Respiratory syncytial virus mRNA vaccine

By introducing a specific mutation into the F protein of RSV A2 strain and combining it with mRNA vaccine technology, the problem of conformational instability of the F protein was solved, achieving efficient antigen expression and immune response, especially the enhancement of neutralizing antibodies and T cell responses.

CN121378427APending Publication Date: 2026-01-23SOUTH CHINA UNIV OF TECH +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511496022.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-20
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

The pre-fusion conformation of the F protein in existing RSV vaccines is not stable enough, resulting in low antigen expression efficiency and an inability to effectively induce efficient neutralizing antibodies and cellular immune responses.

Method used

By introducing mutations such as N67I, S215P, I379V, and M447V into the amino acid sequence of the F protein of RSV A2 strain, the pre-fusion conformational stability of the F protein was enhanced. The protein was then expressed using mRNA vaccine technology and combined with a lipid nanoparticle delivery system to improve antigen expression efficiency and immunogenicity.

Benefits of technology

It enhanced the pre-fusion conformational stability of the RSV F protein, improved antigen expression efficiency, induced significant neutralizing antibody titers and a strong cellular immune response, which is superior to traditional vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121378427A_ABST
    Figure CN121378427A_ABST
Patent Text Reader

Abstract

The invention discloses a respiratory syncytial virus mRAN vaccine, and belongs to the technical field of biological medicines. The invention provides the F protein mutant of the prefusion conformation in the respiratory syncytial virus (RSV) with the amino acid sequence shown as SEQ ID NO.1, the stability of the F protein of the prefusion conformation of the RSV is enhanced, the antigen expression efficiency is improved, and stronger cellular immune response can be induced. And corresponding mRNA is constructed based on the F protein mutant, so that the immune to the respiratory syncytial virus can be realized, and the F protein mutant has wide applicability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of biomedical technology, specifically relating to a respiratory syncytial virus mRNA vaccine. Background Technology

[0002] Respiratory syncytial virus (RSV) is a common respiratory virus belonging to the genus Pneumovirus in the family Paramyxoviridae. It is a single-stranded negative-sense RNA virus. It is mainly transmitted through droplets and close contact and is highly contagious.

[0003] Previous studies have shown that the pre-fusion conformation of the RSV F protein is a key target for inducing high-titer neutralizing antibodies. The NIH-designed DS-Cav1 vaccine, a recognized RSV prevention strategy, relies on structural modification techniques to stabilize the pre-fusion F protein, thereby effectively inducing neutralizing antibody production (McLellan, JS et al. Structure-Based Design of a Fusion Glycoprotein Vaccine for Respiratory Syncytial Virus. Science 342, 592–598 (2013)). Current RSV vaccine construction generally employs molecular engineering techniques to conformate the F protein, ensuring its stability in the pre-fusion state to maximize the preservation of antigenic epitopes and thus induce highly efficient neutralizing antibody production. Therefore, continuously developing new modification techniques to improve the stability of the pre-fusion conformation of the F protein is essential.

[0004] Furthermore, mRNA vaccines, by delivering mRNA into cells and expressing original conformational antigens, induce cellular immunity through MHC-I / II class presentation and, through interaction with B cells, induce a certain degree of humoral immunity. Compared to traditional vaccine preparation technologies, mRNA vaccines, with sufficient antigen information, can shorten the vaccine prototype preparation, proof-of-concept, and process development to within a few months, achieving extremely high yields and shorter production cycles, thus meeting the vaccination and control needs of large-scale outbreaks. Summary of the Invention

[0005] In view of this, the primary objective of this application is to provide a pre-fusion respiratory syncytial virus (RSV) F protein, based on the wild-type F protein of RSV A2 strain. A key amino acid is introduced into its amino acid sequence to prevent the F protein from changing from its pre-fusion conformation to its post-fusion conformation after expression, thereby enhancing the stability of the pre-F protein conformation. This protein is then used as an immunogen to prepare a RSV mRNA vaccine, improving antigen expression efficiency and inducing a stronger cellular immune response.

[0006] To achieve the above objectives, this application adopts the following technical solution: One aspect of this application discloses the F protein, which is a fusion of pre-respiratory syncytial virus, and the amino acid sequence of the F protein is shown in SEQ ID NO.1, and is named IPVV in this application.

[0007] Another aspect of this application discloses the use of the F protein as an immunogen in the preparation of vaccines.

[0008] Another aspect of this application discloses isolated mRNA containing a coding region that encodes the F protein.

[0009] Another aspect of this application discloses isolated DNA capable of transcribing the mRNA.

