Cotton gland-associated protein CGR46 or coding gene and application thereof

Abstract

The invention belongs to the technical field of plant breeding, and particularly relates to a cotton gland related protein CGR46 or a coding gene and application thereof. The amino acid sequence of the cotton gland associated protein CGR46 is shown as SEQ ID NO: 1. After the expression level of the coding gene of the cotton gland-associated protein CGR46 in cotton is reduced by using a virus-induced gene silencing technology, the resistance of a cotton plant to verticillium wilt bacteria is remarkably reduced, so that the verticillium wilt resistance of the cotton can be improved by improving the expression level of the coding gene of the cotton gland-associated protein CGR46.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant breeding, and particularly relates to a cotton CGR46 related protein or a coding gene thereof and application thereof. BACKGROUND

[0002] Cotton is an important economic crop in the world, and its fiber is the core raw material of the natural textile industry, which plays an irreplaceable role in the national economy. However, cotton is susceptible to various pests and diseases during its growth cycle, among which Verticillium wilt caused by Verticillium dahliae is one of the most serious soil-borne vascular diseases. The disease has a wide transmission route (can be transmitted through cotton seeds, plant residues, soil, etc.), and after the disease occurs, the cotton plants show leaf yellowing, a large number of bolls falling off, and even the whole plant death, resulting in yield reduction or even no yield, so it is called the "cancer" of cotton. At present, there is no specific and effective chemical agent for cotton Verticillium wilt, and the biological control method has problems such as high cost and unstable effect, so breeding disease-resistant varieties is still the most economical and effective way to control the disease.

[0003] During the long-term evolution process, cotton has formed a complex self-defense mechanism, among which the gland (also known as "gossypol gland" "black gland") is a unique structural feature. The gland is rich in secondary metabolites such as gossypol, hemigossypol, flavonoids, naphthoquinones, etc. These substances not only inhibit the growth of pathogens such as cotton leaf spot fungus, but also have toxicity to herbivorous insects such as cotton bollworm and cotton aphid, and are important "phytoalexins" for cotton to resist biological stress. In recent years, it has been found that genes regulating secondary metabolic pathways play a key role in disease resistance, for example, the GhnsLTPs gene identified through GWAS analysis can regulate lignin and flavonoid metabolism in the phenylpropanoid pathway, and enhance the resistance of cotton to Verticillium wilt, Fusarium wilt and insect pests. However, the molecular mechanism of synthesis and regulation of cotton gland secondary metabolites is still not completely clear, especially the key resistance gene mining and function research for Verticillium wilt still needs to be further studied.

[0004] Modern biotechnology provides a new method for the mining and utilization of cotton disease-resistant genes, among which pathogenesis-related proteins (PR proteins) are key functional proteins of plants in response to pathogen infection, and their gene expression characteristics have been widely used in disease-resistant variety breeding. PR proteins are regulated by hormone signals such as salicylic acid and jasmonic acid, and can be divided into 17 subgroups according to sequence similarity and function, and play a core role in systemic acquired resistance (SAR). Cloning of disease-resistant related genes, analyzing their functions, and regulating gene expression through gene editing or RNA interference technology have become an important strategy for breeding disease-resistant varieties. Therefore, mining key genes related to cotton gland secondary metabolism and Verticillium wilt resistance, and elucidating their mechanism, have important theoretical significance and application value for breeding cotton varieties with high resistance to Verticillium wilt. SUMMARY

[0005] Based on this, the present application aims to provide a cotton gland-related protein CGR46 or its encoding gene and application.

[0006] In order to achieve the above-mentioned purpose, the present application can adopt the following technical solutions: In the first aspect, the present application provides a cotton gland-related protein CGR46, which comprises any one of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO: 1; (2) the amino acid sequence of a protein with the same function obtained by substitution, insertion or deletion of one or more amino acids of the amino acid sequence shown in SEQ ID NO: 1.

[0007] In the second aspect, the present application provides an encoding gene of the above-mentioned cotton gland-related protein CGR46, which comprises any one of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO: 2; (2) the nucleotide sequence capable of encoding a protein with the same function obtained by substitution, deletion or insertion of one or more nucleotides of the nucleotide sequence shown in SEQ ID NO: 2.

