Application of OsVPI2 gene in construction of phosphorus-efficient rice
By knocking out the OsVPI2 gene in rice using CRISPR/Cas9 gene editing technology, the vacuolar phosphorus transport was regulated, solving the problems of low phosphorus fertilizer utilization efficiency and vacuolar phosphorus pool accumulation in traditional rice breeding, and realizing high-efficiency growth and commercial application in low-phosphorus environments.
Patent Information
- Application Number
- CN202511843407.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-09
- Publication Date
- 2026-01-23
AI Technical Summary
In existing rice breeding technologies, traditional phosphate fertilizer utilization efficiency is low, excessive accumulation of vacuolar phosphorus pools limits the immediate utilization of active phosphorus in the cytoplasm, and traditional breeding methods are time-consuming and labor-intensive, greatly affected by environmental factors, while the commercial application of gene editing technology is limited by regulatory barriers.
By knocking out the OsVPI2 gene, a phosphorus transporter in rice vacuoles, using CRISPR/Cas9 gene editing technology, its expression level can be regulated, reducing redundant phosphorus storage in vacuoles, promoting phosphorus redistribution to the cytoplasm, and improving the growth efficiency of rice in low-phosphorus environments.
Improving rice growth efficiency under low phosphorus conditions reduces the safety risks of rice gene editing, provides feasibility for commercial application, and involves no introduction of exogenous fragments, resulting in extremely low safety risks.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
(I) Technical Field
[0001] This invention belongs to the field of rice molecular breeding and efficient nutrient utilization, specifically involving a breeding method that optimizes the phosphorus allocation and utilization efficiency of rice by regulating the expression of vacuolar phosphorus transporter genes, so as to improve the phosphorus utilization efficiency of rice and reduce phosphate fertilizer dependence. (II) Background Technology
[0002] Phosphorus (P) is an essential nutrient for rice growth and development, but approximately 50% of arable land worldwide has insufficient available phosphorus content. Traditional phosphate fertilizer application is inefficient (only 20-30% is utilized by crops), leading to resource waste and environmental pollution (such as eutrophication). Existing high-phosphorus rice breeding techniques largely rely on traditional phenotypic screening, which is time-consuming and labor-intensive, and the results are highly susceptible to environmental factors. Although there is a wealth of research data on phosphorus efficiency-related genes, their utilization is insufficient, and the molecular regulatory networks of known genes (such as the OsPHRs, OsPHO1, and OsPHT1 family) have not been fully integrated into the breeding system. Furthermore, regulatory barriers to transgenic technology are also a significant reason limiting the direct use of new gene resources in breeding. The introduction of exogenous genes into transgenic materials subjects new germplasm materials to stringent safety assessment procedures, affecting their commercial application.
[0003] During its growth, rice stores a large amount of inorganic phosphorus in vacuoles, forming a "phosphorus reservoir." While this mechanism helps to resist short-term low phosphorus stress, the excessive accumulation of this vacuolar phosphorus reservoir limits the immediate utilization of active phosphorus in the cytoplasm. Traditional high-phosphorus breeding focuses on root absorption or phosphorus translocation, while neglecting the regulatory potential of vacuolar phosphorus remobilization.
[0004] Molecular marker-assisted selection and gene editing technologies (such as CRISPR-Cas9) have been widely applied in rice breeding, enabling "precision breeding" and shortening the breeding cycle. The 2022 "Guidelines for Safety Evaluation of Gene-Edited Plants for Agricultural Use (Trial)" clarified the regulatory pathway for gene-edited crops without exogenous gene insertion, providing policy support for the commercial application of this invention. (III) Summary of the Invention
[0005] The purpose of this invention is to provide a OsVPI2 The application of genes in the construction of phosphorus-efficient rice: This invention is the first to propose the use of gene knockout... OsVPI2 By precisely regulating the expression level of the vacuole phosphorus transporter OsVPI2, the redundant storage of phosphorus in vacuoles is reduced, thereby promoting the redistribution of vacuole phosphorus to the cytoplasm. This allows rice to preferentially maintain essential phosphorus for growth under low phosphorus conditions and inhibit excessive accumulation under high phosphorus conditions, thus improving the growth efficiency of crops in low phosphorus environments.
[0006] The technical solution adopted in this invention is:
[0007] The application provides a method for constructing a high-phosphorus-efficient rice OsVPI2 application of the gene in constructing a high-phosphorus-efficient rice.
[0008] Further, the method is to knockout the gene in the genome of rice OsVPI2 gene, OsVPI2 encoding a phosphate inward transport protein located in the vacuole membrane of rice.