[0010] Another aspect of this application discloses a recombinant expression vector containing the aforementioned DNA.

[0011] Another aspect of this application discloses a recombinant host cell containing the said DNA or the said recombinant expression vector.

[0012] Another aspect of this application discloses a respiratory syncytial virus mRNA vaccine composition, said mRNA vaccine composition comprising: mRNA expressing a respiratory syncytial virus immunogen, said mRNA as described above; And mRNA vaccine vectors.

[0013] Another aspect of this application discloses the use of the foregoing mRNA, DNA, recombinant expression vector, recombinant host cell, or mRNA vaccine composition in the preparation of a medicament, wherein the medicament is used for: a: Prevention of respiratory syncytial virus; b: Inducing specific antibodies against respiratory syncytial virus in mammals; c: Induces T-cell responses against respiratory syncytial virus in mammals.

[0014] The beneficial effects of this application are: The RSV pre-F protein provided in this application enhances its pre-fusion conformational stability and increases the expression of the pre-fusion conformational pre-F protein.

[0015] The mRNA vaccine provided in this application can induce significant RSV neutralizing antibodies, and the final neutralizing antibody titer is high, which can induce a specific cellular immune response. Attached Figure Description

[0016] Figure 1 The results are from capillary electrophoresis assays to determine mRNA purity. Figure 1 In the diagram, A stands for RNA Ladder. Figure 1 B in this application is an IPVV candidate sequence. Figure 1 C in the middle is Ds-Cav1.

[0017] Figure 2 The particle size test results are for the finished mRNA vaccine product (LNP-mRNA) DS-Cav1 and IPVV in this application. Figure 2 A represents the particle size distribution of DS-Cav1 and IPVV in this application. Figure 2 In section B, the average value of particle size and PDI was measured in three parallel measurements for each sample.

[0018] Figure 3 mRNA stock solution was transfected into 293T cells. The target protein in the preF conformation was labeled using RSV preF-specific antibodies (AM14 and D25), and the expression level of the target protein was detected by flow cytometry. Figure 3 China A and Figure 3 B represents the percentage of positive cells labeled with AM14 antibody and D25 antibody, respectively. Figure 3 C and Figure 3 D represents the average fluorescence intensity of positive cells labeled with AM14 antibody and D25 antibody, respectively.

[0019] Figure 4 The levels of preF-specific antibodies in the serum of mice immunized with different mRNA vaccines.

[0020] Figure 5 This demonstrates the use of ELISpot to detect IFN-γ secretion levels of RSV F protein in mouse spleen cells, at a rate of 2.5 × 10⁻⁶. 5 Spot-forming units (SFUs) produced in spleen cells were used as an indicator to assess cellular immune responses induced by different vaccines. Figure 5 Image A shows the dot pattern generated in the wells of the Elispot plate after stimulation with specific antigens in the PBS group, Ds-Cav1 group, and IPVV group. Figure 5 Figure B shows the statistical results of the number of spots generated in the PBS group, Ds-Cav1 group, and IPVV group. Detailed Implementation

[0021] The embodiments of this application will be clearly and completely described below. The technical solutions in the embodiments described below are exemplary and only possible technical implementations of this application, not all possible implementations. Those skilled in the art can combine the embodiments of this application to obtain other embodiments without creative effort, and these embodiments are also within the protection scope of this application.

[0022] The first aspect of this application discloses the F protein of pre-fusion respiratory syncytial virus (RSV), referred to herein as IPVV, which is a mutant of the pre-fusion F protein of RSV. Specifically, the wild-type (WT) amino acid sequence of the pre-fusion F protein of RSV is shown below: (574nt).

[0023] The known amino acid sequence of the F protein Ds-Cav1 in the prior art is shown below: (574nt).

[0024] The F protein IPVV of this application is obtained by mutating certain amino acid sites based on the wild-type F protein sequence. The specific mutation sites are N67I, S215P, I379V, and M447V. The amino acid sequence of the mutated F protein IPVV is shown in SEQ ID NO.1.

[0025] The mutation design in this application disrupts the conversion trend of the pre-fusion F protein to the post-fusion conformation, locks the antigen in the pre-F state, thereby improving antigen expression efficiency, enhancing humoral immune response, and inducing a stronger T cell immune response.

[0026] The second aspect of this application discloses the application of the F protein described in the first aspect of this application as an immunogen in vaccine preparation. Specifically, after engineering the F protein before RSV fusion, the nucleic acid sequence is optimized using elements such as coding gene codons, 5'UTR, and 3'UTR that are already disclosed in the art or independently developed by the applicant, thereby obtaining mRNA with good stability, capable of effective in vivo and in vitro protein expression, and enhancing the immunogenicity of the antigen.

