Application of chicken FNDC3A gene in resisting H9N2 avian influenza virus infection
By silencing the FNDC3A gene in chickens and using siRNA interference technology to inhibit the replication of H9N2 avian influenza virus, the problems of persistent viral transmission and drug resistance in existing technologies have been solved, the disease resistance of chickens has been improved, and new targets have been provided for vaccine and drug development.
Patent Information
- Application Number
- CN202511597563.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-04
- Publication Date
- 2026-01-23
AI Technical Summary
In the current technology, H9N2 subtype avian influenza virus often causes asymptomatic infection in chickens, resulting in mild symptoms but continuous transmission. Existing vaccines have limited protective effects, and antiviral drugs are prone to inducing drug resistance. There is a lack of effective molecular targets to enhance the disease resistance of chickens.
By inhibiting the expression of the chicken FNDC3A gene and silencing the FNDC3A gene using siRNA interference or knockout technology, a cell model resistant to H9N2 avian influenza virus infection was established, enhancing the chicken's resistance to the virus.
It significantly inhibits the replication and pathogenic process of H9N2 avian influenza virus, enhances the resistance of cells to viral infection, provides new targets for anti-H9N2 avian influenza vaccines and antiviral drugs, and supports disease-resistant breeding in poultry.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of genetic engineering and biomedicine, specifically relating to the application of silent chicken FNDC3A in improving chicken resistance to H9N2 subtype avian influenza virus infection. Background Technology
[0002] The H9N2 subtype of avian influenza virus (AIV) is a low-pathogenic avian influenza virus characterized by its wide range of infection and strong transmissibility. This virus can infect various poultry species, often in a latent infection state, causing damage to the respiratory, digestive, and reproductive systems. Infected poultry typically exhibit mild respiratory distress, reduced feed intake, decreased egg production, and occasional mortality. Although the H9N2 virus has low pathogenicity, it can continuously shed the virus through infected flocks, causing viral spread and epidemics among groups. It can also cause immunosuppression, leading to secondary bacterial or viral infections, posing a serious threat to the stable production of poultry farming. The H9N2 subtype of avian influenza virus has a strong genetic mutation capacity, capable of escaping vaccine immune pressure through antigenic drift, resulting in limited protective efficacy of existing vaccines. Simultaneously, long-term use of antiviral drugs can induce drug resistance, further weakening the control effect. Therefore, exploring new molecular targets to inhibit viral infection is of great significance for improving the disease resistance of poultry. Summary of the Invention
[0003] The purpose of this invention is to provide a gene that can enhance chicken resistance to H9N2 avian influenza virus infection and its application. It can be used as a molecular marker for disease resistance and to assist in the breeding of new chicken varieties resistant to H9N2 avian influenza virus infection. It has important application value in genetically assisted disease resistance breeding.
[0004] To achieve the above objectives, the present invention adopts the following technical measures:
[0005] This invention provides an application of enhancing chicken resistance to H9N2 avian influenza virus infection by inhibiting the expression of the chicken FNDC3A gene. The FNDC3A gene includes the FNDC3A gene in the chicken genome with NCBI accession number NC_052532.1 or a homologous FNDC3A gene in chickens.
[0006] In the applications described above, preferably, the inhibition methods include, but are not limited to, the use of siRNA interference technology or knockout technology targeting the chicken FNDC3A gene.
[0007] The scope of protection of this invention also includes: a cell model for resisting H9N2 avian influenza virus infection established by using the FNDC3A gene of silent chickens.
[0008] Compared with the prior art, the present invention has the following advantages:
[0009] The applicant, using siRNA interference technology, targeted and inhibited the expression of the FNDC3A gene in the chicken embryo fibroblast cell line (DF-1). This discovery, for the first time, revealed that silencing this gene significantly inhibits the replication and pathogenic process of H9N2 avian influenza virus, thereby enhancing cellular resistance to viral infection. This gene can serve as a novel antiviral target for H9N2 avian influenza. This invention provides a new theoretical basis and target for the development of safe and effective anti-H9N2 avian influenza vaccines and antiviral drugs, and also provides a new candidate gene for poultry disease-resistant breeding, demonstrating broad application prospects. Attached Figure Description
[0010] Figure 1 FNDC3A mRNA was downregulated in DF-1 cells after H9N2 AIV infection;
[0011] Among them, RT-qPCR was used to detect the mRNA expression level of the FNDC3A gene in DF-1 cells after H9N2 AIV infection;
[0012] Figure 2 :siFNDC3A transfection inhibits the expression of FNDC3A mRNA in DF-1 cells;
[0013] RT-qPCR was used to detect the construction of the FNDC3A gene silencing model in DF-1 cells.
