Methods and systems for rapid detection of microorganisms using recombinant bacteriophages

By inserting indicator genes into the late gene region of a recombinant phage, and incubating the sample with a high multiplicity of infection and a high concentration of phage, the target microorganism can be detected rapidly. This solves the problem of long detection time in existing technologies and achieves high sensitivity and rapid detection results.

CN121379990APending Publication Date: 2026-01-23LABORATORY CORPORATION OF AMERICA HOLDINGS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510888447.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2014-02-18
Filing Date
2015-02-18
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

Existing microbial detection methods are time-consuming and cannot quickly, simply, and sensitively detect bacteria, viruses, and other microorganisms, especially in food, water, and clinical samples where there is a detection lag problem.

Method used

Recombinant bacteriophages are used, and an indicator gene is inserted into the late gene region of the bacteriophage to enable it to express a soluble indicator protein after infection with host bacteria. By incubating the sample with bacteriophages of high multiplicity of infection and high concentration, the target microorganisms can be detected rapidly, and the positive detection of microorganisms can be achieved by detecting the indicator protein product.

Benefits of technology

It enables rapid, simple, and highly sensitive microbial detection within a short time (e.g., within two hours), avoiding the time requirements of traditional enrichment culture, and can detect individual bacteria, making it suitable for microbial detection in various environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005474319690000011
    Figure HDA0005474319690000011
  • Figure HDA0005474319690000021
    Figure HDA0005474319690000021
  • Figure HDA0005474319690000031
    Figure HDA0005474319690000031
Patent Text Reader

Abstract

Disclosed herein are methods and systems for rapid detection of microorganisms in a sample without enrichment culture of the microorganisms. Also disclosed is a modified bacteriophage comprising a non-natural indicator gene in the late gene region. The indicator product is not a fusion protein. The specificity of infectious agents allows targeting of specific microorganisms, and the indicator signal can be enlarged to optimize assay sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of Chinese Invention Patent Application No. 201580009143.1, filed February 18, 2015, entitled "Method and System for Rapid Detection of Microorganisms Using Recombinant Bacteriophage".

[0002] Related Applications

[0003] This application claims priority under 35 USC 119(e) to U.S. Provisional Patent Application No. 61 / 940,959, filed February 18, 2014. The disclosure of U.S. Provisional Patent Application No. 61 / 940,959 is incorporated herein by reference in its entirety. TECHNICAL FIELD

[0004] The present invention relates to methods and systems for detecting microorganisms using infectious agents. BACKGROUND

[0005] There is strong interest in improving the speed and sensitivity of detecting bacteria, viruses, and other microorganisms in biological, food, water, and clinical samples. Microbial pathogens can cause considerable morbidity in humans and domestic animals, as well as tremendous economic losses. In addition, given the pathogenic or devastating diseases caused by ingestion of certain microorganism-contaminated food, such as E. coli or Salmonella spp., detection of microorganisms is a high priority for the Food and Drug Administration (FDA) and the Centers for Disease Control (CDC).

[0006] Traditional microbiological tests for bacterial detection rely on non-selective and selective enrichment cultures, followed by plating on selective media and further testing to confirm suspected colonies. Such procedures can take several days. Various rapid methods have been investigated and introduced into practice to shorten the time requirement. However, these methods have drawbacks. For example, techniques involving direct immunoassay or genetic probes generally require an enrichment step to achieve adequate sensitivity. Polymerase chain reaction (PCR) tests also include an amplification step, and thus can have very high sensitivity and selectivity; however, the sample size that can be economically accepted for PCR testing is limited. Using a diluted bacterial suspension, most small subsamples will not contain cells, and thus still require a purification and / or enrichment step.

[0007] The time required for traditional bio-enrichment is influenced by the growth rate of the target bacterial population in the sample, the effects of the sample matrix, and the required sensitivity. For example, for detection of 1000, 100, and 1 colony forming units per milliliter (CFU / mL) in a model system, respectively, a magnetic capture PCR system for Shiga toxin-producing E. coli can require enrichment cultures of about 5, 7, and 10 hours, while 15 hours of enrichment culture is required for detection of 1 CFU per gram (g) in ground beef. In practice, most high-sensitivity methods use overnight incubation and take approximately 24 hours in total. Due to the time required for culture, these methods can take up to three days depending on the organism to be determined and the sample source. This lag time is often inappropriate because contaminated food, water (or other products) can have already entered the livestock or humans. In addition, the increase in antibiotic resistant bacteria and bio-defense considerations make rapid identification of bacterial pathogens in water, food, and clinical samples a high priority worldwide.

[0008] Accordingly, there is a need for rapid, simple, and sensitive microbial detection and identification of microorganisms such as bacteria, viruses, and other potentially pathogenic microorganisms. SUMMARY

[0009] Embodiments of the present application include compositions, methods, systems, and kits for microbial detection. The present application can be embodied in a variety of ways.

[0010] In some aspects, the present application includes a recombinant bacteriophage comprising an indicator gene inserted into a late gene region of the bacteriophage.

[0011] In some embodiments, the present application includes a method for detecting a target microorganism in a sample, comprising the step of incubating the sample with a recombinant bacteriophage that infects the target microorganism, wherein the recombinant bacteriophage comprises an indicator gene inserted into a late gene region of the bacteriophage, such that the indicator gene is expressed during bacteriophage replication following infection of the host bacteria, forms a soluble indicator protein product, and detecting the indicator protein product, wherein a positive detection of the indicator protein product indicates that the target microorganism is present in the sample.

[0012] In other embodiments, the present application includes a system for rapid detection of a target microorganism in a sample, comprising components for incubating the sample with an infectious agent specific for the target microorganism, wherein the infectious agent comprises an indicator moiety, and components for detecting the indicator moiety.

[0013] In yet other embodiments, the present application includes a non-transitory computer readable medium for use with a method or system according to the present application. BRIEF DESCRIPTION OF DRAWINGS

[0014] The present application can be better understood by reference to the following non-limiting drawings.

[0015] Figure 1 Depicted is an indicator phage construct according to embodiments of the application, illustrating the insertion of a genetic construct comprising a luciferase gene and a T7 late promoter into the late (class III) region of the phage. Also depicted are sequences including stop codons to prevent read-through and untranslated regions (UTRs) in all three reading frames.

[0016] Figure 2 Shown is the genome of phage JG04, a T4-like phage isolated from a sewage treatment plant sample and sharing ~98% identity with T4-like phage RB69. The capsid proteins gp23 and gp24 are within the late gene region, consisting of structural genes that encode virion proteins. Because these virion proteins are expressed at very high levels, it is expected that any gene inserted into this region will have similar expression levels, provided that a late gene promoter and / or other similar control elements are used.

[0017] Figure 3 Shown are homologous recombination plasmid constructs carrying three different luciferase genes. The click beetle luciferase, Luciferase, and Oplophorus luciferase genes were each inserted into the pUC57.Amp R plasmid backbone. In each construct, a fragment of the gp23 capsid protein gene is followed by a T4 late promoter, the respective luciferase gene, and a gp23-24 untranslated region. The Oplophorus construct additionally includes a fragment of the gp24 gene downstream of the untranslated region.

[0018] Figure 4 Depicted is the isolation of recombinant phage from modifications of the JG04 phage using a series of sequential infection and absorption steps, using plasmid constructs such as those shown in Figure 3 to identify recombinant phage expressing indicator genes.

[0019] Figure 5 Depicted is the use of indicator phage encoding soluble luciferase to detect bacterial cells by detecting luciferase produced from progeny phage replication during infection of the bacterial cells.

[0020] Figure 6 Demonstrated is the sensitivity of using indicator phage with a spin column to detect target bacteria. The approximate number of E. coli 0157:H7 cells in each assay is indicated on the X-axis. The signal provided by soluble luciferase produced upon infection of the bacteria is shown on the Y-axis as relative luminal units (RLU) (RLU / BG) over the relative background (BG) signal (i.e., no cells).

[0021] Figure 7 According to embodiments of the invention, target bacteria can be detected within a range of titers using an indicator phage with a rotating column. The X-axis represents the approximate number of *E. coli* O157:H7 cells in each assay. The signal provided by the soluble luciferase produced upon bacterial infection is shown on the Y-axis as a relative luminal unit (RLU) (RLU / BG) to the relative background (BG) signal (i.e., cell-free).

[0022] Figure 8 The sensitivity of detecting targeted bacteria using indicator phages and a 96-well filter plate according to embodiments of the present invention has been demonstrated. The X-axis represents the approximate number of *E. coli* O157:H7 cells in each assay. The signal provided by the soluble luciferase produced upon bacterial infection is shown on the Y-axis as a relative luminal unit (RLU) (RLU / BG) to the relative background (BG) signal (i.e., cell-free).

[0023] Figure 9 This invention demonstrates that, according to embodiments thereof, target bacteria can be detected within a range of titers using indicator phages and a 96-well filter plate. The X-axis represents the approximate number of *E. coli* O157:H7 cells in each assay. The signal provided by soluble luciferase produced upon bacterial infection is shown on the Y-axis as a relative luminal unit (RLU) (RLU / BG) to the relative background (BG) signal (i.e., cell-free). The duration of luciferase activity detection is extended. Here, ◇ indicates time 0 (i.e., baseline control); Δ after 15 minutes; and □ after 30 minutes.

[0024] Figure 10 An embodiment of the invention is described, in which a filter plate test for detecting target bacteria using modified bacteriophages is performed, wherein bacteria and recombinant bacteriophages are incubated on a filter plate, and indicator proteins are detected directly after progeny bacteriophages are produced, without removing the culture medium.

[0025] Figure 11 Showing the use Results of a phage-based plate test to detect E. coli O157:H7 cells in a sample with a known cell count. The X-axis represents the approximate number of E. coli O157:H7 cells in each test. The signal provided by the soluble luciferase produced during bacterial infection is shown on the Y-axis as a relative luminal unit (RLU) to the relative background (BG) signal (i.e., cell-free) (RLU / BG).

[0026] Figure 12 An embodiment of the invention is described, which describes a “concentration-free assay” for detecting target bacteria using modified bacteriophages.

[0027] Figure 13 Results from a no-concentration test using JG04-OpLuc phage to detect E. coli O157:H7 cells in samples with low number ranges of known cell numbers are shown. The approximate number of E. coli O157:H7 cells in each test is indicated on the X-axis. The signal provided by the soluble luciferase produced upon infection of the bacteria is shown on the Y-axis as relative luminescence units (RLU) compared to background (X) signal (i.e., no cells).

[0028] Figure 14 Results from a no-concentration test using JG04-OpLuc phage to detect E. coli O157:H7 cells in samples with low to high number ranges of known cell numbers are shown. The approximate number of E. coli O157:H7 cells in each test is indicated on the X-axis. The signal provided by the soluble luciferase produced upon infection of the bacteria is shown on the Y-axis as relative luminescence units (RLU).

[0029] Figure 15 Results from a no-concentration test using JG04-OpLuc phage to detect E. coli O157:H7 cells in vegetable wash samples with known cell numbers are shown. The approximate number of E. coli O157:H7 cells in each test is indicated on the X-axis. The signal provided by the soluble luciferase produced upon infection of the bacteria is shown on the Y-axis as relative luminescence units (RLU).

[0030] Figure 16 Demonstration of specific and quantitative capture of E. coli O157:H7 using affinity purified, surface specific antibodies according to embodiments of the application.

[0031] Figure 17 Depiction of a Hybrid Immuno-Phage (HIP) assay to detect target bacteria using modified phage according to embodiments of the application, wherein the microorganism of interest is captured on the surface of the assay well using an antibody to the microorganism prior to incubation with a recombinant infectious agent having an indicator gene.

[0032] Figure 18 Results from a HIP test using JG04-OpLuc phage to detect E. coli O157:H7 cells in samples with known cell numbers on a log scale are shown. The approximate number of E. coli O157:H7 cells in each test is indicated on the X-axis. The signal provided by the soluble luciferase produced upon infection of the bacteria is shown on the Y-axis as relative luminescence units (RLU). DETAILED DESCRIPTION

[0033] Disclosed herein are compositions, methods, and systems that demonstrate surprising sensitivity for detecting target microorganisms in assay samples (e.g., biological, blood, water, and clinical samples). Using genetically modified infectious agents, detection can be achieved in less time than previously thought possible in assays that do not use any enrichment culture or, in some embodiments, minimal incubation times during which the microorganisms can potentially multiply. Also surprising is the success of using high multiplicity of infection (MOI) or high concentrations of plaque forming units (PFU) for incubation with test samples. Such high phage concentrations (PFU / mL) have previously been said to be detrimental to microorganism detection assays because they were said to cause "autolysis."

[0034] The compositions, methods, systems, and kits of the present invention can include infectious agents for detecting such microorganisms. In certain embodiments, the present invention includes compositions comprising recombinant bacteriophages having an indicator gene inserted in a late gene region of the bacteriophage. In certain embodiments, expression of the indicator gene during bacteriophage replication following infection of the host bacteria forms a soluble indicator protein product. In certain embodiments, the indicator gene can be inserted in a late gene (i.e., class III) region of the bacteriophage. The bacteriophage can be derived from T7, T4, JG04, or another natural bacteriophage.

[0035] In some aspects, the present invention includes methods of detecting a target microorganism. The methods can use infectious agents for detecting the target microorganism. For example, in certain embodiments, the target microorganism is a bacterium and the infectious agent is a bacteriophage. Thus, in certain embodiments, the methods can include detecting a target microorganism in a sample by incubating the sample with a recombinant bacteriophage that infects the target microorganism. In certain embodiments, the recombinant bacteriophage includes an indicator gene. In certain embodiments, the indicator gene can be inserted in a late gene region of the bacteriophage such that expression of the indicator gene during bacteriophage replication following infection of the host bacteria forms a soluble indicator protein product. The methods can include detecting the indicator protein product, wherein positive detection of the indicator protein product indicates that the target microorganism is present in the sample.

[0036] In certain embodiments, the present invention can include a system. The system can contain at least some of the compositions of the present invention. In addition, the system can include at least some of the components for performing the methods. In certain embodiments, the system is formulated as a kit. In certain embodiments, the present invention can include a system for rapid detection of a target microorganism in a sample comprising: a component for incubating the sample with an infectious agent specific for the target microorganism, wherein the infectious agent includes an indicator moiety; and a component for detecting the indicator moiety. In still other embodiments, the present invention includes software for use with the methods or systems.

[0037] Accordingly, some methods of the present application address the need to amplify the detectable signal indicative of the presence of bacteria by using an infectious agent-based approach. In certain embodiments, as few as a single bacterium is detected. The principles applied herein can be applied to detect a variety of microorganisms. Due to the myriad of binding sites on the surface of a microorganism for an infectious agent, the ability to produce one hundred or more infectious agent progeny during the infectious process and the potential for high level expression of an encoded indicator moiety, the infectious agent or indicator moiety can be detected more rapidly than the microorganism itself. In this manner, embodiments of the present application can achieve a tremendous signal amplification from even a single infected bacterium.

[0038] Various aspects of the present application take advantage of the high specificity of binding agents that can bind to specific microorganisms, such as infectious agents, as a means of detecting and / or quantifying specific microorganisms in a sample. In some embodiments, the present application takes advantage of the high specificity of infectious agents, such as bacteriophage.

[0039] In some embodiments, detection is achieved by an indicator moiety associated with a binding agent specific for the microorganism of interest. For example, the infectious agent can comprise an indicator moiety. In some embodiments, the indicator agent can be encoded by the infectious agent, such as a bacteriophage, and the bacteriophage is designated an indicator bacteriophage.

[0040] Some embodiments of the present application disclosed and described herein take advantage of the discovery that a single microorganism is capable of binding a specific recognition agent, such as a bacteriophage. Upon infection and replication of the bacteriophage, the progeny bacteriophage can be detected by an indicator moiety expressed during the replication process of the bacteriophage. This principle, based on the specific recognition of a microorganism surface receptor, allows for the amplification of an indicator signal from one or a few cells. For example, by exposing even a single microorganism cell to a plurality of bacteriophage, which is then allowed to amplify and high level express the encoded indicator gene product during replication, the indicator signal is amplified such that a single microorganism can be detected.