[0027] The third aspect of this application discloses an isolated mRNA containing a coding region that encodes the F protein described in the first aspect of this application.

[0028] In some specific examples, the nucleotide sequence of the mRNA coding region is shown in SEQ ID NO.2.

[0029] It is understood that the isolated mRNA contains not only coding regions but also some necessary elements, such as 5' cap elements, 5' UTR elements, 3' UTR elements, stop codons, and polyA tail elements, but is not limited to these. The selection of each element and the specific nucleotide sequence can be designed according to the actual needs of those skilled in the art, without any particular restrictions.

[0030] In some specific examples, the mRNA is operatively linked in sequence by the following elements: 5' cap element, 5' UTR element, coding region, 3' UTR element, and polyA tail element.

[0031] In this application, the term "operable link" refers to a connection in which the described element is in a relationship that allows it to function in its intended manner. An "operable link" to a control sequence of a coding sequence is a connection made in a manner that enables the expression of the coding sequence to be achieved under conditions compatible with the control sequence. The sequence of the "operable link" includes an expression control sequence adjacent to the relevant gene and an expression control sequence that functions trans- or at a distance to control the expression of said relevant gene.

[0032] In some specific examples, the mRNA further includes modifications such as N1-methyl-pseudouridine, N6-methyladenosine, pseudouridine, or 5-methylcytidine. As a preferred example, the mRNA is modified with pseudouridine (Ψ), thereby reducing immune recognition and prolonging the mRNA half-life.

[0033] As a preferred example, the full-length nucleotide sequence of the mRNA is shown in SEQ ID NO.3.

[0034] The fourth aspect of this application discloses isolated DNA capable of transcribing the isolated mRNA described in the third aspect of this application.

[0035] In some specific examples, the DNA contains a nucleotide sequence encoding the F protein as shown in SEQ ID NO.4.

[0036] This application further discloses a recombinant expression vector and a recombinant host cell, wherein the recombinant expression vector contains the DNA described in the fourth aspect of this application. The recombinant host cell contains either the DNA or the recombinant expression vector.

[0037] In this application, the term "recombinant expression vector" refers to a DNA molecule used to express a target gene or protein in a host cell. There is no particular limitation on its specific type; it can be of types well-known in the art, including but not limited to plasmids, viruses, and bacteria. The term "recombinant host cell" refers to a cell into which a foreign gene has been introduced through genetic engineering techniques, enabling it to express a specific protein. There are no particular restrictions on the type of host cell; it can be a prokaryotic host cell, a typical example being *Escherichia coli*; or a eukaryotic host cell, typical examples being yeast and mammalian cells (such as CHO cells).

[0038] The fifth aspect of this application discloses a respiratory syncytial virus mRNA vaccine composition, said mRNA vaccine composition comprising: mRNA expressing a respiratory syncytial virus immunogen, said mRNA being as described in the third aspect of this application; And mRNA vaccine vectors.

[0039] mRNA is prepared into an mRNA vaccine using mRNA vaccine vectors known in the art or developed in-house, thereby achieving effective delivery of mRNA.

[0040] As a typical example, the mRNA vaccine carrier is a lipid nanoparticle. In this application, the lipid nanoparticle is not particularly limited or required, and can be lipid nanoparticles known in the art or developed independently by the applicant. Typically, the lipid nanoparticle comprises: (i) cationic lipids (ii) a lipid combination selected from at least one lipid selected from neutral auxiliary lipids, polyethylene glycol modified lipids, and sterols.

[0041] The requirements for lipid nanoparticles generally involve encapsulating mRNA within fine lipid particles to effectively deliver and release the mRNA into the cytoplasm. Furthermore, the particle size of the lipid nanoparticles should not increase after storage for a certain period (e.g., 1 month, 1.5 months, or 3 months), demonstrating excellent physical stability. In this application, the term "cationic lipid" refers to a lipid molecule that carries a net positive charge under physiological pH conditions. Specific examples include, but are not limited to, DOTMA (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride), DOTAP (1,2-dioleoyl-3-trimethylammonium propane), DDAB (dimethyloctadecylammonium bromide), DC-Chol (cholesterol derivative), DOSPA (dioleoylphosphatidylethanolamine-polyethyleneimine), DOGS (bisoctadecylamide glycylcarboxylic acid spermamine), DLin-KC2-DMA, DLin-MC3-DMA (commercial lipid MC3), KL10, KL22, Octyl-CLinDMA, Lipofectin®, Lipofectamine®, etc. It is understood that any one of these cationic lipids may be selected individually, or a mixture of two or more may be used.