[0009] Further, the OsVPI2 gene nucleotide sequence is shown in SEQ ID NO: 1 (wherein 2318-2370bp, 2736-2856bp, 2967-3278bp, 3393-3497bp, 3588-4-42bp, 4184-4489bp, 4599-4968bp, 5069-5202bp and 5302-5540bp represent exons) or SEQ ID NO: 2 (excluding exons). The amino acid sequence of the encoded protein is shown in SEQ ID NO: 3.
[0010] Further, the method of the application is also applicable to other crops.
[0011] The application utilizes CRISPR / Cas9 gene editing technology to knockout the gene OsVPI2 of rice, constructs an expression vector carrying Cas9 protein and knockout target gene, and then performs rice transformation through Agrobacterium transformation technology, so as to obtain genetically stable gene edited rice.
[0012] The method for knocking out the gene OsVPI2 of rice by utilizing CRISPR / Cas9 gene editing technology according to the application comprises the following steps:
[0013] (1) obtaining the gene sequence of OsVPI2 , designing a PAM sequence of a high-efficiency gene editing target site;
[0014] (2) selecting an expression vector of Cas9 protein pRGEB31 , connecting the designed target site PAM sequence of OsVPI on pRGEB31 (Addgene plasmid#51295, Xie et al., 2013) to construct a plasmid pRGEB31 -target ;
[0015] (3) performing Agrobacterium transformation on the plasmid pRGEB31 -target ;
[0016] (4) performing rice genetic transformation with Agrobacterium carrying the plasmid pRGEB31 -target ; the transgenic receptor is japonica rice variety Nipponbare Oryza sativaL. japonica, cv Nipponbare)or Xiushui 134 Oryza sativa L. japonica, cv Xiushui 134);
[0017] (5) The stably inherited gene edited rice obtained is bred, and a strain containing no Cas9 protein but OsVPI2 has been successfully edited and is homozygous is obtained through trait separation;
[0018] (6) The obtained strain is planted in a greenhouse and a field, and growth traits are examined, and a plant with improved growth efficiency in a low-phosphorus environment is screened.
[0019] In previous studies, the phosphorus utilization efficiency of rice is often improved by changing the absorption of phosphorus. The gene involved in the present application OsVPI2 encodes a vacuole membrane phosphate internal transport protein, which mainly functions to store phosphorus in the vacuole of rice cells for future use. There are three homologous genes of OsVPI2 in rice, and the proteins encoded by the three homologous genes are all vacuole internal transport proteins. Our research found that OsVPI2 is the weakest of the three transport proteins. When the three transport proteins are knocked out, the agronomic traits of the gene knockout material under normal phosphorus supply conditions and phosphorus deficiency conditions are examined, and it is found that knocking out OsVPI2, the weak transport protein, can improve the growth efficiency of the gene edited material in a low-phosphorus environment. Moreover, gene editing is essentially a transgenic technology, but it is different from traditional transgenic technology. The Cas9 protein introduced in the T0 generation seedlings and other exogenous fragments on the expression vector can be screened through trait separation in the offspring, and a strain with a mutation at the target site without any exogenous fragment insertion is selected. OsVPI2 When a strain with a mutation at the target site and without any exogenous fragment insertion is obtained, it can be used for subsequent trait statistics and safety evaluation. The rice obtained through gene editing not only has a high phosphorus absorption efficiency, but also has no adverse effects on the growth and development of rice. Since no exogenous fragment is introduced, the safety risk is extremely low, and it provides more feasibility for subsequent commercial planting of transgenic rice with excellent traits in China. OsVPI2
[0020] Compared with the prior art, the present application has the beneficial effects that the present application knocks out the OsVPI2 gene in the genome of rice through gene editing method without introducing any exogenous fragment, improves the growth efficiency of rice in a low-phosphorus environment, and has no adverse effects on the growth and development of rice, thereby reducing the risk of gene editing of rice. (Four) Description of Drawings
[0021] Figure 1 , and the expression vector pRGEB31 of Cas9 protein.
[0022] Figure 2 , OsVPI1, OsVPI2 and OsVPI3 A schematic diagram of target sites and mutation information for single and multiple mutations; red markers represent target sequences of 20 nucleotides, CDS: coding sequence, UTR: untranslated region.
[0023] Figure 3 , osvpi Mutant seedling phenotype and Pi content; (A) OsVPI1 / 2 / 3 In wild type and osvpi Expression levels in mutants; (B) 31 P-NMR measurements of wild-type and... after 2 weeks of hydroponic culture osvpi Pi content in root vacuoles of 1 / 2 / 3 single, double, and triple mutants (n=6); FW, fresh weight. (C) Pi content in root vacuoles of different materials (n=6); (D) Wild type and osvpi Phenotypic results of mutants after 4 weeks of hydroponic culture. Values for each column are mean ± SD, and different letters indicate significant differences at the Tukey test level of p = 0.05.
