Proline hydroxylase controllable expression vector, construction method of proline hydroxylase expression controllable engineering bacteria and application of proline hydroxylase expression controllable engineering bacteria

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a proline hydroxylase controllable expression vector, a construction method of proline hydroxylase expression controllable engineering bacteria and application of the proline hydroxylase expression controllable engineering bacteria. The invention constructs a recombinant vector. The recombinant vector comprises a Trp promoter, a ribosome binding site, a multiple cloning site and a marker gene, wherein the nucleotide sequence of a part of gene segments of the Trp promoter is as shown in SEQ ID NO. 2. By adopting the recombinant vector, a controllable expression vector of the target protein can be further constructed, the expression level of the target protein can be accurately controlled by changing the tryptophan concentration in a culture medium, high tryptophan inhibits expression, and low tryptophan promotes expression. The regulation mechanism allows reduction of ineffective expression of the target protein in a thallus growth stage, reduces metabolic load, can realize real-time regulation in different stages, and provides a solution for efficient production of high-quality target protein.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to a proline hydroxylase controllable expression vector, a construction method of proline hydroxylase expression controllable engineering bacteria and application thereof. BACKGROUND

[0002] Collagen is an important structural protein existing in skin, bone, teeth, cornea, tendon, ligament and various tissues and organs, and plays a role in supporting and protecting tissues of the body. Collagen presents a three-stranded helical structure in spatial structure, and in the body, collagen forms a reticular structure with tissues and cells by three-stranded helical structure to exert its biological effect, so that the biological activity and application of collagen largely depend on its natural three-stranded helical structure and reticular structure. In the synthesis process of collagen, the hydroxylation of proline and lysine is required to improve the stability and cross-linking effect of collagen. The hydroxylation of proline residues of collagen is crucial to the stability of the three-stranded helical structure of collagen and the formation of the reticular support structure.

[0003] Mammalian proline hydroxylase (P4H) is an enzyme with an alpha2beta2 tetramer arrangement, which is a key enzyme for synthesizing collagen and plays a role in the post-translational hydroxylation of proline residues in the collagen protein chain. In the heterologous microbial expression of recombinant humanized collagen, the lack or low content of proline hydroxylase in the microorganism will lead to low hydroxylation rate of amino acids in the synthesized collagen, which cannot form collagen with stable three-stranded helical structure and reticular support structure, and the continuous overexpression of proline hydroxylase in the microorganism will affect the synthesis yield of the target collagen.

[0004] In the prior art, although there are methods for preparing hydroxylated recombinant type III collagen by co-expressing proline hydroxylase derived from Saccharopolyspora RH1 and human collagen gene in Escherichia coli or expressing human proline hydroxylase P4H in yeast, these methods cannot realize controllable expression of proline hydroxylase at different growth stages of microorganisms, and there are problems of low hydroxylation rate of collagen due to low expression of proline hydroxylase, or low synthesis yield of target collagen due to continuous high expression of proline hydroxylase. SUMMARY

[0005] Therefore, an embodiment of the present application provides a recombinant vector, a proline hydroxylase controllable expression vector, a proline hydroxylase expression controllable engineering bacteria and a construction method thereof.

[0006] In one aspect, the present application provides a recombinant vector, which comprises a partial gene fragment of a Trp promoter, a ribosome binding site, a multiple cloning site and a marker gene.

[0007] The nucleotide sequence of the partial gene fragment of the Trp promoter is shown as SEQ ID NO. 2.

[0008] Another aspect of the present application provides a vector for controllable expression of proline hydroxylase, which comprises the recombinant vector and a gene encoding proline hydroxylase.

[0009] The Trp promoter of the recombinant vector can regulate the expression of the gene encoding proline hydroxylase.

[0010] Another aspect of the present application provides a construction method of the vector for controllable expression of proline hydroxylase, which comprises the step of inserting a gene encoding proline hydroxylase at the multiple cloning site of the recombinant vector.