[0041] Embodiments of the methods and systems of the present application can be applied to detect and quantify a variety of microorganisms (e.g., bacteria, fungi, yeast) in a variety of environments, including but not limited to the detection of pathogens from food, water, clinical, and commercial samples. The methods of the present application can provide high detection sensitivity and specificity rapidly and do not require traditional biological enrichment (e.g., enrichment culture), which is a surprising aspect as all available methods require culture. In some embodiments, detection is possible within 1-2 replication cycles of the bacteriophage or virus, which is contrary to conventional wisdom as conventional wisdom does not take advantage of the natural ability of bacteriophage to amplify itself and luciferase signal.

[0042] Definitions

[0043] Unless otherwise defined, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. Known methodologies and techniques are generally performed according to conventional methods well-known in the art and as described in various general and more specific references that are discussed throughout the present specification unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The nomenclature used in connection with, and the techniques of, the laboratory procedures and techniques described herein are those well-known and commonly used in the art.

[0044] The following terms, unless otherwise indicated, shall have the following meanings:

[0045] As used herein, the terms "a," "an," and "the" can mean one or more, unless otherwise explicitly stated.

[0046] The use of the term "or" is used to mean "and / or", unless explicitly indicated otherwise, that the disclosure supports a meaning of "only alternatives" or "alternatives exclusive of each other. As used herein, "another" can mean at least a second or more.

[0047] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the sample group.

[0048] The term "solid support" or "support" means a structure that provides a matrix and / or surface upon which a biomolecule can be bound. For example, a solid support can be an assay well (i.e., such as a microtiter plate or multiwell plate), or the solid support can be a filter, an array, or a location on a movable support such as a bead or a membrane (e.g., a filter plate or a lateral flow strip).

[0049] The term "antibody" includes monoclonal antibodies, polyclonal antibodies, synthetic antibodies, and chimeric antibodies, e.g., produced by combinatorial mutagenesis and phage display. The term "antibody" also includes mimics or peptidomimetics of antibodies. Peptidomimetics are compounds based on or derived from peptides and proteins. Peptidomimetics of the present invention can generally be obtained by structural modification of known peptide sequences using unnatural amino acids, conformational constraints, isosteric substitutions, and the like. In some embodiments, antibody fragments can act in place of antibodies. A "surface-specific antibody" as used herein binds to molecules exposed on the outer surface of a particular microorganism.

[0050] As used herein, the term "free antibody" refers to antibodies that are in solution and can move freely by liquid; i.e., they are not initially bound to a solid support or otherwise constrained.

[0051] As used herein, "affinity purified" or "affinity purification" refers to a series of steps used to prepare and handle antibodies so that they exhibit optimal specificity and sensitivity, including minimal cross-reactivity with undesired epitopes. For example, removal of undesired lipids and proteins from antisera can be achieved first by a salt precipitation step. Further positive selection (also known as "affinity purification") and / or negative selection (also known as "reverse purification") can be achieved by passing the remaining antibodies through a support (e.g., a column of agarose) that includes a design to trap surface antigens with a particular affinity for the epitope. In some embodiments, where the starting antisera is polyclonal, the purified antibodies trapped after these selection steps are able to recognize a number of different epitopes on the surface of the target microorganism, but they do not recognize surface epitopes of other microorganisms.

[0052] The term "binding agent" refers to a molecule that can specifically and selectively bind to a second (i.e., different) target molecule. The interaction can be non-covalent, e.g., as a result of hydrogen bonding, van der Waals interactions, or electrostatic or hydrophobic interactions, or can be covalent. The term "soluble binding agent" refers to a binding agent that is not attached (i.e., covalently or non-covalently bound) to a solid support.

[0053] As used herein, "analyte" refers to a molecule, compound, or cell to be measured. In certain embodiments, a target analyte can interact with a binding agent. As described herein, the term "analyte" can refer to a target protein or peptide. An analyte can be an agonist, antagonist, or modulator. Or, an analyte can have no biological effect. Analytes can include small molecules, sugars, oligosaccharides, lipids, peptides, peptidomimetics, organic compounds, and the like.

[0054] The term "detectable moiety" or "detectable biomolecule" or "reporter" or "indicating moiety" refers to a molecule that can be measured in a quantitative assay. For example, the indicating moiety can include an enzyme that can be used to convert a substrate to a product that can be measured. The indicating moiety can be an enzyme that catalyzes a reaction that produces bioluminescent emission (e.g., luciferase). Or, the indicating moiety can be a radioisotope that can be quantified. Or, the indicating moiety can be a fluorophore. Or, other detectable molecules can be used.

[0055] As used herein, "bacteriophage" or "phage" includes one or more of a variety of bacterial viruses. In the present disclosure, the terms "bacteriophage" and "phage" include viruses such as mycobacteriophages (e.g., for TB or paraTB), fungal phages (e.g., for fungi), mycoplasma phages, and any other term that refers to viruses that can invade living bacteria, fungi, mycoplasmas, protozoa, yeasts, and other living organisms visible with a microscope and use them to replicate themselves. Here, "visible with a microscope" means a maximum dimension of one millimeter or less. Phages are viruses that have naturally evolved to use bacteria as a means of self-replication. Phages do this by attaching themselves to a bacterium and injecting their DNA (or RNA) into the bacterium, and inducing it to replicate the phage hundreds or even thousands of times. This becomes phage amplification.

[0056] As used herein, "late gene region" refers to a region of a viral genome that is transcribed late in the viral life cycle. The late gene region typically includes the largest amount of expressed genes (e.g., structural proteins that are assembled into phage particles). Late genes are synonymous with class III genes, and include genes with structural and assembly functions. For example, late genes (synonymous with class III) are transcribed in T7, e.g., from 8 minutes post-infection lipid lysis, class I (e.g., RNA polymerase) is early from 4-8 minutes, and class II is early from 6-15 minutes, so there is an overlap in the timing of II and III. A late promoter is a promoter that is naturally located in such a late gene region and is active in that region.

[0057] As used herein, "enrichment culture" refers to traditional culture, such as incubation in a medium that is conducive to microbial propagation, and should not be confused with other possible uses of the word "enrichment," such as enrichment by removing a liquid component of a sample to concentrate the microorganisms contained therein, or other forms of enrichment that do not include traditional promotion of microbial propagation. In some embodiments of the methods described herein, very short periods of enrichment culture can be used, but are not required and if used at all, are much shorter periods than traditional enrichment culture.

[0058] As used herein, "recombinant" refers to genetic (i.e., nucleic acid) modifications made typically in a laboratory to assemble genetic material that would not otherwise be found. The term can be used interchangeably with the term "modified" herein.

[0059] Sample

[0060] Embodiments of the methods and systems of the present application can allow for rapid detection and quantification of microorganisms in a sample. For example, most preferably, the methods according to the present application can be performed in about two hours or less.

[0061] Microorganisms detected by the methods and systems of the present application include pathogens of commercial, medical or veterinary interest. Such pathogens include gram-negative bacteria, gram-positive bacteria, mycoplasmas and viruses. Any microorganism for which an infectious agent has been identified that has specificity for a particular microorganism can be detected by the methods of the present application. Those skilled in the art will recognize that there is no limitation on the application of the methods of the present application other than the availability of the requisite specific infectious agent / microorganism pair.

[0062] Bacterial cells detectable by the present application include, but are not limited to, bacterial cells that are food or water-borne pathogens. Bacterial cells detectable by the present application include, but are not limited to, all species of Salmonella, all strains of E. coli, including but not limited to E. coli 0157:H7, all species of Listeria, including but not limited to L. monocytogenes, and all species of Campylobacter. Bacterial cells detectable by the present application include, but are not limited to, bacterial cells that are medically or veterinarily important pathogens. Such pathogens include, but are not limited to, Bacillus spp., Bordetella pertussis, Campylobacter jejuni, Chlamydia pneumoniae, Clostridium perfringens, Enterobacter spp., Klebsiella pneumoniae, Mycoplasma pneumoniae, Salmonella typhi, Shigella sonnei, Staphylococcus aureus, and Streptococcus spp.

[0063] The sample can be an environmental or food or water sample as well as a medical or veterinary sample. The sample can be a liquid, solid or semi-solid. The sample can be a swab of a solid surface. The sample can include environmental material such as a water sample, or a filter from an air sample or aerosol sample collected by a cyclone collector. The sample can be meat, poultry, processed food, milk, cheese, or other dairy product. Medical or veterinary samples include, but are not limited to, blood, sputum, spinal fluid and fecal samples as well as different types of swabs.

[0064] The sample can be used directly in the detection method of the present application without preparation, concentration or dilution. For example, liquid samples, including but not limited to, milk and juice, can be tested directly. The sample can be diluted or suspended in a solution, which can include, but is not limited to, a buffer or a bacterial culture medium. Solid or semi-solid samples can be suspended in a liquid by mincing, mixing or macerating the solid in the liquid. The sample should be maintained in a pH range that promotes the attachment of the phage to the host bacterial cells. The sample should also contain appropriate concentrations of divalent and monovalent cations, including but not limited to Na + , Mg 2+ and K + . Preferably, the sample is maintained at a temperature that preserves the viability of any pathogen cells contained within the sample.

[0065] Preferably, the sample is maintained at a temperature that preserves the viability of any pathogen cells present in the sample during the detection assay. During the step in which the phage attach to the bacterial cells, the sample is preferably maintained at a temperature that promotes phage attachment. During the step in which the phage replicate within the infected bacterial cells or lyse such infected cells, the sample is preferably maintained at a temperature that promotes phage replication and host lysis. Such temperatures are at least about 25 degrees Celsius (°C), more preferably no higher than about 45 degrees Celsius. Most preferably, about 37 degrees Celsius. It is also preferred that the sample be gently mixed or agitated during the phage attachment, replication and cell lysis processes.

[0066] The assay can include various appropriate control samples. For example, a control sample containing no phage or a control sample containing phage but no bacteria can be run with the assay as a control for background signal levels.

[0067] indicating an infectious agent

[0068] As described in greater detail herein, the compositions, methods, systems, and kits of the present application can include an infectious agent for detecting among these microorganisms. In certain embodiments, the present application can include a composition comprising a recombinant bacteriophage having an indicator gene inserted into a late gene region of the bacteriophage. As described in greater detail below, in certain embodiments of the infectious agent, the indicator gene does not encode a fusion protein. For example, in certain embodiments, expression of the indicator gene forms a soluble indicator protein product during the process of bacteriophage replication following infection of the host bacteria. In certain embodiments, the indicator gene can be inserted into a late gene region of the bacteriophage. In the recombinant bacteriophage, the late gene region can be a class III gene region.

[0069] In some embodiments, the indicator bacteriophage is derived from a T7, T4, or another bacteriophage. The indicator bacteriophage can also be derived from a T7-like, T4-like, JG04, JG04-like, or any other bacteriophage having a genome that is at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, or 70% homologous to a T7, T7-like, T4, T4-like, JG04, JG04-like bacteriophage. In some embodiments, the indicator bacteriophage is derived from a natural bacteriophage isolated from the environment, such as the JG04 bacteriophage, T4-like bacteriophage as described in the Examples. Genetic modifications can avoid the deletion of wild-type genes and thus retain more similarity to the wild-type infectious agent as compared to many commercially available bacteriophages (e.g., 415) in comparison. Such naturally derived bacteriophages are more specific to bacteria found in the environment as compared to commercially available bacteriophages and thus, are genetically distinct from bacteriophages found in the environment.

[0070] Furthermore, it is believed that non-essential bacteriophage genes can have unrecognized functions. For example, apparently non-essential genes can have important functions in elevated release amounts, while having fine cutting, fitting, or finishing functions in assembly. Thus, deletion of genes to insert an indicator can be detrimental. Most bacteriophages can package several percent more DNA than their natural genome. In view of this consideration, smaller indicator genes can be a more suitable choice for modifying bacteriophages, especially bacteriophages with smaller genomes. OpLuc and Protein is only about 20 kDa (approximately 500-600 bp to encode), while Fluc is about 62 kDa (approximately 1,700 bp to encode). In comparison, the genome of T7 is approximately 40 kbp, while the T4 genome is about 170 kbp.

[0071] In some phage embodiments, the indicator gene can be inserted in an untranslated region to avoid disruption of functional genes, leaving the intact wild-type phage genes, which can result in higher fitness when infecting non-laboratory strain bacteria. Additionally, the stop codons in all three reading frames can improve expression by reducing read-through, also known as leaky expression. This strategy can also eliminate the possibility of forming a fusion protein at low levels, which would present a background signal that cannot be separated from the phage (e.g., luciferase).

[0072] The indicator gene can express a variety of biomolecules. An indicator gene is a gene that expresses a detectable product or an enzyme that produces a detectable product. For example, in one embodiment, the indicator gene encodes luciferase. Various types of luciferases can be used. In alternative embodiments, and as described in greater detail herein, the luciferase is an Oplophorus luciferase, a Photuris luciferase, or an engineered luciferase.

[0073] Thus, in some embodiments, the present application includes a modified phage that includes a non-phage indicator gene in a late (class III) gene region. In some embodiments, the non-native indicator gene is under the control of a late promoter. Use of a viral late gene promoter ensures that the reporter gene (luciferase) is not only expressed at high levels, as are the viral coat proteins, but also is not shut down, as are the endogenous bacterial genes or even the early viral genes.

[0074] In some embodiments, the late promoter is a T4- or T7-like promoter, or another phage promoter similar to that found in a native phage without genetic modification. The late gene region can be a class III gene region, and the phage can be derived from a T7, T4, T4-like, JG04, or another native phage with a genome at least 90% homologous to a T7, T4, or T4-like phage. In preferred embodiments, the indicator gene does not encode a fusion protein.

[0075] Genetic modification of the infectious agent can include insertion, deletion, or substitution of a small segment of nucleic acid, a substantial portion of a gene, or an entire gene. In some embodiments, the inserted or substituted nucleic acid includes a non-native sequence. The non-native indicator gene can be inserted into the phage genome such that it is under the control of a phage promoter. In some embodiments, the non-native indicator gene is not part of a fusion protein. That is, in some embodiments, the genetic modification can be configured such that the indicator protein product does not include a polypeptide of the native phage. In some embodiments, the indicator protein product is soluble. In some embodiments, the present application includes a method for detecting a target microorganism, including the step of incubating a test sample with such a modified phage.

[0076] In some embodiments, the non-native indicator gene is not adjacent to a gene encoding a structural phage protein, and thus does not produce a fusion protein. In some embodiments, expression of the indicator gene in progeny phage following infection of the host bacteria forms a soluble protein product.

[0077] Unlike systems that use a fusion of a detection moiety to a capsid protein (i.e., a fusion protein), some embodiments of the application express a soluble luciferase. This can greatly increase the sensitivity of the assay (down to a single bacterium) and simplify the assay, allowing the assay to be completed in less than 1 hour for some embodiments, as opposed to several hours needed for other purification steps due to the use of constructs that produce a detectable fusion protein. In addition, fusion protein activity can be lower than soluble proteins due to, for example, protein folding constraints that can alter the conformation of the active site of the enzyme or proximity to the substrate.

[0078] In addition, the number of moieties attached to the protein subunits in the phage is limited by the defined fusion protein. For example, using a commercially available system designed as a platform for fusion proteins will form about 415 copies of the fusion moiety, corresponding to about 415 copies of the gene 10B capsid protein in each T7 phage particle. Without this limitation, the infected bacteria would be expected to express more copies of the detection moiety (e.g., luciferase) than would fit on the phage. In addition, large fusion proteins, such as capsid-luciferase fusions, can inhibit assembly of the phage particle, thus producing fewer phage progeny. Thus, a soluble, non-fusion indicator gene product can be preferred.

[0079] In some embodiments, the indicator phage encodes a detectable enzyme. The indicator can emit light and / or can be detected by a color change. Various suitable enzymes are commercially available, such as alkaline phosphatase (AP), horseradish peroxidase (HRP), or luciferase (Luc). In some embodiments, these enzymes can be used as the indicator moiety. In some embodiments, the Firefly luciferase is the indicator moiety. In some embodiments, the Oplophorus luciferase is the indicator moiety. In some embodiments, is the indicator moiety. Other engineered luciferases or other enzymes that produce a detectable signal can also be suitable indicator moieties.