[0042] In this application, the term "neutral auxiliary lipid" refers to phospholipids that exist in an uncharged form or as neutral zwitterions at physiological pH. Specific examples include, but are not limited to, dioleoylphosphatidylethanolamine (DOPE), palmitoylphosphatidylcholine (POPC), lecithinylcholine (EPC), dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), distearateylphosphatidylcholine (DSPC), arachidoylphosphatidylcholine (DAPC), bis(docosahexadecylphosphatidylcholine) (DBPC), bis(docosahexadecylphosphatidylcholine) (DLPC), dioleoylphosphatidylcholine (DOPC), sphingomyelin, ceramide, dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), phosphatidylethanolamine (POPE), and dioleoylphosphatidylethanolamine 4-(N-maleimidemethyl)-cyclohexane-1-carboxylate (DOPE-mal). It is understood that neutral co-adjuvant lipids can be selected individually, or a combination of two or more of these can be used.

[0043] In this application, the polyethylene glycol-modified lipids can be any type commonly found in the art, and specific examples include, but are not limited to, PEG2000-dimyristylglycerol (PEG2000-DMG), PEG2000-dispalmitoylglycerol (PEG2000-DPG), PEG2000-distearylglycerol (PEG2000-DSG), PEG5000-dimyristylglycerol (PEG5000-DMG), PEG5000-dispalmitoylglycerol (PEG5000-DPG), PEG5000-distearylglycerol (PEG5000-DSG), N-[(methoxy-poly(ethylene glycol)2000)carbamoyl]-1,2-dimyristyloxypropyl(oxylpropyl)-3-amine (PEG-cDMA), R-3-[(ω-methoxy-poly(ethylene glycol)]...

[2000] Carbamoyl-1,2-dimyristyloxypropyl-3-amine (PEG-C-DOMG), polyethylene glycol (PEG)-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), etc. Examples of PEG-dialkyloxypropyl include PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-distearyloxypropyl, PEG-distearyloxypropyl, etc. It is understood that polyethylene glycol-modified lipids can be used alone, or in mixtures of two or more.

[0044] In this application, the term "sterol" refers to an alcohol having a steroid backbone. Specific examples include, but are not limited to, cholesterol, dihydrocholesterol, lanosterol, β-sitosterol, campesterol, stigmasterol, rapeseed sterol, ergosterol, fucosterol, 3β-[N-(N',N'-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol), etc. It is understood that sterols may be used alone or in combination of two or more.

[0045] There are no particular limitations or requirements on the composition of each lipid in lipid nanoparticles; proportions known in the art or suitable proportions determined experimentally can be used. In some specific examples, the total lipid content in the lipid nanoparticles is used as the metric, wherein the molar percentage of neutral auxiliary lipids is 0-50%, preferably 0-40%, more preferably 0-30%; the molar percentage of polyethylene glycol-modified lipids is 0-30%, preferably 0-20%, more preferably 0-10%; and the molar percentage of sterols is 0-90%, preferably 10%-80%, more preferably 20%-50%.

[0046] In this application, the lipid components in the lipid nanoparticles can be combined arbitrarily. In a typical example, the lipid nanoparticles contain cationic lipids, DSPC, cholesterol, and DMG-PEG2000 in a molar ratio of 50:10:38.5:1.5.

[0047] Furthermore, there are no special requirements for the average particle size of the lipid nanoparticles. A value known in the art can be used or a suitable particle size can be determined through experiments. For example, the particle size of the lipid nanoparticles is 10~1000nm, preferably 30~500nm, and more preferably 30~200nm.

[0048] Furthermore, it is understood that there are no particular restrictions on the preparation of mRNA vaccines; they can be prepared using methods known in the field or methods developed independently.

[0049] As an example, the mRNA vaccine in this application can be prepared by referring to the following steps: Gene cloning: The target sequence is cloned into a plasmid vector, and positive clones containing the target gene are obtained through single-clone selection and sequencing verification. The positive clone strains are fermented and plasmids are extracted to obtain circular plasmid templates. Preparation of in vitro transcription (IVT) template: The circular plasmid was linearized by restriction endonuclease digestion, and the linearized plasmid was purified and used as the starting template for mRNA synthesis. mRNA synthesis and purification: Using linearized plasmids as templates, the target mRNA is synthesized through in vitro transcription (IVT) and then purified to obtain high-purity mRNA molecules. Preparation and purification of LNP-mRNA lipid nanoparticle complex: The purified mRNA stock solution and four types of LNPs (lipid nanoparticles) were mixed in a microfluidic device to form an mRNA-LNP complex; the mRNA-LNP complex was diluted with PBS and concentrated by ultrafiltration to obtain the mRNA vaccine formulation.