[0011] In some embodiments, the alpha subunit and the beta subunit of the proline hydroxylase are connected by a flexible linker.

[0012] In some embodiments, the amino acid sequence of the flexible linker is (GGGGGS)n, wherein n≥2 and n is a positive integer.

[0013] In some embodiments, 2≤n≤6 and n is a positive integer.

[0014] In some embodiments, the amino acid sequence of the proline hydroxylase is shown as SEQ ID NO. 3.

[0015] In some embodiments, the sequence of the gene encoding proline hydroxylase is shown as SEQ ID NO. 4.

[0016] Another aspect of the present application provides an engineered bacterium with controllable expression of proline hydroxylase, which comprises the vector for controllable expression of proline hydroxylase.

[0017] In some embodiments, the engineered bacterium with controllable expression of proline hydroxylase comprises Escherichia coli.

[0018] Another aspect of the present application provides a construction method of the engineered bacterium with controllable expression of proline hydroxylase, which comprises:

[0019] The step of constructing the vector for controllable expression of proline hydroxylase and the step of transforming a strain with the vector for controllable expression of proline hydroxylase.

[0020] Another aspect of the present application provides a co-expression engineered bacterium co-transfected with a first expression vector and a second expression vector.

[0021] The first expression vector comprises the vector for controllable expression of the proline hydroxylase; and the second expression vector comprises the vector containing the coding gene of the recombinant humanized collagen COL3R4L.

[0022] In some embodiments, the amino acid sequence of the recombinant humanized collagen COL3R4L is shown in SEQ ID NO. 6.

[0023] In some embodiments, the gene sequence coding the recombinant humanized collagen COL3R4L is shown in SEQ ID NO. 5.

[0024] In some embodiments, the co-expression engineering bacteria comprises Escherichia coli.

[0025] Another aspect of the present application provides a recombinant humanized collagen COL3R4L, the amino acid sequence of which is shown in SEQ ID NO. 6.

[0026] Another aspect of the present application provides a method for preparing a recombinant humanized collagen, which comprises: culturing the co-expression engineering bacteria; and isolating the recombinant humanized collagen from the obtained culture.

[0027] In some embodiments, the culture system used for culturing comprises LB medium and tryptophan.

[0028] In some embodiments, the concentration of the tryptophan in the culture system is 5 mM-10 mM.

[0029] In some embodiments, an inducer is added during the culturing process.

[0030] In some embodiments, the inducer comprises IPTG; or / and, the concentration of the inducer is 0.8 mM-1.2 mM.

[0031] In some embodiments, the temperature for induction is 14°C-18°C, and the length of induction is 20 h-24 h.

[0032] In some embodiments, the isolating further comprises a step of purifying.

[0033] In some embodiments, the purifying comprises: purifying using a Ni-NTA column.

[0034] Another aspect of the present application provides the use of the recombinant humanized collagen in products containing the recombinant humanized collagen.

[0035] In some embodiments, the products containing the recombinant humanized collagen comprise one or more of daily cleaning products, home care products, and beauty and skin care products.

[0036] The application constructs a recombinant vector comprising a Trp promoter, a ribosome binding site, a multiple cloning site and a marker gene; wherein the nucleotide sequence of the partial gene fragment of the Trp promoter is shown in SEQ ID NO. 2. The recombinant vector can be used to further construct a controllable expression vector of the target protein. By changing the concentration of tryptophan in the culture medium, the expression level of the target protein can be accurately controlled. High tryptophan inhibits expression, and low tryptophan promotes expression. This regulation mechanism allows to reduce the invalid expression of the target protein during the growth stage of the bacteria, reduces the metabolic load, and can be real-time regulated at different stages, providing a solution for efficient production of high-quality target proteins. BRIEF DESCRIPTION OF DRAWINGS