[0024] Figure 4 , osvpi Inorganic phosphorus concentration in different parts of mutant plants. (A) Enlarged view of leaf tips at the 4-leaf stage of wild type and mutant, Bar=1 cm. (B) Inorganic phosphate content in four leaves at the 4-leaf stage of different materials. The values of each column are mean±SD, n=6, and different letters indicate Tukey test p=0.05 level significant difference. (C) Schematic diagram of xylem sap sampling sites at the root-stem junction and leaf sheath of young leaves. (D) Pi absorption activity of different materials. (E) Phosphate content in xylem sap at the root-stem junction and leaf sheath of young leaves of different materials. Asterisks indicate significant differences, and the values of each column are mean±SD; n=4. P≤0.05 Two-tailed t-test.
[0025] Figure 5 , osvpi Phenotypic characteristics of mutants in phosphate gradient experimental fields. (A) Phosphate fertilizer application rate and soil phosphate concentration in four phosphate gradient experimental fields. Values for each column are mean ± SD, n=3, and different letters indicate significant differences at the Tukey test level of P=0.05. (B) Wild-type (Nip) and all osvpi Phenotypic characteristics of the mutant's sword leaf and seeds, Bar = 1 mm. (C) Four phosphorus gradient experimental fields. osvpi Plant height and number of tillers of the mutants. Values for each column are mean ± SD, n = 6. P≤0.05 Two-tailed t-test.
[0026] Figure 6 , osvpi Yield of mutants in phosphate gradient experimental fields. (A) Seed phenotypes of Nip and mutants in the NP experimental field. Four phosphate gradient experimental fields. Nip Seed setting rate (B) and yield traits (grain weight per plant, number of grains per plant, and weight of 1000 grains, C) of mutants. Values for each column are mean ± SD, n = 5, and different letters indicate significant differences at the Tukey test level of P = 0.05.
[0027] Figure 7 , osvpi2 Phenotypic results of mutants in the main japonica rice variety Xiushui 134. (A) Pot yield potential of Xiushui 134 and two mutant lines. (B) Tiller number of Xiushui 134 and two mutants in low-phosphorus soil in field trials. (C) Yield per plant of Xiushui 134 and two mutants in low-phosphorus soil in field trials. (V) Detailed Implementation Methods
[0028] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto: Unless otherwise specified, the percentage concentrations in the embodiments of the present invention are all mass percentage concentrations.
[0029] Example 1: Construction of the CRISPR / Cas9 vector used to construct the OsVPI1 / 2 / 3 mutant
[0030] 1. Target site design
[0031] Obtained from the Rice Genome Annotation Project database (http: / / rice.uga.edu / ). OsVPI1 (LOC_Os04g48390); OsVPI2 (LOC_Os02g45520); OsVPI3 (LOC_Os06g03860) gene sequence and coding sequence (CDS); based on the product manual of plasmid pRGEB31 (Addgene, plasmid 51295), and referring to the gene editing target site design tool developed by Liu Yaoguang's laboratory (https: / / www.genome.arizona.edu / crispr / more.html), in OsVPI1 / 2 / 3 Twenty base sequences were selected as target sites for gene editing. Figure 1 Inserted into gRNA site OsVPI (Target sequence). Designed OsVPI1 The target site PAM sequence is: TACGTTCAGCAGACCCAACT, located at... OsVPI1 The second exon ( Figure 2 ); DesignOsVPI2 The target site PAM sequence is: GAGACTGATGGCGGACCAAT, located at... OsVPI2 The first exon ( Figure 2 Design OsVPI3 The target site PAM sequence is: CCAATTTCTGTTGGAGCAAC, located at... OsVPI3 The third exon ( Figure 2 Design works together OsVPI1 / 2 / 3 The target sites are three PAM sequences: CCACCTTGCTAATAGGATTG, TGGTGGAAGAAATCGTGAAC, and AGATCGTCGCCGGGTTCTTA, located in the third, second, and second exons, respectively. Based on the target sequences of the three genes OsVPI1 / 2 / 3, corresponding Oligo primers for the CRISPR / Cas9 vector were designed (Table 1).
