detection methods for NGAstV and GoCV. In the basic double MIRA method, the target genes of the two viruses can be stably amplified at 25℃ for 25 min. The fluorescence double MIRA uses FAM and ROX labeled probes to further shorten the reaction time to 20 min at 39℃. Both double MIRA detection methods have good specificity. Double MIRA-qPCR realizes rapid and intuitive interpretation of NGAstV and GoCV single or mixed infection samples through fluorescence imaging technology. NGAstV and GoCV mixed infection shows yellow, NGAstV or GoCV single infection shows green or red, respectively. The minimum detection concentration of NGAstV and GoCV in double MIRA-qPCR detection is 1×10 1 copies / µL and 1×10 2 copies / µL, respectively, which is 10 times higher than the detection limit of the two viruses in the basic double MIRA. This may be related to the difference in probe design and signal amplification. In the detection of 50 clinical samples, the positive detection rates of the two double MIRA detection methods remain the same, and the sensitivity is better than that of the traditional PCR method, which can meet the needs of rapid, convenient, efficient and accurate detection of pathogens in clinical practice.

[0038] The above content is a further detailed description of the present application in combination with the specific embodiments, which cannot be considered as limiting the specific implementation of the present application to these descriptions. For ordinary skilled persons in the technical field to which the present application belongs, without departing from the concept of the present application, a number of simple deductions or substitutions can be made, which should be considered as belonging to the protection scope determined by the claims submitted by the present application.

Claims

1. A primer set for the detection of novel goose astrovirus (NGAstV) and goose circovirus (GoCV) by duplex MIRA, characterized in that, The primer set comprises primers for detecting NGAstV and primers for detecting GoCV, wherein the NGAstV primers comprise NGAstV-F and NGAstV-R, the sequence of NGAstV-F is TCTGGCGGATACGACAGATGCGTTACTT, and the sequence of NGAstV-R is TCGGCAATGACCCATGCTGTTTCCAATA; the GoCV primers comprise GoCV-F and GoCV-R, the sequence of GoCV-F is GATAACTGACGTGGCCCGGAAGTAC, and the sequence of the GoCV-R primer is TATACCAATCACGCGGCTCCCTATT.

2. The primer set according to claim 1, characterized in that, The primer set further comprises probes, which are NGAstV-P and GoCV-P, wherein the sequence of NGAstV-P is ACACCACAGCTTAAGAAACTCTATGATTGGTA[FAM-dT][THF][BHQ1-dT]TAAAAACCTAGTTGA-[C3spacer], and the sequence of GoCV-P is ggttgcgtcagctgatcgtggagaccgc[ROX-dT]c[THF][BHQ2-dT]gattggaagacgga-[C3spacer].

3. Use of the primer set of claim 1 in the preparation of a reagent for detecting novel goose astrovirus (NGAstV) and goose circovirus (GoCV).

4. Use of the primer set of claim 1 in the preparation of a kit for detecting novel goose astrovirus (NGAstV) and goose circovirus (GoCV).

5. A reagent for the detection of novel goose astrovirus (NGAstV) and goose circovirus (GoCV) in a duplex MIRA assay, characterized in that, The reagent comprises the primer set of claim 1 or claim 2.

6. A kit for the detection of novel Goose Astrovirus (NGAstV) and Goose circovirus (GoCV) by duplex MIRA, characterized in that, The reagent comprises the primer set of claim 1 or claim 2.

7. A method for detecting novel goose astrovirus (NGAstV) and goose circovirus (GoCV) by double multi-enzyme isothermal rapid amplification technology (MIRA), characterized in that, The method comprises, (1) obtaining viral nucleic acid molecules in a sample to be detected; (2) adding the viral nucleic acid molecules and the primer set of claim 1 to a MIRA reaction system to obtain a mixture; (3) incubating the mixture of step (2) at a constant temperature of 25-40℃ for 20-35 min; (4) detecting the amplification product.

8. The method of claim 7, wherein, The temperature in step (3) is 25, 30, 35 or 40℃; and the reaction time is 25 min, 30 min or 35 min.

Images