[0037] In order to more clearly illustrate the technical solutions in the embodiments of the application, more completely understand the application and its beneficial effects, the drawings needed to be used in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0038] Figure 1 A schematic diagram of the vector plasmid pETrp1 prepared in the application;

[0039] Figure 2 SDS-PAGE results of P4H(α-β) enzyme synthesized by pETrp-P4H(α-β)-BL21(DE3) strain in conventional LB medium and LB medium added with 10 mM tryptophan, respectively;

[0040] Figure 3 Comparison of SDS-PAGE results of humanized collagen expressed by pETrp-P4H(α-β)-BL21(DE3) strain in conventional LB medium and LB medium added with 5-10 mM tryptophan, respectively;

[0041] Figure 4 SDS-PAGE and chromatographic purity detection results of recombinant humanized collagen COL3R4L prepared in the application;

[0042] Figure 5 Observation results of recombinant humanized collagen COL3R4L solution prepared in an embodiment of the application and COL3R4L solution of Comparative Example 1 under a freeze scanning electron microscope. DETAILED DESCRIPTION

[0043] The application will be described in further detail below with reference to the embodiments and examples. It should be understood that these embodiments and examples are only used to explain the application and not intended to limit the scope of the application. The purpose of providing these embodiments and examples is to make the disclosure of the application more thoroughly and comprehensively understood. It should also be understood that the application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various changes or modifications without departing from the spirit and scope of the application, and the equivalent forms obtained by such changes or modifications also fall within the protection scope of the application. In addition, in the following description, a large number of specific details are given in order to provide a more complete understanding of the application. It should be understood that the application can be implemented without one or more of these details.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0045] Unless otherwise indicated or in contradiction, the terms or phrases used herein have the following meanings:

[0046] The selection range of the terms "and / or", "or / and", "and / or" used herein includes any one of two or more related listed items, and also includes any and all combinations of the related listed items, which includes any two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", "and / or", it should be understood that in this application, the technical solution undoubtedly includes the technical solution connected by "logical and", and also undoubtedly includes the technical solution connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For another example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C and D (i.e. the technical solution connected by "logical or"), and also includes any and all combinations of A, B, C and D, i.e. includes the combination of any two or any three of A, B, C and D, and also includes the four-item combination of A, B, C and D (i.e. the technical solution connected by "logical and").

[0047] In this application, "multiple", "various", "multiple times", "multiple" and the like are used without specific limitation, which means greater than or equal to 2 in quantity. For example, "one or more" means one or more than two.

[0048] The "combination thereof", "any combination thereof", "any combination thereof" and the like used herein include all suitable combinations of any two or more listed items.

[0049] In the present application, the term "suitable" in "suitable combination", "suitable manner", "any suitable manner" and the like means that the technical solution of the present application can be implemented, the technical problem of the present application can be solved, and the intended technical effect of the present application can be achieved.

[0050] In the present application, "further", "still further", "in particular" and the like are used for description purposes to indicate differences in content, but should not be understood as limiting the scope of protection of the present application.

[0051] In the present application, "optionally", "optional" and "optional" mean that it can or can not be present, i.e. it means that it is selected from either of the two parallel schemes "has" or "has not". If there are multiple "optional" in a technical solution, and there is no contradictory or mutual restrictive relationship, each "optional" is independent.

[0052] In the present application, the technical features described in an open manner include both the closed technical solution consisting of the listed features and the open technical solution including the listed features.

[0053] In the present application, with respect to a numerical interval (i.e. a numerical range), if not otherwise specified, the optional numerical distribution within the above numerical interval is considered to be continuous, and includes both numerical end points (i.e. the minimum value and the maximum value) of the numerical range and every numerical value between the two numerical end points. If not otherwise specified, when a numerical interval only points to integers within the numerical interval, including both end point integers of the numerical range and every integer between the two end point integers, in the present application, it is equivalent to directly listing each integer, for example, t is an integer selected from 1 to 10, which means that t is any integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe a feature or a characteristic, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed in the present application should be understood to include any and all sub-ranges subsumed therein.