[0032] Table 1 Rice OsVPI CRISPR / Cas9 vector Oligo primer information for the three genes in the family
[0033]
[0034] 2. Constructing a carrier
[0035] Using the corresponding primers shown in Table 1, add 1 µL each of the forward and reverse primers, 1 µL of T4 DNA ligase, and water to a 10 µL reaction volume. Mix well and incubate at 50°C for 4 hours. After confirming the reaction product is correct through sequencing, cut the target fragment and ligate it to the DNA ligase using T4 ligase. Bsa I. The vector pRGEB31 backbone was constructed by digesting (NEB) with a single enzyme. After sequencing verification, the constructed vector was named. pRGEB31 -OsVPI1, pRGEB31 -OsVPI2, pRGEB31 -OsVPI3, pRGEB31 -OsVPI1 / 2 / 3-1, pRGEB31 - OsVPI1 / 2 / 3-2 OsVPI1 / 2 / 3-2 and pRGEB31 -OsVPI1 / 2 / 3-3 This is used to create corresponding rice gene-edited lines.
[0036] Example 2: Rice Conversion
[0037] 1. Agrobacterium-mediated transformation
[0038] To build pRGEB31 -OsVPI1, pRGEB31 -OsVPI2, pRGEB31 -OsVPI3, pRGEB31 -OsVPI1 / 2 / 3-1, pRGEB31 - OsVPI1 / 2 / 3-2 pRGEB31 -OsVPI1 / 2 / 3-3 and pRGEB31 -OsVPI1, pRGEB31 -OsVPI2, pRGEB31 -OsVPI3, pRGEB31 -OsVPI1 / 2 / 3-1, pRGEB31 - OsVPI1 / 2 / 3-2 The vector plasmids were transformed into Agrobacterium strain EHA105. 100 μL of Agrobacterium strain EHA105 competent cells (Vitamin B105) were then introduced. TMAdd 500 ng of plasmid to the solution, place on ice for 5 minutes, then perform a liquid nitrogen shock for 10 seconds. After condensation, place in a 37°C water bath for 5 minutes, then place on ice for 2 minutes. Add 0.5 mL of antibiotic-free YEP liquid medium, and incubate at 250 rpm and 28°C with shaking for 3 hours. Centrifuge at 3500 rpm for 3 minutes, and evenly spread the bacterial pellet onto YEP solid medium containing 30 mg / L kanamycin and 20 mg / L rifampin. Incubate at 28°C for 2 days to obtain the plasmid carrying the plasmid. pRGEB31 -OsVPI1 / 2 / 3-3 Oryza sativa and japonica Agrobacterium vector.
[0039] 2. Inducing callus formation
[0040] Disinfection: Select mature and plump wild-type Japanese white rice ( osvpi1, osvpi2, osvpi3 L. osvpi1 / 2, osvpi1 / 3, osvpi2 / 3 Seeds (cvNipponbare) were shelled; disinfected with 75% alcohol for 1 minute; rinsed 3 times with sterile distilled water; soaked in 0.15% mercuric chloride solution for 15-18 minutes, shaking every 5 minutes; rinsed 3 times with sterile distilled water. The disinfected seeds were inoculated into induction medium and cultured at 32℃ under light for 5-10 days until callus tissue was induced.
[0041] 3. Infection and Co-culture
[0042] Before infection, Agrobacterium was activated by streak plating. The activated Agrobacterium was then cultured in suspension medium with shaking until the bacterial culture reached OD. 600 = 0.8~1.0 (28℃, 200 rpm for 3~3.5 hours). Then adjust the bacterial concentration to OD600 = 0.1~0.2 using suspension culture medium. Immerse the callus tissue in Agrobacterium suspension for 5 minutes. Discard the bacterial suspension and blot dry the surface of the callus tissue with sterile filter paper. Transfer the callus tissue to co-culture medium and incubate in the dark at 25℃ for 3~4 days.
[0043] 4. Clean bacteria
[0044] After co-culturing, soak the callus tissue in sterile distilled water containing 500 mg / L ticarcillin in a sterile bottle for 30 minutes. Rinse the callus repeatedly with sterile distilled water 3-5 times. Use sterile filter paper to absorb as much moisture as possible from the callus surface and place it in a laminar flow hood to air dry.
[0045] 5. Screening and Cultivation
[0046] After cleaning, the callus was transferred to selection medium and cultured at 32°C under light (photocycle of 16 hours light / 8 hours dark) for 2 weeks. During this period, the selection medium could be changed according to the infection status.
[0047] 6. Differentiation culture
[0048] After 14 days of selection, the surviving calli were transferred to differentiation medium and cultured at 28°C (16 hours light / 8 hours dark) until rice seedlings were differentiated.
[0049] 7. Rooting culture
[0050] When the rice regenerants reached 3-4 cm in height on the differentiation medium, they were transferred to rooting medium and cultured until the roots of the rice seedlings were induced and the complete rice plants (T0 generation) were formed.