[0080] In addition, the use of a soluble detection moiety eliminates the need to separate contaminating parental phage from lysates of infected sample cells. Using the fusion protein system, any phage that infects the sample cells will have the detection moiety attached and will be indistinguishable from the progeny phage that also contain the detection moiety. Because detection of sample bacteria relies on detection of newly formed (de novo synthesized) detection moiety, use of the fusion construct requires an additional step to separate the old (parental) moiety from the newly formed (progeny phage) moiety. This can be accomplished by washing the infected cells multiple times before the phage life cycle is complete, inactivating excess parental phage after infection by physical or chemical means, and / or chemically modifying the parental phage with a binding moiety (e.g., biotin) that can then be bound and separated (e.g., by streptavidin-coated agarose beads). However, even with all of these attempts at separation, parental phage are often retained when high multiplicity of infection (MOI) is used to ensure infection of a small number of sample cells, creating background signal that can interfere with detection of signal from the infected cell progeny phage.

[0081] In contrast, use of an expressed soluble detection moiety in some embodiments of the application eliminates the need to purify parental phage from the final lysate, because the parental phage will not have any detection moiety attached. Thus, any detection moiety present after infection must be de novo formed, indicating the presence of infected bacteria. To take advantage of this benefit, the parental phage can be purified to remove any free detection moiety produced during the process of generating and preparing the parental phage from the bacterial culture. Purification of the phage according to some embodiments of the phage of the application can be performed using standard phage purification techniques, such as sucrose density gradient centrifugation, cesium chloride isopycnic centrifugation, HPLC, size exclusion chromatography, and dialysis or derivatization techniques (e.g., Amicon band concentrator - Millipore, Inc.). The examples herein describe the use of cesium chloride isopycnic ultracentrifugation as part of the preparation of the recombinant phage of the application to separate the parental phage particles from contaminating luciferase protein produced when the phage is propagated from the bacterial stock. In this way, the recombinant phage of the application is essentially free of any luciferase produced during the bacterial production process. Removal of residual luciferase present in the phage stock can substantially reduce the background signal seen when the recombinant phage is incubated with a test sample.

[0082] In some embodiments of the modified bacteriophage, the late promoter (class III promoter, e.g., from T7 or T4) has high affinity for the RNA polymerase of the same native bacteriophage (e.g., T7 or T4, respectively) that transcribes the genes for the structural proteins used to assemble into the bacteriophage particle. These proteins are the largest amount of protein formed by the bacteriophage, as each bacteriophage particle contains tens or hundreds of copies of these molecules. Use of a viral late promoter can ensure optimal high level expression of the luciferase detection moiety. Use of a late viral promoter derived from the original wild-type bacteriophage from which the indicator bacteriophage is derived (e.g., T4 or T7 late promoter with a T4- or T7-based system), specific for the original wild-type bacteriophage from which the indicator bacteriophage is derived (e.g., T4 or T7 late promoter with a T4- or T7-based system), or active in the original wild-type bacteriophage from which the indicator bacteriophage is derived (e.g., T4 or T7 late promoter with a T4- or T7-based system) can further ensure optimal expression of the detection moiety. In some cases, use of standard bacterial (non-viral / non-bacteriophage) promoters can be detrimental to expression, as these promoters are often down-regulated during bacteriophage infection (to prioritize the bacterium as a source for bacteriophage protein production). Thus, in some embodiments, the bacteriophage is preferably engineered to encode and express the soluble (free) indicator moiety at high levels, without limiting expression to the number of subunits of the bacteriophage structural components.

[0083] Use of embodiments of the modified bacteriophage of the present application can allow for rapid detection of specific bacterial strains, with total assay times as fast as 45 minutes - 1.5 hours. Depending on the strain of bacteriophage in the test and the strain of bacteria to be detected, the amount of time required can be somewhat less or more.

[0084] Figure 1 A diagram depicting the genomic structure of a recombinant bacteriophage (indicator bacteriophage 415-Luc) of the present application. For the Figure 1 embodiment depicted in FIG. 1, the detection moiety is encoded by a luciferase gene 100 inserted within the late (class III) gene region 110, which is expressed late in the viral life cycle. Late genes are generally expressed at higher levels than other bacteriophage genes, as they encode structural proteins. Thus, in Figure 1 In the depicted embodiment of the recombinant bacteriophage, the indicator gene (i.e., luciferase) is inserted into the late gene region, just after gene 10B (major coat protein), and is a construct comprising the luciferase gene 100. Figure 1 The depicted construct in FIG. 1 is designed to include a stop codon 120 in all three reading frames to ensure that luciferase is not incorporated into the gene 10B product. In addition, as Figure 1As depicted, the construct can include a consensus T7 late promoter 130 to drive transcription and expression of the luciferase gene. The construct can also include a composite untranslated region synthesized from several T7 UTRs 140. This construct ensures production of soluble firefly luciferase, such that expression is not limited to the amount of capsid protein inherent in the phage display system.

[0085] As described herein, in certain embodiments, it can be preferable to utilize an infectious agent that has been isolated from the environment for the production of the infectious agent of the present application. In this manner, a naturally derived microbe-specific infectious agent can be produced.

[0086] For example, Figure 2 The genome of phage JG04 is shown, which is a natural phage with approximately 98% sequence homology to T4-like phage (RB69). Isolation of the JG04 phage from a sewage treatment plant sample is described in particular in the Examples herein. As discussed in the Examples, the capsid proteins, gp23 (220) and gp24 (230) are within the late gene region (210), which consists of structural genes that encode virion proteins. Because these virion proteins are expressed at very high levels, it is expected that any gene inserted into this region will have similar expression levels, provided that a late gene promoter and / or other similar control elements are used. Figure 2 The phage construct depicted in the middle has the sequence shown in SEQ ID NO: 3.

[0087] The compositions of the present application can include various infectious agents and / or indicator genes. For example, Figure 3 Three homologous recombination plasmid constructs carrying three different luciferase genes are shown. The three constructs were made and used in recombination with JG04 to produce the recombinant phage of the present application. Thus, Figure 3 The upper construct in shows a recombinant plasmid with a firefly luciferase construct for homologous recombination insertion into JG04: homologous recombination plasmid pUC57.HR.Fluc, corresponding to SEQ ID NO. 5. Figure 3 The middle construct in shows a recombinant plasmid for homologous recombination insertion into JG04: homologous recombination plasmid pUC57.HR. corresponding to SEQ ID NO. 6; and Figure 3 The lower construct in shows a recombinant plasmid for Oplophorus luciferase homologous recombination insertion into JG04: homologous recombination plasmid pUC19.HR.OpLuc.KanR, corresponding to SEQ ID NO. 7.

[0088] In some embodiments, the indicator genes according to the present application include genetic engineering to include Figure 3JG04 of any one of the three constructs shown in Figure 1. That is, a reporter phage comprising the sequence of SEQ ID NO. 3, further comprising other sequences corresponding to nucleotides 402-2,973 of SEQ ID NO. 5 (or a portion thereof) inserted between nucleotides 116,555 and 119,830 of SEQ ID NO. 3; or nucleotides 402-1,922 of SEQ ID NO. 6 (or a portion thereof), also referred to as JG04-OpLuc reporter phage in Examples 6 and 11 herein. For example, a portion thereof can include only the luciferase portion (i.e., nucleotides 943-2,595 of SEQ ID NO. 5; or nucleotides 943-1,542 of SEQ ID NO. 6; or nucleotides 2,784-3,296 of SEQ ID NO. 7). A portion thereof can further include the T4 late promoter (i.e., nucleotides 908-936 of SEQ ID NO. 5 or NO. 6, or nucleotides 2,749-2,777 of SEQ ID NO. 7). In another embodiment, such a reporter phage is included in a system or kit according to the application. The methods described herein also utilize such reporter phages. a reporter phage; or nucleotides 2,241-4,729 of SEQ ID NO. 7 (or a portion thereof), also referred to as JG04-OpLuc reporter phage in Examples 7-9 herein. For example, a portion thereof can include only the luciferase portion (i.e., nucleotides 943-2,595 of SEQ ID NO. 5; or nucleotides 943-1,542 of SEQ ID NO. 6; or nucleotides 2,784-3,296 of SEQ ID NO. 7). A portion thereof can further include the T4 late promoter (i.e., nucleotides 908-936 of SEQ ID NO. 5 or NO. 6, or nucleotides 2,749-2,777 of SEQ ID NO. 7). In another embodiment, such a reporter phage is included in a system or kit according to the application. The methods described herein also utilize such reporter phages.

[0089] Figure 4 depicted in Figure 1 and described in Example 6, from modifications of the JG04 phage. Figure 3 depicted in Figure 1 and described in Example 6, from modifications of the JG04 phage.

[0090] In a first step 402, the bacteria transformed with the homologous recombination plasmid are infected with phage to form a progeny phage of a mixture of parent and recombinant phage in a ratio of about 20,000 wild type : 1 recombinant phage 434. The resulting mixture of recombinant phage is diluted 404 into a 96-well plate 406 to obtain an average of 3 recombinant transduction units (TU) per plate, which corresponds to about 625 infectious units (IU) of mostly wild type phage per well. The 96-well plate is assayed for luciferase activity to identify wells containing recombinant phage 436 as compared to wells containing wild type phage 440. Bacteria 438 are added 408; for example, each well can contain about 50 μL of turbid E. coli 0157:H7. This allows the phage to replicate and produce luciferase 442. After incubation at 37°C for 2 hours as shown at 410, the wells can be screened for the presence of luciferase 442. Any positive wells are likely to have been inoculated with a single recombinant phage, and at this stage the mixture can contain a ratio of about 600 wild type phage : 1 recombinant, enriched from the initial 20,000:1 ratio. In one embodiment, soluble luciferase and phage are present in a ratio of about 625 wild type : 1 recombinant. Progeny from this enrichment culture 412 can be subjected to another limiting dilution assay 414 to confirm the ratio and to determine the actual concentration of recombinant phage transduction units. For example, about 3 recombinant TU per 96-well plate 416 can be aliquoted 414 from the first purified stock to form a second dilution test plate 420 inoculated with about ~20 mostly wild type phage per well. Any positive luciferase wells are likely to have been inoculated with a single recombinant along with ~20 wild type phage. These wells can be analyzed for the presence of luciferase 442.

[0091] After addition of bacteria and incubation (e.g., 37°C for 2 hours) 418, soluble luciferase and phage are present in a ratio of about 20 wild type : 1 recombinant 420. Finally, a plaque assay 422 can be performed to screen for recombinants expressing luciferase 446. A small number of individual (e.g., n = 48) plaques can be individually picked and screened 426 on a third multi-well plate for luciferase activity 436. In one embodiment, this method should ensure about 3 recombinants in the mixture of plaques to be screened. One plaque can be removed from the plate 424 into each well of a 96-well plate and a luciferase test 426 can be performed to determine which wells contain phage exhibiting luciferase 442 activity. Wells 428 demonstrating luciferase activity represent pure recombinant phage 434, while wells 430 lacking luciferase activity represent pure wild type phage 432.

[0092] Individual plaques can then be suspended in buffer or media (e.g., 100 μL TMS), and aliquots (e.g., about 5 μL) are added to wells containing turbid E. coli 0157:H7 cultures, and assayed after incubation (e.g., about 45 minutes to 1 hour at 37°C). Positive wells are expected to contain pure recombinant phage cultures. Still, in certain embodiments, it is preferred to include another round of plaque purification.

[0093] Thus, as Figure 4 By way of illustration, recombinant phage produced by homologous recombination of a suitable recombinant plasmid with JG04 can be isolated from a mixture comprising 0.005% of total phage. After isolation, large scale production can be performed to obtain a high titer stock suitable for use in E. coli 0157:H7 detection assays. For example, as described in greater detail in the Examples herein, cesium chloride isopycnic gradient centrifugation can be used to isolate phage particles from contaminating luciferase proteins to reduce background.

[0094] In this manner, and as described in greater detail in the Examples below, recombinant phage can be produced having a target luciferase gene (e.g., a firefly, Oplophorus, or engineered luciferase, such as ) inserted into an environmentally-derived phage.

[0095] Methods for detecting microorganisms using infectious agents

[0096] As described herein, in certain embodiments, the present application can include methods for detecting microorganisms using infectious agents. The methods of the present application can be embodied in a variety of ways.

[0097] Thus, the methods of the present application take advantage of the high specificity of binding agents that recognize and bind to specific target microorganisms as a means to amplify the signal and thereby detect low levels of microorganisms (e.g., single microorganisms) present in a sample. For example, infectious agents (e.g., phage) specifically recognize surface receptors of specific microorganisms and thus specifically infect those microorganisms. Thus, these infectious agents can be suitable binding agents for targeting the target microorganisms. Some embodiments of the present application take advantage of the binding specificity and high level of genetic expression capability of infectious agents for rapidly and sensitively targeting infection and facilitating detection of the target microorganisms.

[0098] Thus, in one embodiment, the present application can include a method for detecting a target microorganism in a sample, comprising the steps of: incubating the sample with an infectious agent that infects the target microorganism, wherein the infectious agent comprises an indicator gene such that expression of the indicator gene during phage replication following infection of the target microorganism forms a soluble indicator protein product; and detecting the indicator protein product, wherein positive detection of the indicator protein product indicates the presence of the target microorganism in the sample.

[0099] Various infectious agents can be used. In alternative embodiments, invading live bacteria, fungi, mycoplasma, protozoa, yeast, and other live organisms visible under a microscope, bacteriophages, phages, mycobacteriophages (such as for TB and paraTB), fungal phages (such as for fungi), mycoplasma phages, and any other viruses can be used. For example, in one embodiment, where the target microorganism is a bacterium, the infectious agent can comprise a bacteriophage. As discussed herein, such a bacteriophage can replicate inside the bacterium to produce hundreds of daughter bacteria. Detection of the indicator gene inserted into the bacteriophage can be used as a measure of the bacteria in the sample. For example, well-studied bacteriophages of E. coli include Tl, T2, T3, T4, T5, T7, and lambda; other E. coli bacteriophages available from the ATCC repository include, for example, phiX174, S13, Ox6, MS2, phiVl, fd, PR772, and ZIKl. Alternatively, natural bacteriophages can be isolated from various environmental sources. The sources used for bacteriophage isolation can be selected based on the location in which the target microorganism is expected to be found. Thus, in some embodiments, the indicator bacteriophage comprises an indicator moiety, and infection of a single E. coli cell can be detected by the signal produced by the amplified indicator moiety. Thus, the method can comprise detecting the indicator moiety produced during the replication of the bacteriophage, wherein detection of the indicator indicates the presence of the target bacteria in the sample.

[0100] In one embodiment, the application can comprise a method for detecting a target bacterium in a sample, comprising the steps of: incubating the sample with a recombinant bacteriophage that infects the target bacterium, wherein the recombinant bacteriophage comprises an indicator gene inserted into a late gene region of the bacteriophage, such that expression of the indicator gene during replication of the bacteriophage following infection of the host bacterium forms a soluble indicator protein product; and detecting the indicator protein product, wherein positive detection of the indicator protein product indicates the presence of the target bacterium in the sample. In one embodiment, and as described in detail herein, the amount of indicator moiety detected corresponds to the amount of target bacterium present in the sample.

[0101] In one embodiment, the late gene region is a class III gene region. As described in greater detail herein, insertion of the indicator gene into a late class III gene region can ensure that the indicator gene is expressed in high numbers when replicated in the bacterium.

[0102] As described above for the compositions of the application, the bacteriophage is derived from a T7, T4, T4-like, JG04 bacteriophage or another natural bacteriophage having a genome that is at least 90% homologous to T7, T4, or other T4-like bacteriophage.

[0103] In addition, in certain embodiments, the indicator gene does not encode a fusion protein. Thus, in certain embodiments, expression of the indicator gene during phage replication following infection of the host bacteria forms a soluble indicator protein product.

[0104] Various indicator moieties can be used. In certain embodiments, the indicator gene can encode a luciferase. For example, the luciferase can be one of Oplophorus luciferase, Photuris luciferase, or an engineered luciferase.

[0105] As described in greater detail herein, the methods and systems of the present application can utilize various multiplicities of infection (MOI). In certain embodiments, the MOI is higher than standard tests. Such a relatively high MOI can allow infection of microorganisms present in a sample in very low amounts. For example, in certain embodiments, the phage concentration used for the incubation step is higher than 1 x 10 7 PFU / mL.