[0054] In the present application, the temperature parameter, if not otherwise specified, allows for constant temperature treatment and also allows for variation within a certain temperature interval. It should be understood that the constant temperature treatment allows for fluctuations within the accuracy range controlled by the instrument. Fluctuations within a range of, for example, ±5°C, ±4°C, ±3°C, ±2°C, ±1°C are allowed.

[0055] In the present application, (w / w) and wt% both represent weight percentage, (v / v) represents volume percentage, and (w / v) represents mass volume percentage.

[0056] All the documents mentioned in the present application are cited in the present application as references, as if each document is cited as a reference individually. Unless and to the extent that the documents cited in the present application conflict with the purpose and / or technical solutions of the present application, the cited documents are cited in the present application in their entirety, in all purposes. When the present application refers to the cited documents, the definitions of the relevant technical features, terms, names, phrases, etc. in the cited documents are also cited in the present application. When the present application refers to the cited documents, the examples, preferred modes of the relevant technical features cited are also incorporated into the present application as references, but limited to the implementation of the present application. It should be understood that when the cited contents conflict with the description in the present application, the present application is for reference or is modified adaptively according to the description in the present application.

[0057] In order to solve the problem that the expression of proline hydroxylase enzyme cannot be controlled at different growth stages in the heterologous microbial expression of recombinant humanized collagen, the present application provides an engineering bacterium with controllable expression of proline hydroxylase enzyme and its application in the preparation of recombinant humanized collagen with a network structure.

[0058] During the growth of microorganisms, by adjusting the concentration of tryptophan in the culture medium, the expression of proline hydroxylase can be controlled at a specific stage, which not only ensures sufficient hydroxylase activity, but also avoids the influence of excessive expression of the enzyme on the synthesis of target collagen.

[0059] Based on this, the present application provides a recombinant vector, which comprises a partial gene fragment of a Trp promoter, a ribosome binding site, a multiple cloning site and a marker gene.

[0060] The nucleotide sequence of the partial gene fragment of the Trp promoter is shown in SEQ ID NO. 2.

[0061] The present application provides a construction method of the above-mentioned recombinant vector, which comprises the step of connecting the partial gene fragment of the Trp promoter with the linearized vector skeleton of the pET vector.

[0062] In some embodiments, the pET vector comprises a pET-28a(+) vector.

[0063] Specifically, it comprises the following steps: using a restriction enzyme to cut the pET vector to obtain a linearized vector skeleton; providing a partial gene fragment of a Trp promoter, the two ends of the partial gene fragment being respectively provided with enzyme cutting sticky ends of a restriction enzyme; connecting the linearized vector skeleton with the gene fragment of the Trp promoter to construct a recombinant vector.

[0064] In some embodiments, the method further comprises transforming the recombinant vector into a host cell and screening to obtain a positive clone comprising the recombinant vector. In some embodiments, the method further comprises transforming the recombinant vector into a host cell and screening to obtain a positive clone comprising the recombinant vector.

[0065] In some embodiments, the restriction enzymes include one or both of BglII and XbaI.

[0066] Another aspect of the present application provides a vector for controllable expression of proline hydroxylase, which includes the recombinant vector and a gene encoding proline hydroxylase.

[0067] The Trp promoter of the recombinant vector can regulate the expression of the gene encoding proline hydroxylase.

[0068] Another aspect of the present application provides a method for constructing the vector for controllable expression of proline hydroxylase, which includes the step of inserting a gene encoding proline hydroxylase into the multiple cloning site of the recombinant vector.

[0069] In some embodiments, the alpha subunit and the beta subunit of the proline hydroxylase are connected by a flexible linker.

[0070] In some embodiments, the amino acid sequence of the flexible linker is (GGGGGS)n, where n≥2 and n is a positive integer. The design of the flexible linker with a specific length allows the alpha subunit and the beta subunit to maintain an appropriate distance and conformation, which is conducive to the formation of an alpha2beta2 tetramer structure with high activity and improves the catalytic efficiency of the proline hydroxylase.