[0008] In the third aspect, the present application provides a biological material, which comprises the above-mentioned encoding gene; the biological material comprises a recombinant expression vector, an overexpression vector, an interference vector, a recombinant virus, a recombinant bacteria or a recombinant gene expression cassette.

[0009] In the fourth aspect, the present application provides the application of the above-mentioned cotton gland-related protein CGR46 or the above-mentioned encoding gene or the above-mentioned biological material, which comprises any one of the following applications: (i) application in regulating metabolites in cotton glands; (ii) application in cultivating cotton resistant to Verticillium wilt; (iii) application in improving cotton germplasm resources resistant to Verticillium wilt.

[0010] Preferably, in the above-mentioned application, the expression level of the cotton gland-related protein CGR46 in cotton is increased to improve the resistance of cotton to Verticillium wilt.

[0011] More preferably, in the above-mentioned application, the encoding gene of the cotton gland-related protein CGR46 in cotton is increased to achieve the purpose of increasing the expression level of the cotton gland-related protein CGR46 in cotton.

[0012] More preferably, in the above-mentioned application, overexpression includes promoting the expression of the endogenous gene CGR46 by a CRISPR-dCas9 gene editing system.

[0013] In a fifth aspect, the embodiments of the present application provide a breeding method of Verticillium wilt resistant cotton, the method comprising: obtaining the Verticillium wilt resistant cotton by overexpressing the coding gene in cotton.

[0014] Preferably, in the breeding method, the overexpression of the coding gene in cotton is achieved by gene editing.

[0015] The present application has at least the following beneficial effects: after the expression level of the coding gene of cotton gland-associated protein CGR46 in cotton is reduced by the virus-induced gene silencing technology, the resistance of the cotton plant to Verticillium dahliae is significantly reduced, which indicates that the Verticillium wilt resistance of cotton can be improved by increasing the expression level of the coding gene of cotton gland-associated protein CGR46 in the present application. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 is the expression analysis of CGR46 gene in cotton gland; wherein, A represents the expression amount of CGR46 in the gland tissue and non-gland tissue in the gland stem tissue of cotton with gland; and B is the RNA in situ hybridization result of CGR46 gene; Figure 2 is the induced expression of CGR46 by Verticillium dahliae; Figure 3 is the plant phenotype and interference efficiency after the silencing of CGR46 gene; wherein, A represents the performance of TRV:00, TRV:CLA and TRV:CGR46 interference plants; and B represents the expression amount of CGR46 gene in the interference plants; Figure 4 is the plant phenotype after the silencing of CGR46 gene and the inoculation of Verticillium dahliae; wherein, A represents the resistance phenotype of TRV:00 and TRV:CGR46 plants after the inoculation of Verticillium dahliae; and B represents the incidence rate and incidence index of TRV:00 and TRV:CGR46 plants after the occurrence of disease. DETAILED DESCRIPTION

[0017] The embodiments are used to better illustrate the present application, but are not the only embodiments of the present application, and are only limited to the embodiments. Therefore, the skilled in the art can make non-essential improvements and adjustments to the embodiments according to the above description, which still belong to the protection scope of the present application.

[0018] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure. Unless otherwise defined, all terms of art used herein including technical and scientific terms have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and the present disclosure, and will not be interpreted in an overly literal sense unless expressly so defined herein. As used herein, it is also to be understood that the description of the present application is intended to be illustrative, and not restrictive, of the application, and that

[0019] For a better understanding of the present application, reference will be made to the following examples which are intended to be illustrative only and not restrictive of the application.

[0020] Example 1 (1) Primer design According to the cDNA sequence of CGR46 gene, the primers for fluorescence quantitative are designed as follows: CGR46-qRT-F (SEQ ID NO: 3): CTACCTCTCCAGTCGCCCCT; CGR46-qRT-R (SEQ ID NO: 4): CTTGTCCCCCAAAGGTCCAC.