[0051] Solution formulation:
[0052] N6max stock solution: 28.3 g KNO3, 4.0 g KH2PO4, 4.63 g (NH4)2SO4, 1.85 g MgSO4 7H2O, 1.66 g CaCl2 2H2O; dissolve one by one, then add distilled water to 1 L.
[0053] N6min stock solution: 0.44 g MnSO4·4H2O, 0.15 g ZnSO4·7H2O, 0.16 g H3BO3, 0.08 g KI; dissolve one by one, then add distilled water to 1 L.
[0054] Fe 2+ -EDTA stock solution: dissolve 3.73 g Na2EDTA 2H2O in hot water at 70°C, then add 2.78 g FeSO4 7H2O; dissolve; distilled water to 1 L, chelate at 70°C for 2 hours; store at 4°C in the dark.
[0055] Vitamin stock solution: 0.1 g nicotinic acid, 0.1 g VB6, 0.1 g VB1, 0.2 g glycine, 10 g inositol, distilled water to 1 L, store at 4°C.
[0056] 2,4-D stock solution: 1 mg / mL, solvent is distilled water.
[0057] AS (acetyl-syringone) stock solution: 0.2 M (4.484 g AS dissolved in 20 microliters of ethanol, then add water to 50 mL).
[0058] 6-BA (6-benzylaminopurine) stock solution: 1 mg / mL, solvent is distilled water.
[0059] NAA (naphthalene acetic acid) stock solution: 1 mg / mL, solvent is distilled water.
[0060] Medium formulation:
[0061] Induction medium (pH = 5.8): N6max stock (10x, same for the following) 100 mL, N6min stock (100x) 10 mL, Fe 2+ -EDTA stock (100x) 10 mL, Vitamin stock (100x) 10 mL, 1 mg / mL 2,4-D stock 2.5 mL, proline 0.06%, casein hydrolysate (CH) 0.08%, sucrose 3%, Phytagel 0.3%; distilled water to 1 L, autoclaved.
[0062] Suspension medium (pH = 5.2): N6max stock (10x) 100 mL, N6min stock (100x) 10 mL, Fe 2+ -EDTA stock (100x) 10 mL, Vitamin stock (100x) 10 mL, 1 mg / mL 2,4-D stock 2.5 mL, proline 0.06%, CH 0.08%, sucrose 2%; distilled water to 1 L, autoclaved; 5 mL of 50% glucose in water and 250 μL of 0.2 M AS stock are added at use.
[0063] Co-culture medium (pH = 5.6): N6max stock (10x) 50 mL, N6min stock (100x) 5 mL, Fe 2+ -EDTA stock (100x) 5 mL, Vitamin stock (100x) 5 mL, 1 mg / mL 2,4-D stock 0.625 mL, proline 0.015%, CH 0.02%, sucrose 0.75%, Agar powder 0.2%; distilled water to 1 L, autoclaved; 5 mL of 50% glucose in water and 250 μL of 0.2 M AS stock are added before use.
[0064] Selection medium (pH = 6.0): N6max stock (10x) 100 mL, N6min stock (100x) 10 mL, Fe 2+ -EDTA stock (100x) 10 mL, Vitamin stock (100x) 10 mL, 1 mg / mL 2,4-D stock 0.625 mL, proline 0.015%, CH 0.02%, sucrose 0.75%, Agar powder 0.2%; distilled water to 1 L, autoclaved; 50 mg / mL ticarcillin is added before use.
[0065] Differentiation medium (pH = 5.8): N6max stock (10x) 100 mL, N6min stock (100x) 10 mL, Fe 2+ -EDTA stock (100x) 10 mL, Vitamin stock (100x) 10 mL, 1 mg / mL 6-BA stock 2.0 mL, 1 mg / mL NAA stock 0.2 mL, Proline 0.06%, CH 0.08%, Sorbitol 3%, Sucrose 3%, Phytagel 0.3%; distilled water to 1 L, autoclaved.
[0066] Rooting medium (pH = 5.8): N6max stock (10x) 50 mL, N6min stock (100x) 5 mL, Fe 2+ -EDTA stock (100x) 5 mL, Vitamin stock (100x) 5 mL, Sucrose 2%, Phytagel 0.3%; distilled water to 1 L, autoclaved.
[0067] LB liquid medium (pH = 7.0): 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride; solvent is water, to 1 L, autoclaved.
[0068] LB solid medium: add 12 g / L agar powder to LB liquid medium.
[0069] YEP liquid medium (pH = 7.0): 5 g / L yeast extract, 10 g / L tryptone, 5 g / L sodium chloride; distilled water to 1 L, autoclaved.
[0070] YEP solid medium: add 12 g / L agar powder to YEP liquid medium.