[0050] In microfluidic operations, the mRNA dilution solution used can be either citrate-sodium citrate buffer (pH 3.5~5.0) or acetate-sodium acetate buffer (pH 3.5~5.0).

[0051] The microfluidic crude product can be preserved using Tris-HCl or PBS. Preferably, in this invention, a cryoprotectant is added to the final product preservation solution to effectively improve the preservation stability of the mRNA vaccine. The cryoprotectant can be sucrose, trehalose, or levoglucoside, preferably with a v / w ratio of 2% to 50%.

[0052] This application further discloses the use of the mRNA, the DNA, the recombinant expression vector, the recombinant host cell, or the mRNA vaccine composition in the preparation of a drug, wherein the drug is used for: a: Prevention of respiratory syncytial virus; b: Inducing specific antibodies against respiratory syncytial virus in mammals; c: Induces T-cell responses against respiratory syncytial virus in mammals.

[0053] It is understood that the mammals in this application include, but are not limited to, humans, rats, rabbits, sheep, etc., and as an example, the mammals in this application are humans or rats.

[0054] The following are specific embodiments of this application. It should be noted that the specific embodiments below are for illustrative purposes only and do not limit the scope of this application in any way.

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the specification of this application is for the purpose of describing particular embodiments only and is not intended to be limiting of this application.

[0056] In addition, unless otherwise specified, methods without detailed conditions or steps are conventional methods, and the reagents and materials used are commercially available.

[0057] In the following examples, all DNA fragments involved were commissioned synthesized, and the mRNA used was prepared according to the following method: A third party was commissioned to synthesize a DNA fragment encoding the pre-fusion RSV pre-F protein (its nucleotide sequence is shown in SEQ ID NO. 4), which was then cloned into the pIVT plasmid to obtain the recombinant plasmid, named pIVT-RSV-F-preF-IPVV in this application. Sequencing confirmed the sequence was correct. Using the plasmid as a template, the plasmid was linearized by digestion with the restriction endonuclease Mlu I (37°C, 2 hours), and the linearized plasmid was recovered and purified.

[0058] Perform the in vitro transcription IVT response as follows: Modified mRNA was prepared by one-pot (co-transcription and capping) in vitro transcription, using the T7 in vitro transcription kit (Novizan) with a 60 μL reaction system as an example: First, prepare the IVT reaction solution: Add 3 μg of linearized DNA template (approximately 15 ng / μL final concentration), 6 μL of 10×T7 reaction buffer, 5 mM of NTP mixture (ATP, CTP, GTP, ΨTP), 5 mM of Cap analog (e.g., CleanCap AG), 6 μL of T7 RNA polymerase mixture, and 1.5 μL (~40 U) of RNase inhibitor. Add RNase-free water to a final volume of 60 μL. After mixing, incubate at 37°C for 2 hours for in vitro transcription (this can be extended to 4 hours if necessary). Then add 3 μL of DNase I and continue incubating at 37°C for 10 minutes to degrade the template DNA.

[0059] Before using VAHTS RNA Clean Beads for RNA purification, remove the magnetic beads from 2–8°C and equilibrate at room temperature for 30 minutes, ensuring thorough resuscitation by inverting or vortexing. Add 1.8 times the volume of the original RNA solution (e.g., 108 μL) of RNA Clean Beads, mix thoroughly by pipetting 10 times, and incubate at room temperature for 5 minutes to encourage RNA binding to the beads. Place the mixture on a magnetic rack and incubate for 5 minutes until the solution becomes clear, then carefully discard the supernatant. Keeping the beads on the rack, add 200 μL of freshly prepared 80% ethanol (prepared with RNase-free water) to wash, incubate at room temperature for 30 seconds, and discard the supernatant; repeat this washing step twice. Then, air-dry the beads for 5–10 minutes (avoiding over-drying), add an appropriate amount of RNase-free water (generally 10–20 μL, pH 7.0) to elute the RNA, mix by pipetting 10 times, and incubate at room temperature for 5 minutes. Finally, place the tube back on the magnetic rack for 5 minutes, then transfer the clear supernatant to a new tube; this is the purified RNA product.