[0021] (2) Analysis of CGR46 tissue expression pattern (2-1) Take the gland tissue and non-gland tissue on the stem tissue of the gland cotton plant, and extract the cotton RNA according to the steps and reagents provided by the polysaccharide and polyphenol plant total RNA extraction kit (DP441) of Tian Gen Biotechnology Co., Ltd.; (2-2) Synthesis of cDNA: total RNA was used as template, and reverse transcription was performed by using ReverTra Ace qPCR RT Kit (TOYOHA, Japan); the operation steps were as follows: 1 μg total RNA was added with 1 μL OligdT, and Nuclease-free Water was added to make up to 13 μL, and then the mixture was incubated at 65 °C for 2 min, and immediately placed on ice for 2 min; then 2 μL 5xRT buffer, 2 μL dNTPs, 0.5 μL RT Enzyme and 0.5 μL PRI were added, and the total volume was 20 μL; reverse transcription was performed at 50 °C for 60 min, and enzyme inactivation was performed at 85 °C for 5 min to terminate the reaction; the cDNA sample obtained after reverse transcription was diluted 50 times for qRT-PCR amplification (reaction system: 2xMaster Mix 5 μL, CGR46-qRT-F (10 mM) 0.2 μL, CGR46-qRT-R (10 mM) 0.2 μL, template (CDNA) 5 μL; amplification procedure: 95 °C, 10 s; 60 °C, 30 s; 40 cycles; 12 °C, 10 min); qRT-PCR experiment was completed on a Roche LightCycler 96 real-time fluorescent quantitative PCR system; the relative gene expression amount was calculated by using GhUBQ7 as a reference gene and adopting the method The detection results are shown in FIG. A, and the results show that CGR46 is specifically expressed in cotton gland tissue. Figure 1 A. The detection results are shown in FIG. A, and the results show that CGR46 is specifically expressed in cotton gland tissue.

[0022] (3) In situ hybridization of CGR46 gene (3-1) A specific segment of about 270 bp in the full-length sequence of CGR46 was selected as a template, and amplification primers were designed; the CGR46 fragment was amplified by using the cDNA of 'TM-1' cotton as a template; the sequence of the amplification primer pair was as follows: CGR46-Hybrids-F (SEQ ID NO: 5): ATTTAGGTGACACTATAGAATAGAGTCTACCTCTCCAGTCGC; CGR46-Hybrids-R (SEQ ID NO: 6): TAATACGACTCACTATAGGGAGAGATTTTCTCAAGCTTGTCCC; The amplification conditions are as follows: using cDNA as a template, CGR46-Hybrids-F / R as amplification primers, and using fidelity enzyme for amplification: the amplification system is as follows: 2xPhanta Max Buffer 25 μL, dNTP (10 mM) 1 μL, CGR46-VIGS-F (10 mM) 0.8 μL, CGR46-VIGS-R (10 mM) 0.8 μL, template (cDNA) 10 μL, Phanta Max Super-Fidelity DNA Polymerase (5 U / μL) 0.3 μL, and ddH2O is added to 50 μL; the amplification procedure is as follows: (95℃, 5 min; 95℃, 30 s; 58℃, 15 s; 72℃, 5 s; 40 cycles; 16℃, 5 min); after PCR, agarose gel electrophoresis detection is performed, and then the amplified fragments are recovered and purified.

[0023] (3-2) Under the action of T7 RNA polymerase, a digoxin-labeled dNTP is used as a substrate, and a CGR46 specific segment is used as a template to obtain a labeled CGR46 RNA probe (SEQ ID NO: 7), and the specific process is as follows: GAGTCTACCTCTCCAGTCGCCCCTGCCAGGCTTTTCAAAGCTTTTTCTCTTGAAGCTGACAAGGTTTGGCCCAAGGCTGCTCCTCAGGCAGTCAAGAGCGTTGAGGTTGAAGCTAATCCTGGCCCTGGAAGTATCGTAAAGATCAACTTTGCTGAAGGCCTTCCATTCCAATATATGAAGCACCAGATTGGAGGACATGACGACAAGAATTTGTCATACAGTTATAGTTTGATCGAAGGTGGACCTTTGGGGGACAAGCTTGAGAAAATC.

[0024] (3-3) The stems and true leaves of the 'TM-1' cotton plants are fixed with 4% paraformaldehyde, and then paraffin-embedded and sectioned; the sections are dewaxed with xylene and gradiently rehydrated with ethanol to a phosphate buffer for standby; then, pre-hybridization, hybridization of the probe and the tissue are performed; after hybridization, color development reaction is performed on the sample at 37℃ using NBT / BCIP as a substrate, the color development reaction is terminated, and the color development result is observed. According to the color development position and depth of the tissue, the fine positioning of CGR46 in the cotton tissue is judged, and the result is shown in Figure 1 B, wherein the cavity structure indicated by the arrow is the position of the cotton gland, which indicates that CGR46 CGR46 is specifically expressed in the cotton gland tissue cells.