[0071] In some embodiments, 2≤n≤6 and n is a positive integer.

[0072] In some embodiments, the amino acid sequence of the proline hydroxylase is shown in SEQ ID NO. 3.

[0073] In some embodiments, the gene sequence encoding the proline hydroxylase is shown in SEQ ID NO. 4.

[0074] Another aspect of the present application provides a co-expression vector, which is characterized in that it includes the vector and a vector containing a gene encoding recombinant humanized collagen COL3R4L.

[0075] An aspect of the present application provides an engineered bacterium with controllable expression of proline hydroxylase, which is constructed by transforming Escherichia coli with a recombinant vector containing a gene of proline hydroxylase and a promoter regulating the expression of the gene of proline hydroxylase.

[0076] The promoter includes a Trp promoter. The Trp promoter is a tryptophan-regulated promoter. In E. coli, when the concentration of tryptophan is high, the Trp promoter is inhibited, and gene expression is reduced; when the concentration of tryptophan is low, the Trp promoter is activated, and gene expression is enhanced. By regulating the concentration of tryptophan in the culture medium, the expression intensity of proline hydroxylase can be accurately controlled, and its controllable expression in different stages of microbial growth can be realized.

[0077] The present application constructs an engineered bacterium with controllable expression of proline hydroxylase (P4H). The engineered bacterium uses E. coli as the host, and the expression plasmid carried by the bacterium uses a Trp promoter to regulate the coding gene of P4H. By changing the concentration of tryptophan in the culture medium, the expression level of P4H can be accurately controlled: high tryptophan inhibits expression, and low tryptophan promotes expression. This regulation mechanism allows the reduction of invalid expression of P4H during the growth stage of the bacterium, reducing the metabolic load; during the collagen synthesis stage, the expression of P4H is timely increased to ensure sufficient hydroxylation of proline. This effectively balances the yield and hydroxylation rate of collagen, providing a solution for efficient production of high-quality collagen.

[0078] In some embodiments, the alpha subunit and the beta subunit of the proline hydroxylase are connected by a flexible linker. In order to ensure that the mammalian proline hydroxylase (P4H) can form a high-activity alpha2beta2 tetramer configuration, the alpha subunit and the beta subunit are connected by a flexible linker to form P4H(alpha-beta). This structural design is conducive to maintaining the activity of the enzyme and improving the hydroxylation efficiency of collagen.

[0079] In some embodiments, the amino acid sequence of the proline hydroxylase is shown in SEQ ID NO. 3. This amino acid sequence is an optimized proline hydroxylase sequence with higher catalytic activity and stability, which can effectively catalyze the hydroxylation reaction of proline residues in collagen.

[0080] SEQ ID NO. 3: GTISRGELPGTKYQAMLSVDDCFGMGRSAYNEGDYYHTVLWMEQVLKQLDAGEEATTTKSQVLDYLSYAVFQLGDLHRALELTRRLLSLDPSHERAGGNLRYFEQLLEEEREKTLTNQTEAELATPEGIYERPGGGGGSGGGGGSGPAATTLPDGAAAESLVESSEVAVIGFFKDVESDSAKQFLQAAEAIDDIPFGITSNSDVFSKYQLDKDGVVLFKKFDEGRNNFEGEVTKENLLDFIKHNQLPLVIEFTEQTAPKIFGGEIKTHILLFLPKSVSDYDGKLSNFKTAAESFKGKILFIFIDSDHTDNQRILEFFGLKKEECPAVRLITLEEEMTKYKPESEELTAERITEFCHRFLEGKIKPHLMSQELPEDWDKQPVKVLVGKNFEDVAFDEKKNVFVEFYAPWCGHCKQLAPIWDKLGETYKDHENIVIAKMDSTANEVEAVKVHSFPTLKFFPASADRTVIDYNGERTLDGFKKFLESGGQDGAG.