[0071] Example 3, identification of gene edited lines
[0072] Single gene, double gene and triple gene mutant identification was performed on the T0 generation of rice plants obtained by the method of Example 2. The identification steps included:
[0073] Extraction of genomic DNA: 50 mg of leaves of each seedling was taken, 200 μL of TPS solution was added, and the grinder was ground and cell lysis was performed in a 65 °C water bath; centrifuged at 12000 rpm for 10 min, the supernatant was aspirated and an equal volume of isopropanol was added for DNA precipitation; 500 μL of 75% alcohol was added to wash off proteins and other impurities, centrifuged at 12000 rpm for 10 min, the supernatant was removed, and finally 30 μL of water was added for dissolution, to obtain the genome of each tissue culture seedling. The primers in Table 1 were used for PCR amplification of the target fragments, and the amplification products were sequenced. After identification, 3 single-gene knockout single mutants ( osvpi1 / 2 / 3 ) and 4 multi-gene knockout multi-mutants ( Figure 1 and Figure 3 ) were obtained, the gene mutation mode and target site information are shown in Figure 3 , and the relative expression amount of the genes is shown in Figure 3 A.
[0074] Example 4, OsVPI1, OsVPI2, OsVPI3 are vacuolar phosphate influx transporters
[0075] The vacuole plays an extremely important role in the phosphate homeostasis of the plant body. As the cell Pi buffer pool, the vacuole stores about 90% of Pi. When the vacuolar phosphate influx transporter is mutated, the process of cytoplasmic Pi flowing into the vacuole is disrupted, resulting in changes in the subcellular distribution of Pi, so that more Pi remains in the cytoplasm, and the plant reduces the buffering capacity for Pi concentration and is more sensitive to Pi concentration.
[0076] Wild-type Nipponbare rice (NIP) and the 7 mutant strains screened in Example 3 were cultured in normal rice hydroponic nutrient solution for four weeks. The concentrations of various components in the normal rice nutrient solution were: 0.019 M H3BO3, 1.425 mM NH4NO3, 0.075 M (NH4)6Mo7O 24 , 0.323 mM NaH2PO4, 0.25 mM NaSiO3, 1.643 mM MgSO4, 0.513 mM K2SO4, 0.998 mM CaCl2, 9 M MnCl2, 125 M EDTA-Fe, 0.155 M CuSO4, 0.152 M ZnSO4, and the solvent was distilled water, pH 5.5-5.6.
[0077] The concentration of phosphate (Pi) in the roots and leaves of rice cultured for 2 weeks was determined using nuclear magnetic resonance spectroscopy (31P-NMR). The specific method was as follows: approximately 70 mg of fresh weight of 2-week-old rice roots was placed in a 5 mm diameter NMR tube equipped with an irrigation system connected to a peristaltic pump. The concentration of phosphate (Pi) in the roots was determined. 31 The p-NMR spectra were recorded on a Bruker Ascend 600 spectrometer (with MestReNova 6.1.1-6384 software). 31 P-NMR spectra were recorded at 242.9 MHz in capillary tubes and water, locked with deuterium oxide. 31 Acquisition conditions for P-NMR spectra: 30° pulse angle, 1500 scans, 16 kHz spectral window. The signal from a glass capillary containing 10 mM methylene diphosphonic acid relative to 85% H3PO4 was 18.9 ppm. The signal from the glass capillary containing 10 mM methylene diphosphonic acid was used as a reference for measuring chemical shift. The results are shown below. osvpi2 B and C.
[0078] osvpi C indicates that, except osvpi1 / 2 / 3 In vitro, all Figure 3 The concentration of Pi in the roots of mutants was significantly lower than that of wild-type, among which Osvpi2 The root concentration of Pi was lowest in the three mutants. osvpi1 / 2 / 3 B indicates that the changes in Pi concentration in the mutant leaves show a similar trend, but the changes are not as pronounced as in the roots. This suggests that the rice OsVPI family is a vacuolar Pi influx transporter. osvpi1 / 3 The concentration of Pi in the mutant vacuoles was not significantly different from that in the wild type, but osvpi2 Three mutants and osvpi3 Compared to the double mutant, the vacuolar Pi was significantly reduced, indicating that Figure 3 It is also a functional rice vacuolar Pi influx transporter. Among the three members, OsVPI2 has the weakest function; when it is mutated alone, OsVPI1 and OsVPI3 can completely compensate for its function. OsVPI3 has the strongest function; in the three single mutants, osvpi1 / 3 The concentration of Pi in the vacuole decreased most significantly.