[0014] Figure 3 Silencing the FNDC3A gene does not affect the mRNA expression of the H9N2 AIV NP gene;
[0015] Among them, RT-qPCR was used to detect the mRNA expression of H9N2 AIV NP protein gene after silencing the FNDC3A gene;
[0016] Figure 4 Silencing the FNDC3A gene inhibits H9N2 AIV NP gene protein expression;
[0017] Among them, Western blot was used to detect the expression of H9N2 AIV NP protein after silencing the FNDC3A gene; Detailed Implementation
[0018] Example 1: Detection of FNDC3A gene expression level in DF-1 cells after H9N2 AIV infection;
[0019] 1. Culture of DF-1 cells
[0020] The specific steps are as follows:
[0021] (1) DF-1 cell thawing: Remove the frozen cells from the liquid nitrogen tank and quickly place them in a 37°C water bath to thaw. Transfer the thawed cell mixture into a 15mL centrifuge tube and add 10mL of DMEM cell culture medium. Centrifuge at 1000r / min for 5min and discard the supernatant. Add 1mL of complete cell culture medium to resuspend the cells and seed them into a T25 culture flask, then add culture medium to about 5mL. Gently shake the culture flask to spread the cells evenly on the bottom of the flask and place it in a 37°C, 5% CO2 incubator for culture.
[0022] (2) Passaging of DF-1 cells: When the cells in the culture flask reach about 90% confluence, passaging is performed. The specific cell passaging procedure is as follows: Aspirate the culture medium from the culture flask, add PBS to wash the cells, and repeat the washing twice; discard the PBS, add 1 mL of preheated 0.25% trypsin, place the culture flask in an incubator and let it stand for 1 min, then observe under a microscope. When gaps appear between the cells and the cells begin to round out, discard the trypsin, invert the culture flask in an incubator, let it stand for 1 min, and then add 3 mL of complete culture medium to stop digestion; pipette the cells in the culture flask to form a single-cell suspension and collect the cells; collect the cell suspension in a 15 mL centrifuge tube, centrifuge at 1000 r / min for 5 min, and discard the supernatant; add complete cell culture medium, pipette to resuspend the cells, transfer the cells to a new culture flask, add an appropriate amount of cell culture medium, and incubate in a 37℃, 5% CO2 incubator.
[0023] (3) Cryopreservation of DF-1 cells: When the cells in the culture flask reach about 90% confluence, collect the cells into 15mL centrifuge tubes according to the cell passage procedure, resuspend the cells in cell cryopreservation solution, and aliquot them into cell cryopreservation tubes. Place the cryopreservation tubes in a cell cryopreservation box and freeze overnight at -80℃ before transferring them to a liquid nitrogen tank.
[0024] (4) Challenge of DF-1 cells: Cells were seeded into 24-well plates and cultured overnight before challenge. The original culture medium was discarded, and the cells were washed with PBS twice. The PBS was discarded, and 500 μL of DMEM medium containing trypsin (1 μg / mL) was added. The cells were then infected with H9N2 AIV (MOI=0.01). 1.5 h after viral infection, the culture medium was discarded, and the cells were washed with PBS twice. The PBS was discarded, and 500 μL of DMEM medium containing trypsin (1 μg / mL) was added. The cells were then cultured in an incubator for 24 h. The original cell culture medium was discarded, and the cells were washed twice with PBS buffer to remove as much of the original cell culture medium as possible. The cells were collected using 500 μL of TRIzol and 80 μL of LRIPA lysis buffer, respectively, and stored at -20℃ for later use.
[0025] 3. Extraction of total RNA from cells
[0026] The specific steps are as follows:
[0027] (1) Add 100 μL of chloroform to every 500 μL of TRIzol reagent, shake vigorously to mix, and let stand for 5 min.
[0028] (2) Centrifuge the sample at 12,000 r / min for 15 minutes at 4°C. Transfer the aqueous phase containing RNA to a new tube.
[0029] (3) Add 500 μL of isopropanol, invert the centrifuge tube several times to mix thoroughly, let stand for 10 min, centrifuge at 4℃ and 12,000 r / min for 15 min, and discard the supernatant.