[0060] It should be noted that RNA has poor stability; it is recommended to store it at -20°C for a short period or use it immediately for downstream reactions.

[0061] RNA concentration was detected using Nanodrop (A260 / A280 = 1.9-2.1), aliquoted into 1 mL vials, and stored at -80°C (purity test results are shown in the image). Figure 1 As shown in the figure, the results indicate that the molecular weights of IPVV and Ds-Cav1 are as expected, and their purities are both greater than 90%.

[0062] The amino acid sequence of the pre-fusion RSV F protein (IPVV) is shown in SEQ ID NO.1. The nucleotide sequence of the mRNA encoding IPVV is shown in SEQ ID NO.2, and the full-length nucleotide sequence of the prepared mRNA is shown in SEQ ID NO.3.

[0063] The nucleotide sequences of other elements in the mRNA are shown below: 5'UTR: GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCCGCGCCACC.

[0064] 3'UTR: GCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGCA.

[0065] Poly (A) tail: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.

[0066] Meanwhile, wild-type F protein and Ds-Cav1 (S190F / S207F) were designed and constructed independently to compare stability and immunogenicity. The specific mRNA preparation is described above.

[0067] Example 1: Preparation of mRNA vaccine composition Weigh the lipids (purchased from Xiamen Sainuobang) according to the molar ratio of SM102:DSPC:cholesterol:DMG-PEG2000 of 50:10:38.5:1.5, and dissolve them in anhydrous ethanol to prepare lipid solution A. The specific preparation process is as follows: Take the preparation of 50 mL lipid solution A as an example. Weigh 287.5 mg of SM102 lipid, 62.0 mg of DSPC, 116.7 mg of cholesterol, and 33.0 mg of DMG-PEG2000 lipid using a precision balance, dissolve them in anhydrous ethanol, and bring the volume to 50 mL. Use a 0.22 μm filter membrane to remove impurities.

[0068] The mRNA stock solution (1 mg / mL) was diluted to 0.1 mg / mL with 100 mM citrate buffer (pH 4.0) to form solution B. Using the Suzhou Aitesen microfluidic nanoparticle preparation system, solutions A and B were mixed at a volume ratio of 1:3 at a total flow rate of 12 mL / min, and lipid nanoparticles were formed through dynamic self-assembly. The mixture was immediately dialyzed against 40 volumes of PBS buffer (pH 7.4) for 4 h (4℃), followed by aseptic filtration through a 0.22 μm filter membrane and aliquoting to obtain the mRNA vaccine composition.

[0069] Example 2: Detection of mRNA vaccine composition 2.1 Detection of particle size and particle dispersion coefficient of mRNA vaccine composition Dynamic light scattering (DLS) was used for determination: The mRNA vaccine composition prepared in Example 1 was diluted to 0.1 mg / mL with PBS buffer (pH 7.4) and placed in a Malvern Zetasizer NanoZS90 instrument. The detection temperature was set to 25°C and the equilibration time to 2 min. Each sample was measured three times. The results are as follows: Figure 2 As shown.

[0070] Figure 2 The results showed that the average particle size of the mRNA vaccine product encapsulated by lipid nanoparticles (LNP) was between 90 and 120 nm, and the particle dispersion index (PDI) was ≤0.2, indicating that the particle distribution was uniform and met the quality requirements of nanomedicine delivery systems.

[0071] 2.2 Detection of in vitro activity of mRNA-encoded RSV F protein The mRNA stock solutions encoding the wild-type (WT), conventional Ds-Cav1 mutant (S190F / S207F), and the IPVV mutants (N67I, S215P, I379V, and M447V) of this application were transfected in vitro and detected by flow cytometry, respectively. The specific steps are as follows: 293T cells in good growth condition were harvested, digested with trypsin, and then the concentration was adjusted to 0.67 × 10⁻⁶. 6Cells / mL, seeded at 1 mL / well into 6-well plates and added 2 mL / well of DMEM complete medium (Gibco, catalog number: 10566024); 2 μg / well of each group of mRNA stock solution (WT, Ds-Cav1, IPVV) was mixed with 100 μL of Opti-MEM medium (Gibco, catalog number: 31985062) and 2 μL of RNA transfection reagent (Changchun Jinchuan Technology, catalog number: mRNA220521010), and incubated at room temperature for 5-10 minutes to form a transfection complex. Then, 100 μL / well was added to the cells, gently shaken to mix, and incubated at 37°C, 5% CO2 for 48 hours. Cells were washed with FACS solution (1×PBS containing 2% FBS), centrifuged, and incubated with 1 μg / mL RSV preF specific antibodies (AM14, D25) at 4°C for 60 minutes. After washing, APC fluorescently conjugated secondary antibody (1 μg / mL, purchased from Aladdin) was added and incubated in the dark for 20 minutes. After fixation, 20,000 cells / sample were collected by flow cytometry. Fluorescence signals were detected by FSC / SSC gating and APC channel analysis. CytExpert software analysis showed that the proportion of pre-F protein-positive cells of the IPVV mutant was significantly higher than that of wild type (WT), and the mean fluorescence intensity (MFI) was 2.5 times (AM14) and 2.0 times (D25) higher than that of Ds-Cav1, demonstrating that the N67I, S215P, I379V, and M447V mutations effectively enhanced the conformational stability and antigen expression of pre-F. Figure 3 ).