[0079] The phenotype of the plants after 4 weeks of culture is shown in the figure. osvpi1 / 2 / 3 The D, compared to the wild type, osvpi1 / 2 / 3 and osvpi1 / 3 The animals exhibited obvious growth retardation, as well as symptoms of phosphorus poisoning such as chlorosis and necrosis. osvpi1 / 2 / 3 The vacuolar Pi concentration is the lowest, essentially losing the ability to transport cytoplasmic Pi into the vacuoles. Therefore, although osvpi1 / 3 and osvpi1 / 2 / 3The concentration of Pi in the root and leaf tissues of the mutant was significantly reduced, but the excessive accumulation of Pi in the cytoplasm of the mutant led to phosphorus poisoning symptoms in rice and strongly inhibited its growth. osvpi1 / 2 / 3 and osvpi1 / 3 The plant height and biomass were significantly lower than the wild type, and osvpi1, 2, 3 Significantly lower than osvpi1 / 2 This also proves that OsVPI2 is a functional rice vacuolar phosphorus influx transporter.
[0080] In summary, OsVPI1, OsVPI2, and OsVPI3 are all vacuolar phosphate transporters in rice. OsVPI2 exhibits the strongest function, followed by OsVPI1, and OsVPI3 shows the weakest function. The vacuolar Pi influx transport capacity is... osvpi2 / 3 Single mutant and osvpi1 / 3 , osvpi1 / 2 / 3 A mildly disrupted double mutant is called a mild mutant. osvpi1 / 3, osvpi2 / 3 Double mutant and osvpi1 / 2 / 3 The most severely disrupted of the three mutants is termed the severe mutant. Mutations in the vacuolar Pi influx transporter significantly affect phosphorus homeostasis within plants, thereby impacting normal plant growth.
[0081] Example 5: Mutation of vacuolar phosphate influx transporters altered the tissue distribution of phosphate in rice.
[0082] Changes in the expression of vacuolar phosphate transporters can lead to changes in vacuolar phosphorus concentration, which in turn can cause changes in cytoplasmic phosphorus concentration. These changes in cytoplasmic phosphorus concentration can alter the redistribution of phosphorus within the body. Using the method described in Example 4, wild-type Nipponbare rice (NIP) and the mutant lines screened in Example 3 (…) were… Figure 4 and osvpi1 / 3 The cells were cultured to the four-leaf stage, and the Pi content in four leaves at the 1-, 2-, 3-, and 4-leaf stages was determined using the method described in Example 4. The results are shown in [Figure 4]. osvpi1 / 2 / 3 As shown.
[0083] osvpi1 / 3 Double mutant and The three mutants exhibited significant changes in the allocation of Pi in the aboveground parts. Normally, in wild-type rice, most Pi is stored in the epidermal and mesophyll cells of mature leaves, with lower Pi concentrations in young leaves. However, in the severe mutant (…),… and osvpi 1 / 2 / 3 The concentration of Pi in mature leaves was significantly reduced, while the concentration of Pi in young leaves was significantly increased. Figure 4 (A, B) osvpi 1 / 3 Phosphorus poisoning phenotypes were observed in the third and fourth leaves, while osvpi 1 / 2 / 3 All leaves showed phosphorus poisoning phenotype ( Figure 4(A and B). During the long-distance transport from the underground to the aboveground parts, the absence of vacuolar phosphate influx transporters in the severely mutants results in the loss of the vacuoles' ability to absorb Pi. As a result, the mature leaves cannot store large amounts of Pi in the xylem sap. Therefore, more Pi in the xylem sap is passively transported to the newly grown young leaves.
[0084] After the roots absorb Pi from the soil environment, it is transported long distances from the underground to the aboveground parts through the xylem of the vascular tissue. Then, phosphate transporters in each tissue distribute the Pi in the xylem to the corresponding tissues. As Pi in the xylem sap is continuously distributed to various tissues, the Pi concentration in the xylem gradually decreases. Pi concentration was determined by collecting xylem sap from two different locations (root-stem junction and young leaf sheath). Figure 4 (C), it was found that the Pi concentration in the xylem sap at the root-stem junction of the severely mutant was not significantly different from that of the wild type, while the Pi concentration in the xylem sap of the young leaf sheath was significantly higher than that of the wild type. Figure 4 E).
[0085] We also tested the Pi uptake efficiency, and the Pi uptake efficiency of the heavily mutant was not higher than that of the wild type. Figure 4 The result of the D indicates that the mutant roots did not absorb more Pi from the environment, which also confirms that the accumulation of Pi in young leaves was caused by abnormal Pi allocation. The absorption efficiency was calculated based on the decrease in Pi content in the hydroponic nutrient solution at different time points for different materials, divided by the fresh weight of the roots.