[0030] (4) Add 1 mL of 75% anhydrous ethanol (750 μL anhydrous ethanol + 250 μL DEPC water), gently tap the precipitate to rinse it, centrifuge at 4℃ and 12,000 r / min for 8 min, and discard the supernatant.
[0031] (5) Based on the amount of precipitate, add an appropriate amount of DEPC water to dissolve the RNA precipitate. After gently mixing and dissolving, use NanoDrop-2000 to determine the total RNA concentration and purity.
[0032] 4. Detect the expression level of FNDC3A in DF-1 cells infected with H9N2 AIV.
[0033] (1) Synthesis of the first strand of cDNA
[0034] According to the Vazyme reverse transcription kit instructions, the specific procedures are as follows:
[0035] Genomic DNA removal reaction
[0036]
[0037] Mix well. The PCR reaction procedure is as follows: PCR reaction conditions: 42 ℃, 2 min.
[0038] Reverse transcription
[0039]
[0040] PCR reaction conditions: 50℃, 15 min; 85℃, 5 s. A portion of the obtained cDNA sample was diluted 5-fold and aliquoted, then stored at -20℃ for later use.
[0041] The gene sequence of FNDC3A was obtained from NCBI, and primers were designed using Primer 5.0 software. The primer sequences are as follows: FNDC3A-F: CCGATACACAGGTCTCCAGC; FNDC3A-R: ACACTTGGTCGCTCTGTGAC
[0042] The reaction system for detecting the relative expression level of FNDC3A in cells infected with H9N2 AIV by RT-qPCR is as follows:
[0043]
[0044] After mixing and centrifuging, the mixture was transferred to the qPCR instrument. The qPCR reaction program was as follows: 95℃: 30 s; (95℃: 15 s; 60℃: 30 s) × 40
[0045] Example 2: Construction of the FNDC3A gene silencing model
[0046] The specific operational steps are as follows: DF-1 cells in logarithmic growth phase were prepared into a cell suspension and seeded in 24-well plates. Experimental groups [si-NC (H9N2)], [si-FNDC3A (H9N2)], and a negative control group [Mock] were set up, with 3 biological replicates for each group. The transfection procedure is as follows:
[0047] (1) Take 2 μL of si-FNDC3A and si-NC respectively and mix them into jetPRIME® buffer. Mix well and then detach.
[0048] (2) Take 1.5 μL of jetPRIME® reagent and mix it into the mixture in (1). Mix well and then incubate briefly.
[0049] (3) Incubate at room temperature for 10-15 min to form a complex.
[0050] (4) Take 50 μL of the mixture into the prepared cells, gently shake the cell culture plate to mix it evenly, and replace the complete culture medium 4-6 h after transfection.
[0051] (5) Incubate at 37℃ and 5% CO2 for 30 h, and then conduct subsequent experiments.
[0052] The reaction system for RT-qPCR to detect whether the FNDC3A silencing model was successfully constructed is as follows:
[0053]
[0054] After mixing and centrifuging, the mixture was transferred to the qPCR instrument. The qPCR reaction program was as follows: 95℃: 30 s; (95℃: 15 s; 60℃: 30 s) × 40
[0055] The siNC and siFNDC3A sequences are as follows:
[0056]
[0057] Example 3: Silencing the FNDC3A gene to inhibit H9N2 AIV replication
[0058] 1. The construction of cell resuscitation, culture, and silencing models was carried out according to Examples 1 and 2.
[0059] 2. The method for extracting RNA from cells is the same as step 3 in Example 1.
[0060] 3. RT-qPCR was used to detect the expression of H9N2 AIV NP gene mRNA in DF-1 cells after FNDC3A silencing. The primers used were as follows: qt-H9N2-NP-FATGGAAACTGGTGGGGAACG, qt-H9N2-NP-RGCCTTCGTAGTCGCTGAGTT. The reaction system and procedure were the same as in Example 2.
[0061] 4. Western blot analysis of H9N2 NP protein expression in DF-1 cells after FNDC3A silencing.
[0062] (1) Electrophoresis: Prepare a 12.5% separating gel, install the electrophoresis apparatus, add electrophoresis buffer, load the sample, connect the power supply, and adjust the voltage to 80 V; when the bromophenol blue reaches the junction of the stacking gel and the separating gel, adjust the voltage to 120 V; when the bromophenol blue has completely run out of the bottom of the separating gel, turn off the power, remove the gel, and perform a Western blot experiment.