[0081] The nucleotide sequence encoding P4H (a-p) is shown in SEQ ID NO. 4:

[0082]

[0083] In some embodiments, the Trp promoter comprises a partial nucleotide sequence as shown in SEQ ID NO. 1.

[0084] SEQ ID NO. 1:

[0085] CAAATATTCTGAAATGAGCTGTTGACAATTAATCATCGAACTAGTTAACTAGTACGCAAGTTCACGTAAAAAGGGTATCGACAATGAAAGCAATTTTCGTACTGAAAGGTTGGTGGCGCACTTCCTGAAACGGGCAGTGTATTCACCATGCGTAAAGCAATCAGATACCCAGCCCGCCTAATGA.

[0086] In some embodiments, the nucleotide sequence of the Trp promoter is as shown in SEQ ID NO. 2.

[0087] SEQ ID NO. 2: AGATCTATATTCTGAAATGAGCTGTTGACAATTAATCATCGAACTAGTTAACTAGTACTCTAGA.

[0088] Another aspect of the present application provides a method for constructing the engineered bacteria with controllable expression of proline hydroxylase, comprising:

[0089] The step of constructing the recombinant vector, and the step of transforming the E. coli with the recombinant vector.

[0090] Specifically, the method comprises the following steps: Step 1: constructing a vector plasmid pETrp1 containing a Trp promoter sequence; Step 2: inserting a gene sequence encoding proline hydroxylase P4H (a-β) into the vector plasmid pETrp1 to form a recombinant plasmid pETrp-P4H (a-β); Step 3: transforming the recombinant plasmid pETrp-P4H (a-β) into E. coli competent cells, and screening to obtain an E. coli expression system with controllable expression of proline hydroxylase. The method constructs an expression plasmid containing a Trp promoter and a proline hydroxylase gene through molecular cloning technology, and transforms it into E. coli host cells to obtain an engineered strain capable of regulating the expression of proline hydroxylase by the concentration of tryptophan.

[0091] Further, the step 1 comprises: step 1.1: using BglII and XbaI restriction endonuclease to cut the pET-28a(+) plasmid, purifying the linearized gene fragment; step 1.2: synthesizing the Trp promoter gene fragment, using BglII and XbaI restriction endonuclease to cut, and purifying the Trp promoter gene fragment with sticky ends; step 1.3: connecting the linearized gene fragment and the Trp promoter gene fragment, transforming the cloning competent cells, and screening the positive clones; and step 1.4: extracting and purifying the vector plasmid pETrp1 from the positive clones. The method inserts the Trp promoter sequence into the pET-28a(+) plasmid by restriction endonuclease cutting and ligation technology, and constructs the vector plasmid pETrp1 containing the Trp promoter.

[0092] Further, the step 2 comprises: step 2.1: introducing the 5' and 3' ends of the gene sequence encoding the proline hydroxylase P4H(α-β) into the BamHI and EcoRI enzyme cutting sites, respectively; step 2.2: double enzyme cutting the gene sequence encoding P4H(α-β) and the vector plasmid pETrp1 with BamHI and EcoRI; step 2.3: connecting the enzyme-cut gene fragment and the linear plasmid, transforming the competent cells, screening the positive clones, and extracting the recombinant plasmid pETrp-P4H(α-β). The method inserts the gene sequence encoding the proline hydroxylase P4H(α-β) into the vector plasmid pETrp1 by restriction endonuclease cutting and ligation technology, and constructs the recombinant plasmid pETrp-P4H(α-β) containing the Trp promoter and the proline hydroxylase gene.

[0093] Another aspect of the present application provides a co-expression engineering bacterium which is co-transfected with a first expression vector and a second expression vector; the first expression plasmid comprises the proline hydroxylase controllable expression vector, and the second expression plasmid comprises the gene sequence encoding the recombinant humanized collagen COL3R4L.