[0025] (4) CGR46 Verticillium dahliae Induced Expression Pattern Analysis Cotton seedlings were inoculated with spore solution of L. theobromae 'V991' (from the Cotton Bio-breeding and Comprehensive Utilization State Key Laboratory of Henan University, then expanded and preserved by the present experiment), and the RNA of the root tissues of the control cotton plants and the inoculated cotton plants was extracted and reverse transcribed into cDNA (the method is the same as above); the cDNA was used as a template to analyze the response of CGR46 gene to L. theobromae 'V991' by qRT-PCR method. The test results are shown in Figure 2 The results show that the expression level of CGR46 is significantly increased compared with the control treatment, indicating that CGR46 gene is induced by L. theobromae 'V991' and may be involved in the resistance of cotton to Verticillium wilt.

[0026] Example 2 (1) Construction of TRV: CGR46 Virus Interference Vector (1-1) The following primers were designed according to the nucleotide sequence of CGR46, and the primer sequences are shown as follows: Forward primer CGR46-VIGS-F (SEQ ID NO: 8): CGACGACAAGACCCTGAGTCTACCTCTCCAGTCGC; Reverse primer CGR46-VIGS-R (SEQ ID NO: 9): GAGGAGAAGAGCCCTGCTGCCTCAAACTTGTTGTC.

[0027] (1-2) Virus interference fragment of CGR46 was amplified from the cDNA library of 'TM-1' cotton (PCR reaction system: 2xPhanta Max Buffer 10 μL, dNTP (10 mM) 0.4 μL, CGR46-VIGS-F (10 mM) 0.3 μL, CGR46-VIGS-R (10 mM) 0.3 μL, template (cDNA) 5 μL, Phanta Max Super-Fidelity DNA Polymerase (5 U / μL) 0.1 μL, ddH2O to 20 μL; amplification procedure: (95°C, 5 min; 95°C, 30 s; 58°C, 15 s; 72°C, 5 s; 40 cycles; 16°C, 5 min), the virus vector TRV2 plasmid was digested with restriction endonuclease; the cloned PCR product and the recovered TRV2 plasmid fragment were connected by one-step cloning method, and the connection product was the virus silencing vector TRV: CGR46; the connection product was transformed into E. coli DH5a by heat shock, and the positive clones were detected by using primers CGR46-VIGS-F and CGR46-VIGS-R, the positive clones after detection were sent to the company for sequencing, and after sequence comparison, the positive clones were expanded, the plasmid was extracted, and then transformed into Agrobacterium GV3101, and the positive bacteria liquid after detection was stored in a refrigerator at -80°C for standby.

[0028] (2) Agrobacterium-mediated transformation The TRV: CGR46 Agrobacterium storage solution was inoculated into LB liquid medium (peptone 1 g, yeast powder 0.5 g, NaCl 0.5 g to 100 mL sterile water) at a volume ratio of 1:10, activated at 220 rpm for 12 h, the OD600 value of the bacterial liquid was about 1.5, the bacterial liquid was collected and centrifuged, and the bacterial body was resuspended with resuspension liquid (resuspension liquid composition: 10 mM MgCl2, 10 mM MES, 200 μM AS), and the OD600 was adjusted to 0.9; the TRV: CGR46 Agrobacterium storage solution and the auxiliary virus bacterial liquid (TRV2 bacterial liquid and TRV1 bacterial liquid mixed at a volume ratio of 1:1) were mixed uniformly at a volume ratio of 1:1, and inoculated into the cotton cotyledon which grew for about one week by using a syringe, after inoculation, the inoculation was treated in the dark for 12 h, and then cultured under normal light, the cultivation condition was 16 h / dark 8 h, 23°C; and the TRV:00 empty vector was transformed as a blank control according to the above method.