[0106] In certain embodiments, the recombinant infectious agent can be purified such that it is free of any residual indicator protein produced during production of the infectious agent stock. Thus, in certain embodiments, and as described in greater detail herein, the recombinant phage can be purified using a cesium chloride density gradient prior to incubation with the sample. When the infectious agent is a phage, such purification can have the added benefit of removing phage that do not have DNA (i.e., empty phage).

[0107] As further described below, in certain embodiments, the method can use a step of concentrating the microorganism of interest or capturing the microorganism of interest from a large sample. Thus, in certain embodiments, the method can include a step of capturing the microorganism from the sample on a solid support prior to the incubation step.

[0108] In some embodiments, the method can include contacting the microorganism captured on a solid support (e.g., magnetic beads or a filter matrix) with a plurality of specific infectious agents (e.g., indicator phage) and allowing the phage to bind and infect the bacteria. In other embodiments, capture of the microorganism is not necessary for detection. Various solid supports can be used. In certain embodiments, the solid support can include a multi-well plate, a filter, a bead, or a lateral flow strip, filter strip, filter disc, or filter paper, or a membrane designed for growing cells (e.g., PetriFilm by 3M). Other solid supports can also be suitable.

[0109] The microorganism of interest can be purified from the sample by using a binding agent. For example, in certain embodiments, the capture step further includes binding the microorganism with a capture antibody. The antibody can be used in conjunction with a solid support. For example, in certain embodiments, the capture antibody facilitates binding of the microorganism to the solid support.

[0110] The methods of the application can include various steps to improve sensitivity. For example, as discussed in greater detail herein, the methods can include a step of washing the captured and infected microorganisms after the addition of the bacteriophage, but before the incubation, to remove excess parental bacteriophage and / or luciferase or other reporter protein contaminating the bacteriophage preparation.

[0111] In contrast to tests known in the art, detection of the microorganism of interest can be accomplished without culturing the sample, which is a way to increase the population of microorganisms. Thus, in certain embodiments, detection of the microorganism of interest is accomplished in a time period that is shorter than the time period required to increase the number of microorganisms by 4-fold or 10-fold using enrichment culture. For example, in certain embodiments, the total time required for detection is less than 6.0 hours, 5.0 hours, 4.0 hours, 3.0 hours, 2.5 hours, 2.0 hours, 1.5 hours, 1.0 hour, 45 minutes, or less than 30 minutes.

[0112] In addition, in contrast to tests known in the art, the methods of the application can detect individual microorganisms. Thus, in certain embodiments, the methods can detect the presence of < 10 microorganism cells (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9 microorganisms) in a sample.

[0113] Accordingly, various aspects of the application provide methods for detecting microorganisms in a sample by an indicator moiety. In some embodiments, where the microorganism of interest is a bacterium, the indicator moiety can be associated with an infectious agent, such as an indicator bacteriophage. The indicator moiety can react with a substrate to emit a detectable signal or can emit an intrinsic signal (e.g., a fluorescent protein). In some embodiments, the sensitivity of detection can reveal the presence of as few as 50, 20, 10, 9, 8, 7, 6, 5, 4, 3, or 2 cells of the microorganism of interest in a test sample. In some embodiments, even a single cell of the microorganism of interest can produce a detectable signal.

[0114] In some embodiments, the indicator moiety associated with the infectious agent can be detected during or after replication of the infectious agent. Many different types of detectable biomolecules suitable for use as indicator moieties are known in the art, and many are commercially available. In some embodiments, the indicator phage includes an enzyme that is used as the indicator moiety. In some embodiments, the genome of the indicator phage is modified to encode a soluble protein. In some embodiments, the indicator phage encodes a detectable enzyme. The indicator can emit light and / or can be detected by a color change. Various suitable enzymes are commercially available, such as alkaline phosphatase (AP), horseradish peroxidase (HRP), or luciferase (Luc). In some embodiments, these enzymes can be used as indicator moieties. In some embodiments, the firefly luciferase is the indicator moiety. In some embodiments, the Oplophorus luciferase is the indicator moiety. In some embodiments, Other engineered luciferases or other enzymes that produce a detectable signal are also suitable indicator moieties.

[0115] Detecting the indicator can include detecting the emission of light. In some embodiments, a luminometer can be used to detect the indicator (e.g., luciferase). However, other instruments or devices can also be used. For example, a spectrophotometer, a CCD camera, or a CMOS camera can detect color changes and other light emissions.

[0116] In some embodiments, the indicator phage is genetically engineered to contain a gene for an enzyme, such as luciferase, that is produced only upon infection of the bacteria to which the phage specifically recognizes and infects. In some embodiments, the indicator moiety is expressed late in the viral life cycle. In some embodiments, the indicator is a soluble protein (e.g., soluble luciferase) and is not fused to a phage structural protein that limits its copy number, as described herein.

[0117] In various embodiments of the methods of the application, the microorganisms can be detected without the need for purification of any microorganisms from the sample. For example, in certain embodiments, a sample containing one or several microorganisms of interest can be applied directly to an assay vessel, such as a spin column, a microtiter well, or a filter, and the assay is performed in the assay vessel. Various embodiments of such assays are disclosed herein.

[0118] For example, after an aliquot of a test sample containing bacteria is applied to a spin column and infected with recombinant phage and optionally washed to remove any excess phage, the amount of soluble indicator detected will be proportional to the amount of phage produced by the infected bacteria. Example 4 describes such a test.

[0119] Alternatively, an aliquot of the test sample can be directly dispensed into a well of a multi-well plate, the indicator phage added, and after a period of time sufficient for infection, a lysis buffer added along with a substrate for the indicator moiety (e.g., luciferase substrate for a luciferase indicator) and detection of the indicator signal performed. Examples 5-6 describe embodiments of the method performed on filter plates. Examples 7-9 herein describe a variation of the assay termed the "no-concentration assay."

[0120] For example, in many embodiments, a multi-well plate is used to perform the assay. The choice of plate (or any other solution in which the detection can be performed) can affect the detection step. For example, some plates can include a colored or white background that can affect the detection of light emission. In general, white plates have higher sensitivity but also produce a higher background signal. Plates of other colors can produce a lower background signal but also have slightly lower sensitivity. Additionally, one cause of background signal is light leakage from one well to another adjacent well. There are plates that have white wells but the rest of the plate is black. This allows for high signal inside the well but prevents light leakage from well to well and thus can reduce background. Thus, the choice of plate or other assay vessel can affect the sensitivity and background signal of the assay.

[0121] Thus, in some embodiments utilizing indicator phage, the present application includes a method for detecting a microorganism of interest, comprising the steps of: capturing at least one sample microorganism; incubating the at least one microorganism with a plurality of indicator phage; allowing time for infection and replication to produce progeny phage and express a soluble indicator moiety; and detecting the progeny phage, or preferably the indicator agent, wherein detection of the indicator agent demonstrates the presence of the microorganism in the sample.

[0122] For example, in some embodiments, the test sample microorganisms can be captured by binding to the surface of a plate, or by filtration of the sample through a phage filter (e.g., a 0.45 μιη pore size spin filter or a plate filter). In one embodiment, the infectious agent (e.g., indicator phage) is added directly to the captured sample on the filter in a minimal volume. In one embodiment, the captured microorganisms on the filter or plate surface are then washed one or more times to remove excess unbound infectious agent. In one embodiment, media (e.g., Luria-Bertani, also referred to herein as LB broth) is added for a further incubation time to allow phage replication and high level expression of the gene encoding the indicator moiety. A surprising aspect of embodiments of the assay, however, is that the incubation step only requires a length of time sufficient for a single phage life cycle. It was previously thought that the use of phage required more time for amplification so that the phage could replicate several cycles. According to some embodiments of the present application, a single replication of the indicator phage is sufficient to facilitate a sensitive and rapid detection.

[0123] When the bacteria lyse, the soluble indicator (e.g., luciferase) is released into the surrounding liquid, which can then be measured and quantified. In one embodiment, the solution is then spun through a filter, and the filtrate is collected for testing by adding a substrate for the indicator enzyme (e.g., luciferase substrate). The filtrate can thus be removed from the capture solid support and analyzed in a new vessel (e.g., in a luminometer), or the indicator signal can be measured directly on the filter.

[0124] In various embodiments, the purified parental indicator phage does not include the detectable indicator itself, as the parental phage can be purified prior to use in incubation with the test sample. Expression of late (class III) genes occurs late in the viral life cycle. In some embodiments of the application, the parental phage can be purified to exclude any existing indicator protein (e.g., luciferase). In some embodiments, expression of the indicator gene during replication of the progeny phage following infection of the host bacteria forms the soluble indicator protein product. Thus, in many embodiments, the parental is not required to be separated from the progeny phage in the detection step. In one embodiment, the microorganism is a bacterium, and the indicator phage is a bacteriophage. In one embodiment, the indicator moiety is a soluble luciferase, which is released upon lysis of the host microorganism.

[0125] Thus, in alternative embodiments, the indicator substrate can be incubated with the sample portion held in a binding filter or binding plate surface. Thus, in some embodiments, the solid support is a 96-well filter plate (or a conventional 96-well plate), and the substrate reaction is detected by placing the plate directly into a luminometer.

[0126] For example, in one embodiment, the application can include a method for detecting E. coli 0157:H7, comprising the steps of: infecting cells captured on a 96-well filter plate with a plurality of parental indicator phage capable of expressing luciferase upon infection; washing away excess phage, adding LB broth and allowing time for the phage to replicate and lyse the specific E. coli target (e.g., 30-90 minutes); and detecting the indicator luciferase by adding luciferase substrate and measuring luciferase activity directly in the 96-well plate, wherein detection of luciferase activity indicates the presence of E. coli 0157:H7 in the sample.

[0127] In another embodiment, the application can include a method for detecting E. coli 0157:H7, comprising the steps of: infecting cells in a liquid solution or suspension in a 96-well plate with a plurality of parental indicator phage capable of expressing luciferase upon infection; allowing time for the phage to replicate and lyse the specific E. coli target (e.g., 30-90 minutes); and detecting the indicator luciferase by adding a luciferase substrate and measuring luciferase activity directly in the 96-well plate, wherein detection of luciferase activity indicates the presence of E. coli 0157:H7 in the sample. In such an embodiment, no capture step is required. In some embodiments, the liquid solution or suspension can be a consumable test sample, such as a vegetable wash. In some embodiments, the liquid solution or suspension can be a vegetable wash fortified with concentrated LB broth or nutrient broth. In some embodiments, the liquid solution or suspension can be bacteria diluted in LB broth.

[0128] In some embodiments, lysis of the microorganism can occur before, during, or after the detection step. Experiments have shown that in some embodiments, infected unlysed cells are detectable upon addition of the luciferase substrate. It is hypothesized that luciferase can escape the cell and / or that the luciferase substrate can enter the cell without complete cell lysis. Thus, for embodiments utilizing a spin filter system, where only luciferase released into the lysate (and not luciferase still inside intact bacteria) is analyzed in the luminometer, lysis is required for detection. However, for embodiments utilizing a filter plate or 96-well plate and a sample in solution or suspension, where the initial plate is filled with both intact and lysed cells is measured directly in the luminometer, lysis is not required for detection.

[0129] In some embodiments, the reaction of the indicator moiety (e.g., luciferase) with the substrate can continue for 30 minutes or more, and detection at different time points can be desirable for optimal sensitivity. For example, in embodiments utilizing a 96-well filter plate as a solid support and luciferase as an indicator, luminometer readings can be taken at the initial and at 10- or 15-minute intervals until the reaction is complete.

[0130] Surprisingly, detection of very small amounts of target microorganism in very short time periods has been successfully achieved using high concentrations of phage (i.e., high MOI) for infecting test samples. In some embodiments, incubation of phage with a test sample requires only a length of time sufficient for a single phage life cycle. In some embodiments, the concentration of phage used for this incubation step is higher than 7 x 10 6 , 8 x 10 6 , 9 x 10 6 , 1.0 x 10 7 , 1.1 x 107 1.2 x 10 7 1.3 x 10 7 1.4 x 10 7 1.5 x 10 7 1.6 x 10 7 1.7 x 10 7 1.8 x 10 7 1.9 x 10 7 2.0 x 10 7 3.0 x 10 7 4.0 x 10 7 5.0 x 10 7 6.0 x 10 7 7.0 x 10 7 8.0 x 10 7 9.0 x 10 7 or 10.0 x 10 8 PFU / mL.

[0131] The success of using such high concentrations of phage is surprising because large amounts of phage have previously been associated with "autolytic lysis", which kills the target cells and thereby prevents the production of useful signals from early phage tests. It is possible that the removal of the phage stocks prepared as described herein (e.g., removal by CsCl2 gradient ultracentrifugation) helps to alleviate this problem because, in addition to removing any contaminating luciferase associated with the phage, this removal can also remove ghost particles (particles with missing DNA). These ghost particles can lyse bacterial cells by "autolytic lysis", prematurely killing the cells and thereby preventing the production of the indicator signal. Electron microscopy has demonstrated that crude JG04 lysates (i.e., prior to CsCl2 removal) have more than 50% ghosts. These ghost particles can cause premature death of the microbe by the action of many phage particles puncturing the cell membrane. Thus, ghost particles can cause the problem previously reported where high PFU concentrations were detrimental. In addition, very clean phage preparations allow the tests to be performed without a washing step, which makes a non-concentrating assay possible.

[0132] Rotary column assay

[0133] Figure 5A strategy using an indicator bacteriophage that produces soluble luciferase is shown according to embodiments of the application. In this method, a bacteriophage (e.g., T7, T4, or JG04 bacteriophage) can be engineered to express soluble luciferase during the process of bacteriophage replication. Expression of luciferase is driven by a viral capsid promoter (e.g., the bacteriophage T7 or T4 late promoter), resulting in high expression. The parental bacteriophage will not contain luciferase, so the luciferase detected in the test must come from the replication of the progeny bacteriophage during the process of bacterial cell infection. Thus, there is typically no need to separate the parental bacteriophage from the progeny bacteriophage.

[0134] In these experiments, a sample 500 containing at least some of the E. coli bacteria 502 to be quantified is placed into a spin column filter and centrifuged to remove the LB broth, and T7 bacteriophage 504 genetically engineered to express soluble luciferase 503 is added at an appropriate multiplicity. The infected cells can be incubated for a time sufficient for progeny bacteriophage replication and cell lysis to occur (e.g., 30-90 minutes at 37°C). The parental 504 and progeny bacteriophage 516 plus free luciferase 503 in the lysate can then be collected (e.g., by centrifugation), and the luciferase level in the filtrate is quantified using a luminometer 518. Alternatively, a high-throughput method can be used, in which the bacterial sample is applied to a 96-well filter plate, and after all of the operations listed above are performed, the luciferase can be tested directly in the original 96-well filter plate, without a final centrifugation step.

[0135] Data from example experiments from embodiments of the application are shown in Figures 6-9 The results demonstrate that alternative embodiments of the application utilize an indicator bacteriophage to test sample bacteria by detection of soluble luciferase produced by the indicator bacteriophage infecting the bacteria. The indicator detection level, calibrated as relative light units (RLU), is plotted against the cell concentration determined from a standard overnight colony forming unit (CFU) assay and expressed as "cells per assay," thus demonstrating similar sensitivity. Increasing luciferase signal corresponds to increasing input sample cells, demonstrating a dose-dependent response.

[0136] As shown in Figure 6 The method of the application can demonstrate high sensitivity for detection of target bacteria using an indicator bacteriophage and spin column filter, as shown in Figure 1(As shown in the diagram). After incubation for a sufficient time for infection (e.g., 10 minutes at room temperature), the filter can be washed and rotated to remove excess introduced phage. Culture medium (e.g., LB broth) can be added and incubated (e.g., at 37°C for 30 minutes) to allow replication of progeny phages and lysis of bacteria. The filter can be rotated again to remove the filtrate, which can then be transferred to a photometer plate and subjected to a luciferase test (e.g., using...). Photometer, using luciferase assay reagent injection, Promega, Inc. Cell counts can be corrected based on the number of colonies in parallel CFU assays.

[0137] like Figure 6 As shown, approximately 1,700 bacterial cells were detected in the initial sample, and further serial dilution assays demonstrated that the detection decreased to an average of 1.7 cells, corresponding to actual detections of 1 or 2 cells. This indicates that infection with as few as 1 to 3 E. coli cells can provide a measurable signal through luciferase activity. This also demonstrates statistical significance even for the presence or absence of a single cell relative to the background (p = 0.018).