[0086] Example 6 osvpi 2 Mutants improve phosphorus use efficiency in rice
[0087] Through multi-year field trials (2020 and 2021) at multiple locations (Sanya, Hainan and Changxing, Zhejiang), wild-type Nipponbare rice (NIP) and the seven varieties screened in Example 3 were tested. osvpi Performance of mutants under various field phosphorus supply conditions.
[0088] 1. Grouping of experimental fields
[0089] Based on the amount of phosphate fertilizer applied and the Pi content in the topsoil, the experimental field was divided into four P concentration gradient plots: no phosphorus (NP), low phosphorus (LP), medium phosphorus (MP), and high phosphorus (HP). Each plot had an area of 5 square meters, with the topsoil Pi content and phosphate fertilizer application amount increasing in a gradient. Figure 5 A).
[0090] 2. Phenotype of sword leaves and seeds
[0091] Wild-type Nipponbare rice (NIP) and the 7 varieties screened in Example 3 osvpiThe mutants were planted in the above four plots, with 75 holes in each plot, planted 20cm apart, row 33cm apart, and 2 plants per hole.
[0092] For mature period osvpi The main yield traits of the mutants were compared. Leaf and seed phenotypes at maturity for each plot are shown below. Figure 5 As shown in B, plant height and number of tillers are shown below. Figure 5 C. Severe mutant osvpi 1 / 3 and osvpi 1 / 2 / 3 Significant phosphorus poisoning was observed in the flag leaf and glumes under high phosphorus conditions. The growth defects of the severely mutant were alleviated as the concentration of Pi in the soil decreased. Figure 5 (B). In HP and MP cells, severe mutants osvpi 1 / 3 and osvpi 1 / 2 / 3 The plant height and tiller number of the severely mutant were significantly lower than those of the wild type. In the LP and NP plots, the plant height and tiller number of the severely mutant were not significantly different from those of the wild type. Figure 5 (C).
[0093] 3. Seed setting rate and yield phenotype
[0094] Developing seeds are a major source of phosphorus and require sufficient phosphorus for high yields. Crops achieve optimal yields at suitable soil phosphorus concentrations.
[0095] Wild-type Nipponbare rice (NIP) and the rice screened in Example 3 osvpi mutant ( osvpi 1, osvpi 2, osvpi 3 and osvpi 1 / 2 / 3 The seed setting rate and yield were tested, and the seed phenotype is shown in the figure. Figure 6 For A, the seed setting rate is shown in the figure. Figure 6 For yield traits (grain weight per plant, number of grains per plant, and thousand-grain weight), see [link to relevant documentation]. Figure 6 C.
[0096] The results showed that the optimal concentration of Pi in paddy soil was inversely proportional to the absorption capacity of vacuolar Pi. In all four plots, the yield of severely mutants was significantly lower than that of wild-type, indicating that the Pi concentration in the soil of the LP plot was still too high and toxic to them. However, as the Pi concentration in the soil decreased, the yield of severely mutants increased. Figure 6 (B). In the cells of LP and NP, osvpi 2 The yield is higher than that of the wild type ( Figure 6 (B) In this mutant, more Pi is transferred to the ear, which helps maintain its yield under low phosphorus conditions, indicating that... osvpi 2 The study found that rice exhibits higher phosphorus use efficiency under low Pi concentration conditions, providing a new genetic strategy for improving PUE.
[0097] Example 7osvpi 2 Mutants in the main japonica cultivar Xiushui 134 can improve phosphorus utilization efficiency
[0098] In order to determine whether the knockout OsVPI2 can improve the phosphorus utilization efficiency of the main rice cultivars, this embodiment uses the method of examples 1 and 2 to introduce the knockout osvpi 2 mutation into the main japonica cultivar Xiushui 134 in Zhejiang Province, and obtain two osvpi 2 gene knockout mutant lines vpi 2(+T) and vpi 2(+5), and using the method of example 6, plant under low phosphorus (field fertilization amount and soil phosphorus concentration see Figure 5 A in the middle of the field LP) condition, detect tillering and yield per plant, the results show that the tillering (A, B) Figure 7 and yield per plant (C) Figure 7 of the wild type are higher.
Claims
1. A kind OsVPI2 Application of genes in the construction of phosphorus-efficient rice.
2. Use according to claim 1, wherein The application is to knock out a gene in the genome of rice OsVPI2 gene.
3. The use according to claim 1, wherein The OsVPI2 The gene nucleotide sequence is shown as SEQ ID NO: 1 or SEQ ID NO:
2.
4. The use according to claim 1, wherein The application is to knockout gene editing of rice gene by using CRISPR / Cas9 gene editing technology OsVPI2 After constructing an expression vector carrying Cas9 protein and knockout target gene, the crop is transformed by using the technology of transforming plants by agrobacterium, so as to obtain genetically stable gene edited rice.