[0029] (3) Detection of TRV: CGR46 interference efficiency Take interference for about three weeks of TRV:00 and TRV:CGR46 cotton true leaves each 3 biological repeats, using the steps and reagents provided by the total RNA extraction kit of polysaccharide and polyphenol plant of Tian Gen Biology Co., Ltd. (DP441) to extract cotton RNA (cDNA synthesis and qPCR operation steps refer to the cDNA synthesis and qPCR steps described in example 1). Among them, the phenotype of CGR46 gene after interference of cotton plants is as shown in Figure 3 A, the results show that TRV:CLA is a positive control, after interfering with the CLA gene (chlorophyll synthesis related gene), the plant interference appears white phenotype; TRV:00 is the ordinary control, that is, the plant of the empty vector, TRV:CGR46 is the plant of silencing CGR46 gene. The interference efficiency of CGR46 is as shown in Figure 3 B, the results show that the expression amount of CGR46 in TRV:CGR46 plant is significantly lower than that in control plant TRV:00.

[0030] Example 3 The saved 'V991' Verticillium wilt was inoculated into PDA medium and activated in a 25℃ incubator. After one week, the spore solution of 'V991' was collected, counted by hemocyte plate, and then the spore solution concentration was diluted to 10 6 ; the root injury inoculation method was used to inoculate spores to TRV:00 and TRV:CGR46 plants (constructed in example 2) (after root injury, the cotton plant roots were soaked in 10 6 spore solution for 30s); the inoculated plants were placed in a 25℃ light incubator, the air was kept humid, the disease incidence of TRV:00 and TRV:CGR46 plants was observed at different days, and the disease incidence and disease index were counted. The phenotype of the control plant TRV:00 and the CGR46 gene interference plant TRV:CGR46 after inoculation of Verticillium wilt is as shown in Figure 4 A, the disease incidence and disease index of the control plant TRV:00 and the CGR46 gene interference plant TRV:CGR46 plant after inoculation of Verticillium wilt for 10 days and 14 days are as shown in Figure 4 B (DPI refers to days), the results show that compared with the control plant, the resistance of TRV:CGR46 plant to Verticillium wilt is significantly lower than that of the control plant.

[0031] Finally, it should be pointed out that the above examples are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present application, which should be covered by the claims of the present application.

Claims

1. A cotton gland-associated protein CGR46 comprising any one of the following amino acid sequences: (1) an amino acid sequence as shown in SEQ ID NO: 1; (2) an amino acid sequence of a protein having the same function obtained by substitution, insertion or deletion of one or more amino acids of the amino acid sequence as shown in SEQ ID NO:

1. 2.A gene encoding the cotton gland-associated protein CGR46 of claim 1, the gene encoding comprising any one of the following nucleotide sequences: (1) a nucleotide sequence as shown in SEQ ID NO: 2; (2) a nucleotide sequence capable of encoding a protein having the same function obtained by substitution, deletion or insertion of one or more nucleotides of the nucleotide sequence as shown in SEQ ID NO:

2.

3. Biomaterials characterized in that, The biological material comprises the gene encoding of claim 2; the biological material comprises a recombinant expression vector, an overexpression vector, an interference vector, a recombinant virus, a recombinant bacteria or a recombinant gene expression cassette. 4.Use of the cotton gland-associated protein CGR46 of claim 1 or the gene encoding of claim 2 or the biological material of claim 3, the use comprising any one of the following uses: (i) use in regulating metabolites in cotton glands; (ii) use in cultivating cotton resistant to Verticillium wilt; (iii) use in improving cotton germplasm resources resistant to Verticillium wilt.

5. Use according to claim 4, characterized in that, The cotton gland-associated protein CGR46 is used to improve the resistance of cotton to Verticillium wilt by increasing the expression level of the cotton gland-associated protein CGR46 in cotton.

6. Use according to claim 5, characterized in that, The gene encoding the cotton gland-associated protein CGR46 is used to increase the expression level of the cotton gland-associated protein CGR46 in cotton by overexpressing the gene encoding the cotton gland-associated protein CGR46 in cotton.

7. The use of claim 6, overexpression comprising: The CRISPR-dCas9 gene editing system is used to promote the expression of the endogenous gene CGR46.

8. A method of breeding a Verticillium wilt resistant cotton plant, comprising, The method comprises: The cotton resistant to Verticillium wilt is obtained by increasing the gene encoding of claim 2 in cotton.

9. The breeding method according to claim 8, characterized in that, The gene encoding is edited in cotton.

Images