[0138] Figure 7 This demonstrates that using serial dilutions with a wider range of cell numbers is beneficial for... Figure 5 The test describes a very wide detection range for the same method. This indicates that the detection range can range from an average of 1.4 cells to 14 million cells.

[0139] Filter plate assay

[0140] As described above, in some embodiments, the determination can be performed directly in the well of the titration plate. For example, Figure 8 This study demonstrated the use of indicator phages with a 96-well filter plate for capture and detection. This method is similar to the methods described above for... Figure 5 The same applies except that the entire test is performed in a 96-well filter plate, including the luciferase reaction. Compared to the rotating filter method, this embodiment reduces operations and materials. The reduced operations and the use of the 96-well filter plate are suitable for high-throughput assays and, according to an embodiment of the invention, are suitable for use with liquid handling robots. Figure 8 This embodiment shows that the 96-well filter plate can be used to detect single E. coli cells (measured on average 0.5 cells, confirming that about half of the wells received single cells), 5.4, and 54 cells.

[0141] Figure 9It has been demonstrated that, in some implementations, using a 96-well system, a very wide range of cell concentrations can be obtained for the same assay, from an average of less than 1 cell / assay (single cell) to at least 14 million cells / assay. Multiple readings at different time points after the addition of the luciferase substrate demonstrate a wide range of sensitivities. Sensitivity for detecting <10 cells was obtained using 15-minute readings, and sensitivity down to the single-cell level was obtained using 30-minute readings. Therefore, time can be saved if it is not necessary to detect dozens or fewer cells. Note that the increased signal intensity with a higher number of input sample cells in both experiments further demonstrates a dose-dependent response.

[0142] Figure 10 A plate assay for detecting target bacteria using a modified bacteriophage is described according to an embodiment of the invention. An actual experiment utilizing this assay is described in Example 6. Briefly, a sample 1016 comprising target bacteria 1018 is added to the wells 1002 of a porous filter plate 1004 and rotated 1006 to concentrate the sample by removing liquid from it. Genetically modified bacteriophage 1020 is added to the wells and incubated with additional culture medium for a sufficient time for uptake 1008, followed by target bacterial infection and progression of the bacteriophage life cycle 1010 (e.g., ~45 minutes). Finally, a luciferase substrate is added and reacted with any present luciferase 1024. The resulting emission is measured in a photometer 1014, which detects luciferase activity 1026. Figure 11 Showing from Figure 10 The results of the filter plate measurements were plotted using... Bacteriophages were used to detect E. coli O157:H7 cells in samples with known cell counts. Student's t-test showed a p-value of 0.034 between each test for 0 and 1 cells, demonstrating statistical significance.

[0143] In some implementations, assays can be performed without concentrating and capturing bacteria on or near the surface. Figure 12A "no-concentration assay" for detecting target bacteria using modified bacteriophage according to embodiments of the application is illustrated. An aliquot of indicator phage 1214 is dispensed into individual wells 1202 of a multi-well plate 1204, and then an aliquot of test sample containing bacteria 1212 is added and incubated 1206 (e.g., 37°C for 45 minutes) for a time sufficient for the phage to replicate and produce soluble indicator 1216 (e.g., luciferase). The plate wells 1208 containing soluble indicator and phage can then be assayed 1210 to measure indicator activity 1218 (e.g., luciferase assay) on the plate. A true experiment utilizing this method is described in Examples 7-9. In this embodiment, the test sample is not concentrated (e.g., by centrifugation), but is simply incubated directly with the indicator phage for a period of time, and luciferase activity is subsequently assayed.

[0144] Figure 13 Results from a no-concentration assay of the type depicted in FIG. 1 are shown, using JG04-OpLuc phage to detect E. coli 0157:H7 in samples with a low number range of known cell numbers (i.e., samples of cells diluted extensively). As described in Example 7, this experiment demonstrated a statistically significant difference between the signal for 0 cells and 1 cell per assay (p-value = 0.0024 by ANOVA test), demonstrating the ability to detect a single cell. Thus, the assay was surprisingly sensitive. Samples with less than 1 cell per well appeared to show a proportional number of wells above background signal. Figure 12

[0145] Results from a no-concentration assay are shown, using JG04-OpLuc phage to detect E. coli 0157:H7 in samples with a very low to very high number range of known cell numbers (i.e., samples containing less than 1 cell per assay to millions of cells). As described in Example 8, this experiment demonstrated a statistically significant difference between the signal for 0 cells and 1.1 cells per assay (p-value = 0.000702, Student's t-test), demonstrating the ability to detect a single cell. More bacterial cells per assay demonstrated an incremental signal in a dose-dependent manner, up to at least 10 6 cells per assay, surprisingly demonstrating a very wide range of detection. Figure 14

[0146] Results from a no-concentration assay are shown, using JG04-OpLuc phage to detect E. coli 0157:H7 in vegetable wash samples with known cell numbers, as described in Example 9. Figure 15

[0147] ​To prepare the vegetable washing solution, weigh vegetable leaves (e.g., spinach or lettuce) and add them to a clean plastic bag. Add one mL LB (+ / - 0.01-0.05% Tween 20) per gram (g) of vegetables. Manually mix the leaves and solution for a few minutes. Then extract the liquid from the plastic bag and use it as the "vegetable washing solution". Using this method, ~1 million bacteria were found on a single spinach leaf (1-2g).

[0148] The test is quantitative because the detected signal is proportional to the amount of the target microorganism in the sample. For example, in Figure 15 In the experiments depicted, a known number of *E. coli* O157:H7 cells were added to a vegetable wash sample to stimulate plant contamination with pathogenic bacteria. Experiments using the vegetable wash sample demonstrated a significant difference in signal intensity between 0 and 3 cells per assay, demonstrating the ability to detect single-digit cell counts in the vegetable wash. Using more bacterial cells per assay showed a dose-dependent increase in signal intensity. The vegetable wash contained approximately 10... 6 Non-target bacteria / mL, corresponding to at least 10 per sample in this assay. 5 Non-target bacteria (including 0 Escherichia coli O157:H7 controls). Distinguished from 10 5 The ability of a non-target bacterium to detect as few as three target bacterial cells is surprising and further demonstrates the specificity of the test.

[0149] Microbe capture prior to exposure to infectious agent

[0150] In some embodiments, the present invention includes methods and systems that do not require a microbial capture step. Other embodiments allow for the physical isolation of bacterial cells from a sample. The methods described herein can be used as a means to facilitate the detection of low-level microorganisms (e.g., single microorganisms) present in a sample. The capture step may be based on a specific binding agent, such as an antibody that recognizes a target microorganism, or may be based on the selection of other characteristics of the microorganism, such as size grading.

[0151] In some embodiments, microorganisms are captured based on physical characteristics other than molecular specificity (e.g., size). In some embodiments, the present invention utilizes the physical size of microorganisms to capture them on a solid support. In some embodiments, the solid support is a filter. For example, filtering a sample through a bacterial filter (e.g., a 0.45 μm pore size rotary filter) allows smaller substances to pass through while retaining intact bacteria. Alternatively, plate filters can be used to capture microorganisms, or various other filter devices (e.g., 96-well filter plates) can be used.

[0152] For example, the method can include a step of collecting microorganisms on a solid support, such as, for example, filtering a sample through a bacterial filter. Following size-based capture, any binding agent that specifically targets the microorganism of interest can be used. For example, an infectious agent can be incubated with the captured microorganisms to specifically target and identify the microorganism of interest. Other methods of isolating microorganisms in a sample can be used. In some embodiments, the detection step can be performed prior to, concurrently with, or following such a capture step.

[0153] In some embodiments, a binding agent having high specificity for the microorganism of interest can be used as a means to facilitate specific capture of low levels of microorganisms (e.g., single microorganisms) present in a sample. In some embodiments, a large volume liquid sample to be tested can need to be effectively concentrated prior to further testing.

[0154] For example, a single bacterium, which can have a volume of about one cubic micron, can be isolated from a one microliter sample having 10 12 cubic microns of volume. In such embodiments, the capture step can include contacting the sample with a plurality (excess) of affinity-purified capture antibodies or antibody fragments.

[0155] Some embodiments utilize affinity-purified and / or reverse-purified surface-specific antibodies or antibody fragments raised against antigenic molecules found on the surface of the microorganism of interest. Such antibodies or antibody fragments can specifically identify the microorganism for capture or detection purposes, or both. Antibodies demonstrating specific recognition of surface antigens on various bacteria or other microorganisms are commercially available from various sources, such as Kirkegaard & Perry Laboratories, Inc. (KPL) or Abeam.

[0156] In some embodiments of the present application, affinity-purified and / or reverse-purified surface-specific antibodies that recognize a microorganism surface antigen of a particular microorganism (e.g., E. coli 0157:H7) do not recognize other similar microorganisms (e.g., E. coli B). In some embodiments, antibodies specific for, e.g., E. coli B or E. coli 0157:H7 do not recognize cells of Salmonella typhimurium or Staphylococcus epidermidis. This represents another surprising finding, as many bacteria have, for example, surface lipopolysaccharide (Gram-negative bacteria) or lipoteichoic acid (Gram-positive bacteria) molecules that were previously thought to be highly similar, especially between closely related species.

[0157] The methods for antibody-based capture disclosed herein are applicable to any target bacteria or other microorganism (e.g., pathogenic microorganism) for which a surface-specific antibody is available that does not cross-react with other microorganisms.

[0158] For example, in some embodiments, the capture step of the present application can use a microorganism-specific capture antibody or antibody fragment to facilitate capture of the microorganism. In some embodiments, the capture antibody can be conjugated to a chemical moiety that binds to another binding agent that is attached to a solid support (e.g., a bead or a plate surface). For example, in some embodiments, the capture antibody can be biotinylated to facilitate binding to streptavidin that is bound to a solid support. In some embodiments, the solid support comprises a magnetic bead. In other embodiments, the solid support comprises a plate surface or the surface of a multi-well plate (e.g., an ELISA plate). For example, an ELISA plate can be coated with an antibody that specifically recognizes a target microorganism.

[0159] In certain embodiments, the microorganism can be separated from other components of the sample by binding of the microorganism to free capture antibodies or antibody fragments that are subsequently bound to a solid support. In some embodiments, the capture antibodies or antibody fragments comprise a binding agent (e.g., biotin) that binds to a second agent (e.g., streptavidin) that is bound to the solid support.

[0160] In some embodiments, for example, if the capture antibody is labeled with biotin, the method can further comprise contacting the sample with a plurality of magnetic streptavidin-coated beads to bind the bacteria-antibody complex, and capturing the bead-antibody-bacteria complex with a magnet to isolate the bacteria. Or, other methods of purifying the biotin-antibody:bacteria complex can be used. Using such embodiments, bacteria in a milliliter sample can be concentrated to one microliter (~1000 fold), facilitating further detection and / or quantification by the methods described herein.

[0161] Thus, in some embodiments, the present application comprises a method for detecting a target microorganism, wherein the capture step comprises specifically isolating the microorganism from other components in the sample.

[0162] Alternatively, in some embodiments, the capture step can be based on other characteristics of the target microorganism, such as size. In embodiments that utilize size-based capture, the solid support can be a spin column filter. In some embodiments, the solid support comprises a 96-well filter plate. Or, the solid support for capture can be a location on an array or a mobile support (such as a bead).

[0163] Accordingly, in some embodiments, the above-described methods can be used to capture and isolate the target microorganism from a large volume prior to detection. For example, the properties of the capture antibody or antibody fragment can be used to specifically isolate the microorganism. In some embodiments, the capture antibody is biotinylated such that it facilitates subsequent binding of the cell-antibody complex to magnetic streptavidin beads. Or, the capture antibody can be conjugated to another protein or other molecule that facilitates capture on a bead or another solid support. Such embodiments can provide improved sensitivity, particularly in cases where the initial sample volume is large. Accordingly, the methods can include a step of attaching a plurality of binding agents that can specifically bind to surface antigens on the target microorganism, which thereby facilitate binding to a capture solid support.

[0164] Alternatively, magnetic beads can be coated with another chemical moiety that binds to the anti-bacterial antibody. For example, beads can be coated with a secondary antibody that recognizes or binds to the anti-bacterial antibody. The bacteria bound to the beads can then be isolated. In one embodiment, the efficiency of capture can be quantified by plating the bound bacteria onto agar and counting the resulting colonies (CFU). In other embodiments, the signal produced by reaction with a substrate (i.e., a substrate reagent for an indicator moiety) is measured for detection.

[0165] In some embodiments, the specificity of the antibody is demonstrated using specific capture on a solid support. One method of the present invention includes the step of obtaining and concentrating microorganisms (e.g., bacteria) from a sample by using a substrate with a microorganism-specific binding agent. In one embodiment, the binding agent is immobilized on a solid support (e.g., a magnetic bead), or is free and subsequently immobilized on a solid support. The immobilized microorganisms are then removed from the sample (e.g., by separation, decanting, magnetic force, or other suitable separation technique) and detected by various techniques.

[0166] Figure 16An example embodiment is depicted in which E. coli O157:H7 is specifically captured from a sample using antibodies raised against relatively intact E. coli O157:H7, but not E. coli B or Salmonella typhimurium. Thus, in certain embodiments, streptavidin-coated magnetic beads can be used to isolate E. coli O157:H7 pre-incubated with biotinylated polyclonal antibodies (KPL), affinity purified and reverse purified to minimize cross-reactivity with other microbial species. In certain embodiments, using specific E. coli O157:H7 antibodies, only E. coli O157:H7 is present in the captured fraction (i.e., the bead fraction), and no bacteria will be collected in the supernatant (unbound) fraction. In certain embodiments, using E. coli O157:H7 specific antibodies, only E. coli B and Salmonella typhimurium are found in the supernatant fraction, demonstrating the significant specificity of these antibodies. In the absence of antibodies, all three types of bacteria are found in the supernatant fraction.

[0167] Hybrid immunopetite (HIP) assay

[0168] In certain embodiments, the methods of the application incorporate the use of binding agents (e.g., antibodies) to purify and / or concentrate the target microorganism from the sample in addition to detection with the infectious agent. For example, in certain embodiments, the application includes a method for detecting a target microorganism in a sample, comprising the steps of: capturing the microorganism from the sample on a prior support using a capture antibody specific for the target microorganism; incubating the sample with a recombinant bacteriophage that infects the target microorganism, wherein the recombinant bacteriophage comprises an indicator gene inserted in a late gene region of the bacteriophage, such that expression of the indicator gene during bacteriophage replication following infection of the host bacteria forms a soluble indicator protein product; and detecting the indicator protein product, wherein positive detection of the indicator protein product indicates the presence of the target microorganism in the sample.

[0169] For example, Figure 17 A hybrid immuno-bacteriophage (HIP) assay is depicted in accordance with an embodiment of the application, using modified bacteriophage to detect target bacteria. A sample is first applied to a microtiter plate well coated with a bacteria-specific antibody 1702. The plate is then centrifuged to promote binding of the bacteria to the capture antibody 1704. After sufficient time to allow for complete bacterial capture, a solution containing bacteria-specific bacteriophage is added to each sample 1706. Incubation with the bacteriophage results in single or multiple bacteriophage binding and attachment to the captured bacteria 1708. Finally, the sample is incubated to promote bacteriophage replication and luciferase expression, which results in cell lysis and release of soluble luciferase 1710.

[0170] Figure 18Results from the HIP assay are shown, as described in Example 11, using Bacteriophage to detect E. coli O157:H7 in samples with known cell numbers on a logarithmic scale. The HIP assay was able to detect approximately 2 x 10 6 PFU Bacteriophage to detect 100 and 1,000 E. coli O157:H7 in LB media. The average signal range for cell-free samples was exceeded from approximately 50-fold for the 100 cell sample to over 1,000-fold for the 1,000 cell sample.