[0072] 2.3 Detection of antibody titers induced by mRNA vaccine compositions 2.3.1 Animal Immunization and Sample Collection The candidate vaccine Ds-Cav1, the IPVV of this application, and the negative control PBS buffer were administered to mice via intramuscular injection at a dose of 0.5 μg / mouse (mice were randomly divided into 3 groups, n=5 in each group, purchased from Spiford (Beijing) Biotechnology Co., Ltd., BALB / c strain wild type, 6-8 weeks old, male), with a 21-day interval between the two immunizations. Venous blood was collected from mice on day 14 after the first immunization, day 14 after the second immunization, and day 28 after the second immunization. After collection, the blood was left to stand at room temperature for 1 hour, then transferred to a refrigerator at 2-8℃ and left to stand for 1 hour. Finally, the serum was separated by centrifugation at 5000 rpm and 4℃ for 5 minutes and stored at -80℃ for subsequent antibody titer detection.

[0073] 2.3.2 Method for detecting conformation-specific antibodies before F protein fusion The titer of pre-F specific IgG antibodies in mouse serum was quantitatively analyzed using enzyme-linked immunosorbent assay (ELISA). The specific steps are as follows: RSV preF protein (nearshore protein, DRA230) was coated at a concentration of 2 μg / mL onto a high-binding ELISA plate, with 50 μL added to each well and incubated overnight at 4°C. The next day, the coating solution was discarded, and the plate was blocked with 1×Casein buffer to reduce non-specific binding, and incubated at 37°C for 1 hour. After blocking, the plate was washed, and mouse serum was diluted with 0.1×Casein solution (initial dilution 300-fold, followed by 4-fold serial dilutions to 49, 15, 200-fold). Negative and positive controls were pre-diluted to 1000-fold, and 100 μL / well was added to the pre-coated plate (double replicates for test samples, quadruple replicates for negative controls). The plate was incubated at room temperature for 1 hour to allow specific antibodies in the serum to bind to the antigen. After washing the plate again, 50 μL / well of HRP-labeled anti-mouse IgG secondary antibody (Beyotime, A0216, 1:5000 dilution) was added, and the plate was incubated at room temperature for another 1 hour. The plate was then washed, TMB substrate was added for color development, and the reaction was carried out in the dark for 10-15 minutes. The reaction was then terminated with 2N H2SO4. Finally, the OD value of each well was read at a wavelength of 450 nm. The OD450 of 2.1 times that of negative serum was used as the cut-off value to determine the positive titer, and the antibody titer and geometric mean (GMT) of each group of serum were calculated.

[0074] 2.3.3 Results Analysis On day 14 post-primary immunization, all candidate vaccines (Ds-Cav1, IPVV) induced a significant humoral immune response (IgG titer 10). 3 ~10 4 Antibody levels significantly increased on days 14 and 28 after the second immunization (titer 10). 4 ~10 6 Furthermore, no significant antibody attenuation was observed 28 days after the second immunization. The GMT values ​​of the IPVV group at 14 and 28 days after the second immunization were significantly higher than those of the Ds-Cav1 group (p<0.01, specific values ​​not shown), indicating that the N67I, S215P, I379V, and M447V mutations significantly enhanced the immunogenicity of the pre-F conformation, inducing higher levels of specific antibodies. Figure 4 ) It can be seen that, whether 14 days after a single immunization or 14 and 28 days after a second immunization, the IPVV group induced significantly higher antibody levels than the DS-Cav1 group and the PBS group, and the differences were statistically significant. P<0.01, P<0.001, P<0.0001). After the second immunization, the antibody titer in the IPVV group reached nearly 10. 6 This suggests that it has stronger immunogenicity and can effectively enhance humoral immune response, making it superior to the traditional DS-Cav1 vaccine.