[0063] (2) Transfer: After SDS-PAGE electrophoresis, take the gel after SDS-PAGE electrophoresis, without staining, and directly transfer the charged proteins onto a PVDF membrane using the Bio-RAD Mini Trans-Blot Electrophoretic Cell transfer device. The specific operation is as follows: Wear gloves, cut two 8-layer filter papers and one 0.45 μm PVDF membrane. The PVDF membrane should be slightly larger than the gel. Add a small amount of transfer buffer to a tray and soak the filter paper and sponge in it. After soaking the PVDF membrane in methanol for 2 min, transfer it to the transfer buffer as well. Lay the sponge and filter paper on the glass plate in sequence, gently place the electrophoretically extracted gel on the filter paper, use a glass rod to spread the gel evenly, remove air bubbles, attach the PVDF membrane, remove air bubbles again with a glass rod, and then lay the filter paper and sponge on top. Transfer the whole thing to the transfer clamp and place it in the electrotransfer device (the black negative electrode side corresponds to the gel, and the red positive electrode side corresponds to the PVDF membrane). Transfer the membrane at a constant voltage of 200 mA for 120 min, during which ice packs are placed around the electroporation device or the device is placed in an ice box filled with ice.
[0064] (3) Blocking: Prepare the blocking solution by adding 1 g of skim milk powder or BSA (the amount needed for one membrane) to 20 mL of 1×TBST, mixing thoroughly and pouring into a food storage container. Use tweezers to pick up the membrane and lay it flat in the blocking solution with the protein side down, and block overnight at 4°C.
[0065] (4) Primary and secondary antibody incubation: After blocking, wash the membrane with TBST for 5 min, then incubate with H9N2 NP protein rabbit polyclonal antibody at room temperature for 2 h or at 4℃ overnight. After incubation, wash the membrane 3 times with 1×TBST for 10 min each time, add secondary antibody solution, and incubate on a shaker at room temperature for 2 h.
[0066] (5) ECL chemiluminescence detection and imaging analysis: Add 10 mL of 1×TBST to the food storage container and wash 3 times, 5 min each time. Take out the PVDF membrane with the protein side facing up, mix equal volumes of chemiluminescent substrate A and B and cover the PVDF membrane for light-proof color development, and acquire images using a chemiluminescence imaging system.
[0067] In the data above, the two groups were compared using a two-tailed t-test in Microsoft Excel 2016. The experimental statistics are expressed as mean ± standard deviation (Mean ± SD). *p < 0.05 indicates a significant difference, and **p < 0.01 indicates an extremely significant difference.
[0068] SEQ ID NO. 1
[0069]
Claims
1. The FNDC3A gene is the chicken FNDC3A gene, and its nucleotide sequence is shown in SEQ ID NO.
1.
2. The use of the chicken FNDC3A gene inhibitor, characterized in that, Used to prepare drugs for the prevention or treatment of H9N2 AIV infection.
3. The use according to claim 2, characterized in that, The chicken FNDC3A gene inhibitors include siRNAs that interfere with FNDC3A protein expression via RNAi, or nucleic acid molecules or their expression vectors that target and knock out the chicken FNDC3A gene through gene editing.
4. The use according to claim 2, characterized in that, The sense strand of the siRNA is: GCAUUUGUGUGAUCGACUATT, and the antisense strand is: UAGUCGAUCACACAAAUGCTT.
5. A medicament for preparing a drug to prevent or treat H9N2 AIV infection, characterized in that, This includes nucleic acid molecules that target and knock down / knock out the chicken FNDC3A gene to interfere with FNDC3A protein expression.
6. Genetically engineered cells resistant to H9N2 AIV infection, characterized in that, The cells in question are DF-1 cells with FNDC3A gene knockdown.
7. The application of the DF-1 cell line in screening drugs against H9N2 AIV infection, characterized in that, A test group and a control group were set up. The test group had the test compound added to DF-1 cells, while the control group had DF-1 cells without the test compound added. The expression levels of the FNDC3A gene in the test group and the control group were compared to screen for test compounds that significantly reduced the expression level of the FNDC3A gene.
8. Application of the DF-1 cell line, characterized in that, A cell model used for H9N2 AIV infection research.