[0171] In some embodiments, the incubation step of the methods described herein comprises a final bacteriophage concentration of greater than 7 x 10 6 , 8 x 10 6 , 9 x 10 6 , 1.0 x 10 7 , 1.1 x 10 7 , 1.2 x 10 7 , 1.3 x 10 7 , 1.4 x 10 7 , 1.5 x 10 7 , 1.6 x 10 7 , 1.7 x 10 7 , 1.8 x 10 7 , 1.9 x 10 7 , 2.0 x 10 7 , 3.0 x 10 7 , 4.0 x 10 7 , 5.0 x 10 7 , 6.0 x 10 7 , 7.0 x 10 7 , 8.0 x 10 7 , 9.0 x 10 7 , or 1.0 x 10 8 PFU / mL. Such high bacteriophage concentrations were previously thought to be detrimental to such assays and thus produced surprising results. In some embodiments, the methods of the application require less than 3 hours, less than 2.5 hours, less than 2 hours, less than 1.5 hours, or less than 1 hour for detection of the microorganism of interest. In some embodiments, the methods can detect as few as 100, 50, 20, 10, 9, 8, 7, 6, 5, 4, 3, or 2 microorganism of interest cells. These are shorter time periods than previously thought possible. In some embodiments, even a single microorganism cell is detectable. In other embodiments, the application includes systems (e.g., computer systems, automated systems, or kits) comprising components for performing the methods disclosed herein and / or using the infectious agents modified herein.

[0172] Systems and kits of the invention

[0173] In some embodiments, the invention includes systems (e.g., automated systems or kits) that include components for performing the methods disclosed herein. Some embodiments described herein are particularly suitable for automation or kits in view of the small amount of reagents and materials required to perform the methods. In certain embodiments, each component of the kit can include a self-contained unit that can be transferred from a first location to a second location.

[0174] In some embodiments, the invention includes systems or kits for rapid detection of a target microorganism in a sample. In certain embodiments, the systems or kits include a component for incubating the sample with an infectious agent specific for the target microorganism, wherein the infectious agent includes an indicator moiety, and a component for detecting the indicator moiety. In some embodiments of the systems and kits of the invention, the infectious agent is a recombinant bacteriophage that infects the target microorganism, and the recombinant bacteriophage comprises an indicator gene inserted into a late gene region of the bacteriophage as the indicator moiety, such that expression of the indicator gene during bacteriophage replication following infection of the host bacteria forms a soluble indicator protein product. Some systems further include a component for capturing the target microorganism on a solid support.

[0175] In certain embodiments, the systems and / or kits can further include a component for washing the captured microorganism sample. Additionally or alternatively, the systems and / or kits can further include a component for measuring the amount of indicator moiety, wherein the amount of indicator moiety detected corresponds to the amount of microorganism in the sample. For example, in certain embodiments, the systems or kits can include a luminometer or other device for measuring luciferase activity.

[0176] In some systems and / or kits, the same component can be used for multiple steps. In some systems and / or kits, the steps are automated or controlled by a user via computer input and / or wherein a liquid handling robot performs at least one step.

[0177] Accordingly, in certain embodiments, the application can include a system for rapid detection of a target microorganism in a sample, the system comprising: a component for incubating the sample with an infectious agent specific for the target microorganism, wherein the infectious agent comprises an indicator moiety; a component for capturing microorganisms from the sample on a solid support; a component for washing the captured microorganism sample to remove unbound infectious agent; and a component for detecting the indicator moiety. In some embodiments, the same component can be used for the steps of capturing and / or incubating and / or washing. Some embodiments additionally comprise a component for determining the amount of the target microorganism in the sample, wherein the amount of the indicator moiety detected corresponds to the amount of microorganism in the sample. Such a system can include various embodiments and subembodiments similar to those described above for the rapid detection of microorganisms method. In one embodiment, the microorganism is a bacterium and the infectious agent is a bacteriophage. In a computerized system, the system can be fully automated, semi-automated, or directed by a user through a computer (or some combination thereof).

[0178] In some embodiments, the system can include a component for separating the target microorganism from other components in the sample.

[0179] In one embodiment, the application includes a system comprising a component for detecting a target microorganism, comprising: a component for separating the target microorganism from other components in the sample; a component for infecting at least one microorganism with a plurality of parent infectious agents; a component for lysing the at least one infected microorganism to release progeny infectious agents present in the microorganism; and a component for detecting the progeny infectious agents or a component of the progeny infectious agents, wherein detection of the infectious agents or the infectious agent component indicates the presence of the microorganism in the sample.

[0180] The system can include various components for detecting the progeny infectious agents. For example, in one embodiment, the progeny infectious agents (e.g., bacteriophage) can comprise an indicator moiety. In one embodiment, the indicator moiety in the progeny infectious agents (e.g., bacteriophage) can be a detectable moiety expressed during replication, such as a soluble luciferase protein.

[0181] In other embodiments, the application can include a kit for rapid detection of a target microorganism in a sample, the system comprising: a component for incubating the sample with an infectious agent specific for the target microorganism, wherein the infectious agent comprises an indicator moiety; a component for capturing the microorganism from the sample on a solid support; a component for washing the captured microorganism sample to remove unbound infectious agent; and a component for detecting the indicator moiety. In some embodiments, the same component can be used for the steps of capturing and / or incubating and / or washing. Some embodiments additionally comprise a component for determining the amount of target microorganism in the sample, wherein the amount of indicator moiety detected corresponds to the amount of microorganism in the sample. Such kits can include various embodiments and subembodiments similar to those described above for the method of rapid detection of a microorganism. In one embodiment, the microorganism is a bacterium and the infectious agent is a bacteriophage.

[0182] In some embodiments, the kit can include a component for isolating the target microorganism from other components in the sample.

[0183] In one embodiment, the application includes a kit comprising components for detecting a target microorganism, comprising: a component for isolating at least one microorganism from other components in a sample; a component for infecting the at least one microorganism with a plurality of parent infectious agents; a component for lysing the at least one infected microorganism to release progeny infectious agents present in the microorganism; and a component for detecting the progeny infectious agents or a component of the progeny infectious agents, wherein detection of the infectious agents or the component of the infectious agents indicates the presence of the microorganism in the sample.

[0184] The kit can include various components for detecting the progeny infectious agents. For example, in one embodiment, the progeny infectious agents (e.g., bacteriophage) can comprise an indicator moiety. In one embodiment, the indicator moiety in the progeny infectious agents (e.g., bacteriophage) can be a detectable moiety expressed during replication, such as a soluble luciferase protein.

[0185] The systems and kits of the application include various components. As used herein, the term "component" is broadly defined and includes any suitable device or collection of devices suitable for carrying out the described methods. The components need not be integrally connected or disposed relative to one another in any particular way. The application includes any suitable arrangement of components relative to one another. For example, the components need not be in the same room. In some embodiments, the components are connected to one another in a machine group. In some embodiments, the same component can perform multiple functions.

[0186] Computer system and computer readable medium

[0187] The system described in the present invention or any component thereof can be embodied in the form of a computer system. Typical examples of computer systems include general purpose computers, programmed microprocessors, microcontrollers, peripheral integrated circuit elements, and other devices or elements of software that are capable of performing the steps of the technology method in accordance with this invention.

[0188] The computer system can include a computer, input device, display unit and / or internet. The computer can further include a microprocessor. The microprocessor can connect a communication bus. The computer can also include a memory. The memory can include a random access memory (RAM) and a read only memory (ROM). The computer system can further include a storage device. The storage device can be a hard disk drive or a removable storage drive, such as a floppy disk drive, optical disk drive etc. The storage device can also be other similar means for loading computer programs or other instructions to the computer system. The computer system can also include a communication unit. The communication unit allows the computer to connect to other databases and the internet through the I / O interface. The communication unit allows data to be transferred to and from other databases and the internet. The communication unit can include a modem, an Ethernet card or any similar device capable of connecting the computer system to databases and networks, such as LAN, MAN, WAN and the internet. The computer system is thus advantageously able to receive input from a user through the input device, through the I / O interface.

[0189] The computing device will typically include an operating system that provides executable program instructions for the general administration and operation of that device, and typically will include a computer readable storage medium (e.g., hard disk, random access memory, read only memory, etc.) that stores instructions that, when executed by a processor of the server, allow the computing device to perform its intended functions. Suitable implementations for an operating system and general functionality of a computing device are known or commercially available, and are readily implemented by persons having ordinary skill in the art, particularly in light of the disclosure herein.

[0190] The computer system executes a set of instructions that are stored in one or more storage elements, in order to process input data. The storage elements can also store data or other information as desired or needed. The storage element can be in the form of an information source or a physical memory element present in the processing machine.

[0191] The environment can include various data stores such as above discussed and other memory and storage media as appropriate. These can reside in a variety of locations, such as on a storage medium local to (and / or resident in) one or more of the computers or remote from any or all of the computers across the network. In a particular set of embodiments, the information can reside in a storage-area network ("SAN") familiar to those skilled in the art. Similarly, any necessary files for performing the functions attributed to the computers, servers, or other network devices can be stored locally and / or remotely as appropriate. Where a system includes computers in a networked environment, each computer can include a communication mechanism such as a bus for passing computer readable instructions from one computer to another, over a network, from or to one or more remote systems such as a remote server on which software is executed, or a database server to which requests for data are made. The communication mechanism can be any suitable transmission mechanism including a wireless link, a wired link, or a combination thereof.

[0192] Such devices also can include a computer-readable storage media reader, a communications device (e.g., a modem, a network card (wireless or wired), an infrared communication device, etc.), and working memory as described above. The computer- readable storage media reader can be connected with a computer-readable storage medium, or the like, such as a storage device, to receive computer-readable data, instructions, program code, or the like. The communications device can permit information to be transferred between the computing device and other computer systems or a network. The system and various devices also typically will include a number of software applications, modules, components, or the like, stored on or in one or more of the various computer-readable storage media, including an operating system and application programs, such as a client application or Web browser. It should be appreciated that alternate embodiments can have various changes from this described embodiment. For example, customized hardware might also be used and / or particular elements might be implemented in hardware, software (including portable software, such as applets) or both. Furthermore, connection to other computing devices such as network input / output devices can be employed.

[0193] Non-transitory storage media and computer readable media for including encoded or a portion of encoded can include any suitable media known or used in the art, including storage media and communication media, such as but not limited to, volatile and non-volatile, removable and non-removable media implemented in any method or technology for storage and / or transmission of information such as computer readable instructions, data structures, program modules, or other data, including RAM, ROM, EEPROM, flash memory or other memory technology, CD-ROM, digital versatile disks (DVD) or other optical storage, magnetic cassettes, magnetic tapes, magnetic disk storage or other magnetic storage devices, or any other medium which can be used to store the desired information and which can be accessed by a system device. Based on the disclosure and teachings provided herein, a person of ordinary skill in the art will appreciate other ways and / or methods to implement the various embodiments.

[0194] Computer readable media can include, but is not limited to, electrical, optical, magnetic, or other storage devices capable of providing a processor with computer readable instructions. Other examples include, but are not limited to, a floppy disk, CD-ROM, DVD, magnetic disk, memory chip, ROM, RAM, SRAM, DRAM, content addressable memory ("CAM"), DDR, flash memory such as NAND flash or NOR flash, ASIC, configured processor, optical storage, magnetic tape, or other magnetic storage, or any other medium from which a processor can read instructions. In one embodiment, a computing device can include a single type of computer readable media, such as random access memory (RAM). In other embodiments, a computing device can include two or more types of computer readable media, such as random access memory (RAM), a disk drive, and flash memory. A computing device can be in communication with one or more external computer readable media, such as an external hard disk drive or an external DVD drive.

[0195] As discussed above, the implementations include a processor configured to execute computer-readable program instructions and / or access information stored in memory. The instructions can include processor-specific instructions generated by an assembler and / or an interpreter from code written in any suitable computer programming language, including, for example, C, C++, C#, Visual Basic, Java, Python, Perl, JavaScript, and ActionScript (Adobe Systems, Mountain View, Calif.). In one implementation, a computing device includes a single processor. In other implementations, a device includes two or more processors. Such processors can include microprocessors, digital signal processors (DSPs), application-specific integrated circuits (ASICs), field programmable gate arrays (FPGAs), and state machines. Such processors can further include programmable electronic devices such as PLCs, programmable interrupt controllers (PICs), programmable logic devices (PLDs), programmable read-only memories (PROMs), electrically programmable read-only memories (EPROMs or EEPROMs), or other similar devices.

[0196] A computing device includes a network interface. In some implementations, a network interface is configured to communicate over wired or wireless communication links. For example, a network interface can allow communication over a network via Ethernet, IEEE 802.11 (Wi-Fi), 802.16 (Wi-Max), Bluetooth, infrared, etc. As another example, a network interface allows communication over a network such as a CDMA, GSM, UMTS, or other cellular communication network. In some implementations, a network interface allows point-to-point connection with another device, such as via a Universal Serial Bus (USB), 1394 FireWire, serial, or parallel, or similar interface. Some implementations of suitable computing devices can include two or more network interfaces for communicating over one or more networks. In some implementations, a computing device can include a data store in addition to or instead of a network interface.

[0197] Some implementations of suitable computing devices can include or interface with various external or internal devices or peripherals, such as a mouse, a CD-ROM, DVD, a keyboard, a display, a speaker, one or more microphones, or any other input or output device. For example, a computing device can interface to various user interface and display devices. A display device can use any suitable technology, including, but not limited to, LCD, LED, CRT, etc.

[0198] A set of instructions for execution by a computer system can include various requirements for a command processor to perform a particular task, such as steps that make up a method of the technology of the present invention. The set of instructions can be in the form of a software program. Further, the software can be in the form of a collection of separately executable program modules, program modules having a larger program, or portions of program modules, as in the technology herein. The software can also include object-oriented programming in the form of modules targeted for a particular application. Processing of input data by the processor can be in response to a user request, a result of previous processing, or a requirement formed by another processor.

[0199] While the present invention has been disclosed with respect to certain embodiments, various modifications, changes and variations of the described embodiments can become apparent and are intended to fall within the scope of the invention as defined in the appended claims. Thus, it is intended that the present invention not be limited to the described embodiments, but that it include all modifications and alternatives within the scope of the present invention as defined by the language of the claims.

[0200] Some embodiments of the technology described herein can be defined according to any one of the following numbered paragraphs:

[0201] (1) A recombinant bacteriophage comprising an indicator gene inserted into a late gene region of the bacteriophage, and optionally wherein the late gene is a class III gene region, and optionally wherein transcription of the indicator gene is controlled by a bacteriophage class III or "late" promoter.

[0202] (2) The recombinant bacteriophage of paragraph 1, wherein the bacteriophage is derived from a T7, T4, T4-like, JG04 bacteriophage or another natural bacteriophage having a genome at least 90% homologous to T7, JG04, T4 or other T4-like bacteriophage; and / or wherein the amount of indicator moiety detected corresponds to the amount of target microorganism present in the sample.

[0203] (3) The bacteriophage of any one of paragraphs 1-2, wherein the indicator gene does not encode a fusion protein and / or wherein the indicator gene is adjacent to a major capsid gene, and optionally wherein expression of the indicator gene during bacteriophage replication following infection of the host bacterium forms a soluble indicator protein product.

[0204] (4) The bacteriophage of any one of paragraphs 1-3, wherein the indicator gene encodes a luciferase, and optionally wherein the luciferase is one of Oplophorus luciferase, Photuris luciferase or an engineered luciferase.

[0205] (5) A method of detecting a target microorganism in a sample, comprising the steps of: incubating the sample with a recombinant bacteriophage that infects the target microorganism, wherein the recombinant bacteriophage comprises an indicator gene inserted in a late gene region of the bacteriophage, such that expression of the indicator gene during bacteriophage replication following infection of the host bacteria forms a soluble indicator protein product; and detecting the indicator protein product, wherein positive detection of the indicator protein product indicates the presence of the target microorganism in the sample.

[0206] (6) The method of paragraph 5, wherein the late gene region is a class III gene region, and optionally wherein transcription of the indicator gene is controlled by a bacteriophage class III promoter.

[0207] (7) The method of paragraph 5 or 6, wherein the bacteriophage is derived from T7, T4, T4-like, JG04, or another natural bacteriophage having a genome that is at least 90% homologous to T7, T4, or other T4-like bacteriophage; and / or wherein the amount of indicator moiety detected corresponds to the amount of target microorganism present in the sample.

[0208] (8) The method of any one of paragraphs 5-7, wherein the indicator gene does not encode a fusion protein and / or wherein the indicator gene is adjacent to a major capsid gene, and optionally wherein expression of the indicator gene during bacteriophage replication following infection of the host bacteria forms a soluble indicator protein product.