[0075] 2.4 Detection of cell-mediated immunity induced by mRNA vaccine composition 2.4.1 Methods for detecting cellular immune responses Another batch of BALB / c strain wild-type mice (randomly divided into 3 groups, n=5 per group) were used. The candidate vaccine Ds-Cav1, the IPVV of this application, and the negative control PBS were administered to the mice via intramuscular injection at a dose of 1 μg / mouse (21 days apart). Seven days after the last immunization, spleens were harvested to prepare a single-cell suspension: the spleens were ground through a 70 μm filter, and red blood cells were removed with red blood cell lysis buffer. The cells were resuspended in RPMI 1640 medium (Gibco, C11875500CP) (containing 10% FBS (Baidi Technology, F800-500)), stained with trypan blue, counted, and adjusted to 2.5 × 10⁻⁶ cells / mL. 6 cells / mL. IFN-γ secretion was detected using the ELISApot method: spleen cells (2.5 × 10⁻⁶ cells / mL) were... 5 Cells / well were co-incubated with RSV F protein and peptide library (4 μg / mL) for 24 hours (37℃, 5% CO2). After cell lysis, biotinylated detection antibody, enzyme-labeled avidin and AEC chromogenic solution were added sequentially, and spot-forming units (SFUs) were counted using an ELISpot instrument.

[0076] 2.4.2 Results Analysis ELISA Pot assays showed that spleen cells in both the IPVV and Ds-Cav1 groups significantly secreted IFN-γ upon stimulation with the F protein peptide (mean SFU values ​​were 221.6 and 122.2, respectively), while the negative control group showed no response. This indicates that the N67I, S215P, I379V, and M447V mutations in this application enhance the antigen presentation efficiency of the RSV F protein and induce a stronger T-cell immune response. IPVV is superior to the traditional Ds-Cav1 vaccine in activating T-cell-mediated immune responses. Figure 5 ) It should be noted that this application is not limited to the above-described embodiments. The above embodiments are merely examples, and any embodiments with the same structure and effect as the technical concept within the scope of this application are included in the technical scope of this application. Furthermore, various modifications that can be conceived by those skilled in the art to the embodiments, and other ways of constructing by combining some of the constituent elements of the embodiments, without departing from the spirit of this application, are also included in the scope of this application.

Claims

1. The F protein fused with pre-respiratory syncytial virus, characterized in that, The amino acid sequence of the F protein is shown in SEQ ID NO.

1.

2. The use of the F protein as an immunogen in vaccine preparation as described in claim 1.

3. An isolated mRNA containing a coding region, characterized in that, The coding region encodes the F protein as described in claim 1; Preferably, the nucleotide sequence of the coding region is as shown in SEQ ID NO.2; Preferably, the mRNA further comprises any one or more of the following elements: 5' cap element; 5' UTR element; 3' UTR element; stop codon; polyA tail element; Preferably, the mRNA is operatively linked by the following elements in sequence: a 5' cap element, a 5' UTR element, a coding region, a 3' UTR element, and a polyA tail element; Preferably, the mRNA further comprises a modification, wherein the modification is an N1-methyl-pseudouridine, an N6-methyladenosine, a pseudouridine nucleoside, or a 5-methylcytidine modification.

4. The mRNA as described in claim 3, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

3.

5. Isolated DNA capable of being transcribed into the mRNA of claim 3 or 4.

6. The DNA as described in claim 5, characterized in that, The nucleotide sequence encoding the F protein is shown in SEQ ID NO.

4.

7. A recombinant expression vector, characterized in that, It contains the DNA as described in claim 5 or 6.

8. A recombinant host cell, characterized in that, It contains the DNA as described in claim 5 or 6, or the recombinant expression vector as described in claim 7.

9. A respiratory syncytial virus mRNA vaccine composition, characterized in that, The mRNA vaccine composition contains: mRNA expressing a respiratory syncytial virus immunogen, said mRNA as described in claim 3 or 4; and mRNA vaccine vectors; Preferably, the mRNA vaccine carrier is a lipid nanoparticle.

10. The use of the mRNA of claim 3 or 4, the DNA of claim 5 or 6, the recombinant expression vector of claim 7, the recombinant host cell of claim 8, or the mRNA vaccine composition of claim 9 in the preparation of a medicament, characterized in that, The drug is used for: a: Prevention of respiratory syncytial virus; b: Inducing specific antibodies against respiratory syncytial virus in mammals; c: Induces T-cell responses against respiratory syncytial virus in mammals.