[0209] (9) The method of any one of paragraphs 5-8, wherein the indicator gene encodes a luciferase, and optionally wherein the luciferase is one of Oplophorus luciferase, Photuris luciferase, or an engineered luciferase.

[0210] (10) The method of any one of paragraphs 5-9, wherein the concentration of bacteriophage used in the incubation step is higher than 1 x 10 7 PFU / mL, and optionally wherein the recombinant bacteriophage is purified using a cesium chloride isopycnic centrifugation prior to incubation with the sample.

[0211] (11) The method of any one of paragraphs 5-10, further comprising the step of capturing the microorganism from the sample on a solid support prior to the incubation step; and optionally wherein the solid support comprises a multi-well plate or a filter; and optionally wherein the capturing step further comprises binding the microorganism with a capture antibody; and optionally wherein the capture antibody facilitates binding of the microorganism to the solid support; and optionally wherein the method further comprises the step of washing the captured and infected microorganism to remove excess bacteriophage and / or contaminating reporter protein, such as luciferase, after addition of the bacteriophage but prior to incubation.

[0212] (12) The method of any one of paragraphs 5-11, wherein the detection of the target microorganism is completed in a time shorter than the time required to increase the number of microorganisms to 4- or 10- times the original amount using enrichment culture; and optionally wherein the method can detect ≤10 microbial cells in a sample, and optionally wherein the total time required for detection is less than 2 hours.

[0213] (13) A system for rapid detection of a target microorganism in a sample, comprising: a component for incubating the sample with an infectious agent specific to the target microorganism, wherein the infectious agent includes an indicator portion; and a component for detecting the indicator portion; and optionally further comprising a component for determining the amount of the target microorganism in the sample, wherein the amount of the detected indicator portion corresponds to the amount of microorganism in the sample; and optionally further comprising a component for capturing the target microorganism on a solid support, and / or further comprising a component for washing the captured microbial sample, and optionally wherein the same components may be used in multiple steps.

[0214] (14) The system of paragraph 13, wherein the infectious agent is a recombinant phage infecting the target microorganism, wherein the recombinant phage includes an indicator gene inserted into the late gene region of the phage as an indicator portion, such that expression of the indicator during phage replication after infection with the host bacteria forms a soluble indicator protein product; and optionally wherein the steps are automated or controlled by a user via computer input and / or wherein a liquid-operated robot performs at least one step; or wherein the system includes a kit.

[0215] (15) A non-transient computer-readable medium for use with the methods of any one of paragraphs 5-12 and / or the systems of any one of paragraphs 13-14. Example

[0216] The results described in the following examples, except for Example 11, were obtained without enrichment culture or incubation of the sample to achieve sample cell replication. Furthermore, in the "unconcentrated assay," the indicator phage is added directly to the sample without cell concentration, allowing for the infection and detection of small numbers of cells, or even single bacteria.

[0217] Example 1. Formation of indicator phages

[0218] Using materials from Millipore, Inc. The 415-1 phage display system produced indicator phages. In short, purchased purified... DNA was digested with the DNA restriction enzymes EcoRI and HindIII (New England Biolabs) and the cut DNA was subsequently purified. The gene for wild-type luciferase (from the common eastern firefly, Photinus pyralis) was synthesized using the bacteriophage T7 upstream region, including the late T7 promoter, to ensure high level expression of the luciferase gene.

[0219] The synthesized luciferase gene is designated SEQ ID NO. 1. This gene was amplified by PCR to include compatible restriction enzyme recognition sites for EcoRI and HindIII to ensure that the new gene could be inserted 415-1 genome using the following primers:

[0220] TATCTGAATTCTAAGTAACTGATAATACGACTCACTATAGGGAGACCACAAC, designated SEQ ID NO. 2, and

[0221] AATGAAAGCTTTTACAATTTGGACTTTCCGCCCTTCTTGG, designated SEQ ID NO. 3.

[0222] In addition, a stop codon in all three reading frames was added upstream of the luciferase start site to stop production of the bacteriophage major coat protein (gene 10B product). The 415-1 phage display system was designed to form a fusion product of the gene 10B major coat protein and any small protein inserted downstream. The addition of the stop codon ensures that no fusion product is formed and allows the relatively large luciferase gene to be expressed in soluble form. The PCR product was digested with EcoR1 and HindIII, purified, and ligated 415-1. The ligation product was inserted into MegaX DH10B electrocompetent cells (Invitrogen) using the BioRad MicroPulser electroporation system and the culture was plated on E. coli for phage plaques. Plaques were picked and the phage grown in E. coli DH10B and purified by sucrose density gradient centrifugation for use as the indicator phage, 415-Luc.

[0223] Figure 1 Example indicator phage 415 - Genomic structure of. The detectable indicator moiety is encoded by the luciferase gene inserted in the class III gene region, which is expressed late in the viral life cycle and at higher levels than other phage genes. The construct contains a stop codon to ensure that luciferase is not incorporated into the native gene product, such as the capsid protein gene 10B, and thus is not a fusion unit. Thus, this construct allows progeny phage to express soluble luciferase as an indicator to be detected.

[0224] Example 2. Isolation and purification of E. coli 0157:H7 specific phage from the environment.

[0225] Samples from the Hyperion wastewater treatment plant were obtained along with water samples from the adjacent Ballona Wetlands. The samples were mixed 1 x with powdered nutrient broth (Gibco, Inc.) and inoculated with E. coli 0157:H7 (ATCC 43888) from a 3 mL turbid culture. The samples were incubated at 37°C for 3 hours with shaking to enrich for phage that infect E. coli 0157:H7, lysed with 120 μL chloroform, vortexed for 15 seconds, and 1 mL of the sample was centrifuged at 6800 g for 2 minutes. The supernatant was filtered (0.45 μm filter) and plated for phage plaques on E. coli 0157:H7. This sample was plated at various dilutions in a plaque test to obtain plaques isolated in wells. A single plaque was pierced with a disposable pipette tip and resuspended in 100 μL TMS buffer (50 mM Tris-HCl, pH 7.4, 10 mM MgCl2, and 100 mM NaCl).

[0226] E. coli strains 0157:H7, B, and DH10B, and Salmonella strains were tested for plaques using a 5 μL aliquot of the resuspended phage plaque on top agar. Only the clear 0157:H7 phage propagated in E. coli 0157:H7, the lysate was clarified by centrifugation and the particles were loaded into TMS buffer using a buffer exchange column.

[0227] Eight closely related phage isolates were grown on E. coli 0157:H7, purified, and the genomes isolated and sequenced. Three genome types all showed 98% homology to the T4-like phage RB69. Based on this homology, the late genes were mapped and phage JG04 was selected for further study. Figure 2 JG04 is shown, and the genome of JG04 is designated SEQ ID NO. 4.

[0228] Example 3. Production and purification of recombinant indicator phage

[0229] ​Based on sequence analysis and mapping of the late gene region, homologous recombination sequences were synthesized using an insert for various reporter genes combined with different luciferase proteins as shown in Figure 3 Specifically, three constructs were used: a Firefly luciferase homologous recombination plasmid, pUC57.HR.Fluc, corresponding to SEQ ID NO. 5; a homologous recombination plasmid, pUC57.HR. corresponding to SEQ ID NO. 6; and an Oplophorus luciferase homologous recombination plasmid, pUC19.HR.OpLuc.KanR, corresponding to SEQ ID NO. 7.

[0230] The upstream T4 late gene promoter was used to insert the luciferase genes to ensure expression during the late stages of the virus. In some cases, a rapamycin resistance marker was also inserted to allow selection of infected cells under rapamycin antibiotic. These regions were flanked by up to 500 bp of sequence matching the capsid proteins, gp23 and gp24. These synthetic sequences were carried by ampicillin resistant pUC57 or pUC19.

[0231] Using Gene Pulser II electroporator, the plasmids containing the synthetic sequences were transformed into electroporated competent E. coli 0157:H7, conferring ampicillin resistance. Colonies were screened for positive transformation by testing with the appropriate luciferase substrate (D-luciferin for Firefly luciferase, Enteroluciferin for Oplophorus luciferase, and Enteroluciferin or for GFP for Oplophorus luciferase). E. coli 0157:H7 with the plasmid having luc flanked by sequences homologous to phage JG04 were grown in LB broth bacteria containing ampicillin and the bacterial culture was grown in LB broth containing ampicillin to approximately 10 7 cells / mL. The culture was then infected with 1 MOI of phage JG04 and incubated at 37°C with shaking for 45 minutes to lyse the cells. The lysate contained a mixture of mostly wild type phage with a small amount of recombinant phage formed by homologous recombination of the homologous recombination plasmid to the wild type phage genome.

[0232] To determine the ratio of recombinant phage to wild type phage, a limiting dilution assay based on TCID50 (tissue culture infective dose 50%) is used to determine the concentration of infectious units (IU / mL), analogous to the number of viral particles or phage plaque forming units, and the number of luciferase transduction units (TU / mL) is determined. In these tests, samples are serially diluted and aliquots of each dilution are placed into duplicate wells containing E. coli 0157:H7 bacteria. Any well that shows luciferase activity must have been infected with at least one recombinant phage. Based on the highest dilution at which each of these occurred, the initial concentration is back calculated. These initial phage mixtures from transformed cells typically yield a ratio of 20,000 wild type IU for each recombinant phage TU. A step of isolating and amplifying the recombinant phage is then performed.

[0233] As shown in Figure 4 Recombinant phage making up 0.005% of the total phage are isolated from the mixture. The phage mixture is diluted into 96 well plates to obtain an average of 3 recombinant TUs per plate, which resolves into approximately 625 IU of mostly wild type phage per well. Each well contains 50 μL of turbid E. coli 0157:H7. After incubation at 37°C for 2 hours, the wells are sampled and screened for the presence of luciferase. Any positive well is likely to have been inoculated with a single recombinant phage, and ~600 wild type phage, which is an enrichment relative to the initial 20,000:1 ratio. Progeny from this enriched culture are subjected to another limiting dilution assay to verify the ratio and determine the actual concentration of recombinant phage transduction units.

[0234] Again, 3 recombinant TUs per 96-well plate are aliquoted from this stock, creating a rough inoculum of ~20 mostly wild type phage per well. Any positive luciferase well is likely to have been inoculated with a single recombinant phage along with ~20 wild type phage. These wells are analyzed for luciferase activity, and any positive well is subjected to a limiting dilution assay to determine the ratio of TUs to IU, and then to a plaque test to obtain a plaque isolate from the well.

[0235] At this point, the expected ratio of wild type to recombinant is approximately 20:1. Forty-eight plaques are individually picked and screened for luciferase transduction ability, ensuring that approximately 3 recombinants are in the mixture of plaques to be screened. Each plaque is suspended in 100 μL of TMS, and 5 μL is added to a well containing a turbid E. coli 0157:H7 culture, and the well is assayed after incubation at 37°C for 45 minutes to 1 hour.

[0236] Positive wells were expected to contain pure recombinant phage cultures, but another round of plaque purification was a standard procedure. Large scale production was performed to obtain high titer stocks suitable for use in E. coli 0157:H7 detection assays. Cesium chloride isopycnic gradient centrifugation was used to separate phage particles from contaminating luciferase protein to reduce background.

[0237] Example 4. Bacterial detection using an indicator phage with a spin column filter

[0238] Figure 5 Bacterial detection using an indicator phage and a spin column filter is illustrated according to embodiments of the application. In an example embodiment, E. coli DH10B was grown in Luria-Bertani broth (LB) at 37°C with shaking. At an OD600 of 0.5, the culture was infected with 415-Luc at a multiplicity of infection (MOI) of 0.01. The culture was incubated at 37°C for 1 hour, then placed on ice for 10 minutes. The culture was centrifuged at 6000g for 10 minutes at 4°C, and the supernatant was discarded. The cell pellet was resuspended in 1 mL of ice cold PBS, and the cell count was determined using a hemocytometer. The cell count was adjusted to 3000 cells / mL with PBS. The cell suspension was diluted 1:10 with PBS, and 0.1 mL was added to each of three spin column filters. The filters were spun at 600g for 1 minute. Then, 40 μL of each of the following phage dilutions was added to each filter: 1:10, 1:100, 1:1000, 1:10,000, and 1:100,000. The filters were incubated at room temperature for 10 minutes. The filters were washed twice by adding 400 μL of PBST (0.05% Tween) and centrifuging at 600g for 1 minute. Then 50 μL of LB was added, and the filters were incubated at 37°C for 30 minutes. The filters were spun at 6800g for 2 minutes. Then, 30 μL of the filtrate was transferred to a 96-well luminometer plate, and a luciferase assay was performed in a Promega luminometer by injecting 100 μL of luciferase assay reagent (Promega, Inc.). The cell count was corrected according to the number of colonies in a parallel CFU assay. The ratio of signal to background was obtained by dividing the signal of each well by the average of the signal from the zero cell controls. 415-Luc phage was diluted to 10 8 PFU / 40 μL (2.5 x 10 9 PFU / mL). The cell count was determined and diluted to 3000, 300, 30, and 3 cells / mL. CFU assays were performed in parallel with the luciferase assays to determine the actual number of input cells for each assay.

[0239] For each cell dilution, 0.1 mL was added to the filters in triplicate. The filters were spun at 600g for 1 minute. Then, 40 μL of each phage dilution was added to each filter, which was then incubated at room temperature for 10 minutes. The filters were washed twice by adding 400 μL of PBST (0.05% Tween) and centrifuging at 600g for 1 minute. Then 50 μL of LB was added, and the filters were incubated at 37°C for 30 minutes. The filters were spun at 6800g for 2 minutes. Then, 30 μL of the filtrate was transferred to a 96-well luminometer plate, and a luciferase assay was performed in a Promega luminometer by injecting 100 μL of luciferase assay reagent (Promega, Inc.). The cell count was corrected according to the number of colonies in a parallel CFU assay. The ratio of signal to background was obtained by dividing the signal of each well by the average of the signal from the zero cell controls. 200 96-well luminometer plate, and a luciferase assay was performed in a Promega luminometer by injecting 100 μL of luciferase assay reagent (Promega, Inc.). The cell count was corrected according to the number of colonies in a parallel CFU assay. The ratio of signal to background was obtained by dividing the signal of each well by the average of the signal from the zero cell controls. Figure 6 Results are shown demonstrating high test sensitivity to detect as few as 1 to 3 E. coli cells by luciferase activity. Figure 7 Results are shown demonstrating very large detection range of the same method using serial dilutions of a starting bacterial sample. This allows detection of an average of 1.4 cells to 1.4 million cells.

[0240] Example 5. Bacterial detection using an indicator phage with a 96-well filter plate

[0241] E. coli DH10B was grown in LB with shaking at 37°C. At 415-Luc phage was diluted in LB to 4 x 10 7 PFU / 20 μL (2 x 10 9 PFU / mL). Cells were counted and diluted to 500, 50, and 5 cells / mL (0.1 mL was added to each well to obtain ~50, 5, and <1 cells as indicated in the table below). Figure 5 CFU testing was performed in parallel with the luciferase assay to determine the actual number of input cells for each assay.

[0242] For each cell dilution, 0.1 mL was added to multiple wells in a 96-well filter plate: 9 wells for 0.5 cells, 3 wells for 50 cells, 5 cells, and zero cell controls. The 96-well filter plate was spun at 1200 rpm (263 rcf) for 3 minutes. Next, 20 μL of phage dilution was added to each filter and incubated at room temperature for 10 minutes, followed by 30 minutes at 37°C. Luciferase assays were performed directly in the original filter plate using 100 μL of luciferase assay reagent (Promega, Inc.) injected using a Promega luminometer, and the plate was read immediately after injection, and again at 15 and 30 minutes thereafter. Cell counts were corrected according to the number of colonies in the parallel CFU assay. The signal-to-background ratio was obtained by dividing the signal for each well by the average of the signals from the zero cell controls.

[0243] Figure 8 Results are shown demonstrating the use of a 96-well filter plate for detection of single E. coli cells in each well (an average of 0.5 cells was tested, so that about half of the wells received a single cell), as well as 5.4 and 54 cells per well.

[0244] Figure 9 Results are shown demonstrating the very large cell detection range of the 96-well filter plate system, from an average of less than 1 cell / well (single cells) to at least 14 million cells / well.

[0245] Example 6. Use of 415-Luc phage Filter plate assay with phage and low cell concentrations

[0246] E. coli 0157:H7 cells were grown in LB at 37°C with 220 rpm shaking. At Phage was made to 10 6 PFU / 20 μL. Cells were counted and diluted to 7290, 2430, 810, 270, 90, 30, 10, and 0 cells / mL. An aliquot of 100 μL of each sample was deposited into Optiplate 96-well Greyspot luminometer 0.45 μm filter plate wells in duplicate.

[0247] As Figure 10 shown in the schematic Phage dilutions were added to each well to achieve a final concentration of 5 x 10 7 PFU / mL. Plates were incubated at room temperature for 10 minutes, 200 μL PBST was added to each well, and the plates were spun at 2400 rpm for 3 minutes to wash away excess parental phage.

[0248] Next, 50 μL LB was added to each well, and the plates were incubated in a 37°C incubator for 45 minutes without shaking. An aliquot of 10 μL Promega Renilla luciferase lysis buffer was added to the wells, the analyte was transferred to the wells, and a luciferase assay was performed with 50 μL Promega reagents injection. The samples containing cells were compared to a 0 cell control.

[0249] As seen in the schematic Figure 11 , The filter plate results show a statistically significant difference between the signal from 0 cells and 1 cell / test (by Student's t-test, p value = 0.034), demonstrating the ability to detect a single cell. More bacterial cells per assay indicated an increase in signal in a dose-dependent manner.

[0250] Example 7. Non-concentrated assay with low cell concentration

[0251] In preparing an experiment similar to the assay shown in the schematic Figure 12 Escherichia coli 0157:H7 was grown in LB at 37°C using 220 rpm shaking. JG04-OpLuc indicator phage was made at 1.2 x 10 7 PFU / 20 μL, and 20 μL aliquots were dispensed into Optiplate 96-well Greyspot luminometer plate wells. The cells were counted and diluted to 10, 3.3, 1.1, and 0 cells / mL. Aliquots of 100 μL of each sample were dispensed into wells in duplicate (12x for 0.11 and 0.33 cells / assay, and 5x for 1 cell / assay) to achieve a final phage concentration of 10 8 PFU / mL.

[0252] The plates were incubated in a 37°C incubator for 45 minutes without shaking. Finally, 10 μL Renilla luciferase lysis buffer was added to each well and 50 μL Renilla luciferase assay reagent (Glo Lumi) was injected and luciferase assay was performed. Samples were compared to a 0 cell control.

[0253] As Figure 13 As seen in the middle, the no-concentration assay results using low cell concentrations indicate a statistically significant difference between the signal from 0 cells and 1 cell per assay (p-value = 0.0024 by ANOVA test), demonstrating the ability to detect a single cell. Thus, the test is surprisingly sensitive. Samples with less than 1 cell per well show a proportional number of wells above background signal.

[0254] Example 8. No-concentration assay using a wide range of cell concentrations

[0255] In a similar experiment using higher cell concentrations, E. coli 0157:H7 cells were grown in LB at 37°C with 220 rpm shaking. JG04-OpLuc indicator phage was made at 1.2 x 108 7 PFU / 20 μL and 20 μL aliquots were dispensed into the wells of an Optiplate 96-well gray scale plat. The cells were counted and diluted to 10 PFU / mL. Aliquots of 100 μL of each sample were dispensed into the wells, in duplicate, to obtain a final phage concentration of 10 8 PFU / mL. Aliquots of 100 μL of each sample were dispensed into the wells, in duplicate, to obtain a final phage concentration of 10 7 PFU / mL. Aliquots of 100 μL of each sample were dispensed into the wells, in duplicate, to obtain a final phage concentration of 10 6 PFU / mL. Aliquots of 100 μL of each sample were dispensed into the wells, in duplicate, to obtain a final phage concentration of 10 5 PFU / mL. Aliquots of 100 μL of each sample were dispensed into the wells, in duplicate, to obtain a final phage concentration of 10 4 PFU / mL. Aliquots of 100 μL of each sample were dispensed into the wells, in duplicate, to obtain a final phage concentration of 10 3 PFU / mL. Aliquots of 100 μL of each sample were dispensed into the wells, in duplicate, to obtain a final phage concentration of 10 2 PFU / mL. Aliquots of 100 μL of each sample were dispensed into the wells, in duplicate, to obtain a final phage concentration of 10 8 PFU / mL. Aliquots of 100 μL of each sample were dispensed into the wells, in duplicate, to obtain a final phage concentration of 10

[0256] The plates were incubated in a 37°C incubator for 45 minutes without shaking. 10 μL Renilla luciferase lysis buffer was added to each well and 50 μL Renilla luciferase assay reagent (Glo Lumi) was injected and luciferase assay was performed. Samples were compared to a 0 cell control.

[0257] As Figure 14The experiments observed using samples with a very wide range of cell concentrations without concentration showed a statistically significant difference in signal between 0 and 1.1 cells / assay (by Student's t-test, p = 0.000702), demonstrating the ability to detect single cells. Each assay with more bacterial cells showed a dose-dependent increase in signal until at least 10 cells were detected. 6 The bacterial cells / mL figure surprisingly demonstrates a very wide detection range.

[0258] Example 9. Determination of vegetable washing samples without concentration

[0259] To prepare the vegetable washing solution, weigh vegetable leaves (e.g., spinach or lettuce) and add them to a clean plastic bag. Add one mL LB (+ / - 0.01-0.05% Tween 20) per gram (g) of vegetables. Manually mix the leaves and solution for a few minutes. Then extract the liquid from the plastic bag and use it as the "vegetable washing solution". Using this method, ~1 million bacteria were found on a single spinach leaf (1-2g) by CFU.

[0260] Escherichia coli O157:H7 cells were grown in LB medium at 37°C with shaking at 220 rpm. JG04-OpLuc indicator phage was prepared into 1.2 × 10⁻⁶ cells. 7 PFU / 20μL, dispense 20μL of sample into equal portions. Cells were counted and diluted in vegetable wash buffer to 120, 60, 30, and 0 cells / mL in the wells of an Optiplate 96-well gray spectrophotometer plate. 100 μL aliquots of each sample were dispensed into the wells, with two replicates to obtain 10 samples. 8 The final phage concentration in PFU / mL.

[0261] Incubate the plates at 37°C for 45 minutes without shaking. Add 10 μL of... Renilla luciferase lysis buffer was added to each well, and 50 μL of solution was used. The luciferase assay was performed by injection of the Renilla luciferase assay kit (intestinal luciferin). The samples were compared with a control of 0 cells.

[0262] like Figure 15 The experiment using vegetable wash samples without concentration, as seen in the image, showed a significant difference in signal between 0 and 3 cells / test, demonstrating the ability to detect single-digit cell counts in vegetable wash. Using more bacterial cells in each test indicates a dose-dependent increase in signal. Vegetable wash contains approximately 10... 6 Non-target bacteria / mL, corresponding to approximately 10 in this assay. 5non-target cells (including 0 cells of E. coli O157:H7 control). From 10 5 The ability to distinguish as few as 3 target cells of bacteria from 10

[0263] Example 10. Specific and quantitative capture of E. coli O157:H7 using antibodies and beads

[0264] Figure 16 Example 10. Specific and quantitative capture of E. coli O157:H7 using antibodies and beads

[0265] Example 10. Specific and quantitative capture of E. coli O157:H7 using antibodies and beads

[0266] Example 10. Specific and quantitative capture of E. coli O157:H7 using antibodies and beads 10 Example 10. Specific and quantitative capture of E. coli O157:H7 using antibodies and beads

[0267] Example 10. Specific and quantitative capture of E. coli O157:H7 using antibodies and beads 7Streptavidin-coated magnetic microparticles (Invitrogen / Life Technologies) were added to the mixture and incubated for an additional 30 minutes. The cell-antibody-bead complex was then collected using a magnetic stand, and the unbound fraction (supernatant) was removed. The beads were gently washed with phosphate buffered saline containing Tween-20 (1.1 mM KH2PO4, 5.6 mM Na2HPO4, 154 mM NaCl, pH 7.4, 0.05% Tween-20). The supernatant and captured cell-bead complex were then distributed onto LB agar plates, and the plates were incubated at 37°C overnight to determine CFU. E. coli O157:H7, but not E. coli B or Salmonella typhimurium, was specifically and quantitatively captured with the anti-O157:H7 antibody.

[0268] Example 11. Hybrid Immune Phage (HIP) Assay

[0269] As shown in the schematic Figure 17 The hybrid immune phage or "HIP" assay combines the benefits of bacterial-specific antibody capture with the benefits of modified phage. The sample is first applied to microtiter plate wells coated with bacterial-specific antibody (1702). The plate is then centrifuged to promote binding of the bacteria to the capture antibody (1704). After sufficient time to allow for complete capture of the bacteria, a solution containing Luc-phage specific for the bacteria is added to each sample (1706). Incubation with the phage results in binding and attachment of single or multiple phage to the captured bacteria (1708). Finally, the sample is incubated to promote phage replication and luciferase expression, which results in cell lysis and release of soluble luciferase (1710).

[0270] In the HIP assay experiment, white 96-well ELISA plates were coated with 300 ng of target bacteria-specific monoclonal antibody (in 100 μL PBS) for 2-3 hours at room temperature. The wells were washed with PBS (200 μL x 3 washes), blocked with 5% BSA / PBS (300 μL) for 1-1.5 hours at room temperature, and washed again with 300 μL PBS x 1. The sample (100 μL) was added to the wells.

[0271] The ELISA plates were centrifuged at 700 x g for 30 minutes, and then incubated for 1 hour at room temperature. The Phage was added to the sample (10 μL of 2-4 x 10 6 PFU) in 100 μL LB medium) and incubated for 10 minutes at room temperature. The sample was washed with PBS (200 μL x 2 washes). LB medium was added to the sample (100 μL) and incubated for 1.5 hours at 37°C.

[0272] The Substrate (50 μL) was added directly to the sample and luminescence was measured in a luminometer. As Figure 18 As seen in the middle, the HIP assay was able to use approximately 2 x 10 6 PFU Phage detected 100 and 1,000 E. coli 0157:H7 cells in LB medium. The average signal relative to the cell-free sample is shown in log levels and ranged from approximately 50-fold for the 100 cell sample to over 1,000-fold for the 1,000 cell sample.

Claims

1. A recombinant bacteriophage comprising an indicator gene inserted into a late gene region of the bacteriophage.

2. The recombinant bacteriophage of claim 1, wherein the indicator gene is adjacent to a major capsid gene.

3. The recombinant bacteriophage of claim 1, wherein the bacteriophage is derived from a T7, T4, T4-like, JG04, JG04-like bacteriophage or from another natural bacteriophage having a genome with at least 90% homology to a T7, JG04, JG04-like, T4 or other T4-like bacteriophage.

4. The bacteriophage of claim 1, wherein the indicator gene does not encode a fusion protein.

5. The bacteriophage of claim 1, wherein transcription of the indicator gene is controlled by a bacteriophage late promoter.

6. The bacteriophage of claim 1, wherein expression of the indicator gene forms a soluble indicator protein product during bacteriophage replication following infection of a host bacterium.

7. The bacteriophage of claim 2, wherein the indicator gene encodes a luciferase.

8. The bacteriophage of claim 7, wherein the luciferase is one of an Oplophorus luciferase, a Photuris luciferase, a Lucia luciferase or an engineered luciferase.

9. A method for detecting a target microorganism in a sample comprising the steps of: incubating the sample with a recombinant bacteriophage that infects the target microorganism, wherein the recombinant bacteriophage comprises an indicator gene inserted into a late gene region of the bacteriophage such that expression of the indicator gene forms a soluble indicator protein product during bacteriophage replication following infection of a host bacterium; and detecting the indicator protein product, wherein positive detection of the indicator protein product indicates the presence of the target microorganism in the sample.

10. The method of claim 9, wherein the amount of indicator moiety detected corresponds to the amount of target microorganism present in the sample.

11. The method of claim 9, wherein the indicator gene is adjacent to a major capsid gene.

12. The method of claim 9, wherein the bacteriophage is derived from a T7, T4, T4-like, JG04 bacteriophage or from another natural bacteriophage having a genome with at least 90% homology to a T7, T4 or other T4-like bacteriophage.

13. The method of claim 9, wherein the indicator gene does not encode a fusion protein.

14. The method of claim 9, wherein transcription of the indicator gene is controlled by a bacteriophage late promoter.

15. The method of claim 9, wherein the indicator gene encodes a luciferase.

16. The method of claim 15, wherein the luciferase is one of an Oplophorus luciferase, a Photuris luciferase, a Lucia luciferase or an engineered luciferase.

18. The method of claim 9, wherein the recombinant bacteriophage is purified using a cesium chloride isopycnic gradient centrifugation prior to incubation with the sample.

19. The method of claim 9, further comprising a step for capturing microorganisms from a sample on a solid support prior to incubation with the recombinant bacteriophage to infect the bacteria.

17. The method of claim 9, wherein the concentration of bacteriophage used in the incubation step to infect the bacteria is greater than 1 x 10 7 plaque forming units per milliliter volume.

20. The method of claim 19, wherein the solid support comprises a multi-well plate or a filter.

21. The method of claim 19, wherein the capturing step further comprises binding the microorganisms with a capture antibody. ​ ​ 22. The method of claim 21, wherein the capture antibody facilitates binding of the microorganism to the solid support.

23. The method of claim 19, further comprising a step for washing the captured and infected microorganism to remove excess phage and / or contaminating reporter protein, such as luciferase, after the addition of the phage but before cell lysis.

24. The method of claim 9, wherein detection of the target microorganism is accomplished in a time period that is shorter than the time period required to increase the number of microorganisms by 4-fold or 10-fold using enrichment culture.

25. The method of claim 9, wherein the method can detect < 10 microorganism cells in a sample.

26. The method of claim 9, wherein the total time required for detection is less than 2 hours.

27. A system for rapid detection of a target microorganism in a sample, comprising: a component for incubating the sample with an infectious agent specific for the target microorganism, wherein the infectious agent comprises an indicator moiety; and a component for detecting the indicator moiety.

28. The system of claim 27, further comprising a component that is the infectious agent.

29. The system of claim 28, wherein the infectious agent is a recombinant bacteriophage that infects the target microorganism, wherein the recombinant bacteriophage comprises an indicator gene inserted into a late gene region of the bacteriophage as the indicator moiety, such that expression of the indicator gene during phage replication following infection of the host bacteria forms a soluble indicator protein product.

30. The system of claim 28, further comprising a component for capturing the target microorganism on a solid support.

31. The system of claim 28, further comprising a component for washing the captured microorganism sample.

32. The system of claim 28, wherein the same component can be used for multiple steps.

33. The system of claim 28, further comprising a component for determining the amount of the target microorganism in the sample, wherein the amount of indicator moiety detected corresponds to the amount of microorganism in the sample.

34. The system of claim 28, wherein the steps are automated or controlled by a user via computer input and / or wherein a liquid handling robot performs at least one step.

35. A non-transitory computer readable medium for use with the system of claim 28.

36. A non-transitory computer readable medium for use with the method of claim 9.

37. A kit for rapid detection of a target microorganism in a sample, comprising: a component for incubating the sample with an infectious agent specific for the target microorganism, wherein the infectious agent comprises an indicator moiety; and a component for detecting the indicator moiety.

38. The kit of claim 37, wherein the infectious agent is a recombinant bacteriophage that infects the target microorganism, wherein the recombinant bacteriophage comprises an indicator gene inserted into a late gene region of the bacteriophage as the indicator moiety, such that expression of the indicator gene during phage replication following infection of the host bacteria forms a soluble indicator protein product.

39. The kit of claim 37, further comprising a component for capturing the target microorganism on a solid support.

40. The kit of claim 37, further comprising a component for washing the captured microorganism sample.

41. The kit of claim 37, wherein the same component can be used in multiple steps.

42. The kit of claim 37, further comprising a component for determining the amount of the microorganism of interest in the sample, wherein the amount of the indicator moiety detected corresponds to the amount of the microorganism in the sample.

43. A method for making a recombinant bacteriophage comprising inserting an indicator gene into a late gene region of the bacteriophage.

44. The method of claim 43, wherein the indicator gene encodes a luciferase.