[0094] In some embodiments, the co-expression engineering bacterium comprises Escherichia coli.

[0095] In some embodiments, the gene sequence encoding the recombinant humanized collagen COL3R4L is shown in SEQ ID NO. 5.

[0096] SEQ ID NO. 5: GGAGAAAGGGGTGCCCCTGGGTTCCGAGGACCTGCTGGACCAAATGGCATCCCAGGAGAAAAGGGTCCTGCTGGAGAGCGTGGTGCTCCAGGCCCTGCAGGGCCCAGAGGAGCTGCTGGAGAACCTGGCAGAGATGGGAAACCAGGAGCTAACGGTCTCAGTGGAGAACGTGGTCCCCCTGGACCCCAGGGTCTTCCTGGTCTGGCTGGTACAGCTGGTGAACCTGGAAGAGATGGAAACCCTGGATCAGATGGTCTTCCAGGAGAAAGGGGTGCCCCTGGGTTCCGAGGACCTGCTGGACCAAATGGCATCCCAGGAGAAAAGGGTCCTGCTGGAGAGCGTGGTGCTCCAGGCCCTGCAGGGCCCAGAGGAGCTGCTGGAGAACCTGGCAGAGATGGGAAACCAGGAGCTAACGGTCTCAGTGGAGAACGTGGTCCCCCTGGACCCCAGGGTCTTCCTGGTCTGGCTGGTACAGCTGGTGAACCTGGAAGAGATGGAAACCCTGGATCAGATGGTCTTCCA.

[0097] In some embodiments, the recombinant humanized collagen COL3R4L has an amino acid sequence as set forth in SEQ ID NO. 6.

[0098] SEQ ID NO. 6:

[0099] GERGAPGFRGPAGPNGIPGEKGPAGERGAPGPAGPRGAAGEPGRDGKPGANGLSGERGPPGPQGLPGLAGTAGEPGRDGNPGSDGLPGERGAPGFRGPAGPNGIPGEKGPAGERGAPGPAGPRGAAGEPGRDGKPGANGLSGERGPPGPQGLPGLAGTAGEPGRDGNPGSDGLP.

[0100] Another aspect of the present application provides a method for constructing a recombinant humanized collagen, comprising: culturing the co-expression engineered bacteria; and isolating the recombinant humanized collagen from the resulting culture. The recombinant humanized collagen has a stable fibrous network structure in an aqueous solution.

[0101] Specifically comprising the following steps: step 1: constructing an expression plasmid pCo-COL3R4L containing a recombinant humanized collagen COL3R4L gene sequence; step 2: transforming the E. coli expression system of the first aspect of the application with the expression plasmid pCo-COL3R4L to obtain a recombinant humanized collagen E. coli; step 3: culturing the recombinant humanized collagen E. coli to induce expression of the recombinant humanized collagen COL3R4L; and step 4: purifying the recombinant humanized collagen COL3R4L. The method utilizes the proline hydroxylase expression controllable E. coli expression system constructed in the application, and controls the expression of proline hydroxylase by adjusting the concentration of tryptophan, so as to realize accurate control of the hydroxylation rate of collagen, and prepare the recombinant humanized collagen with stable triple helix structure and network structure.

[0102] In some embodiments, the culture system used in the culturing comprises LB medium and tryptophan.

[0103] In some embodiments, the concentration of the tryptophan in the culture system is 5 mM-10 mM. For example, the concentration is 5 mM, 6 mM, 7 mM, 8 mM, 9 mM or 10 mM, and any value in between.

[0104] In some embodiments, an inducer is added during the culturing.

[0105] In some embodiments, the inducer comprises IPTG.

[0106] In some embodiments, the temperature for the induction is 14°C-16°C, and the induction time is 20 h-24 h. For example, the temperature for the induction is 14°C, 15°C or 16°C, and any value in between, and for example, the induction time is 20 h, 21 h, 22 h, 23 h or 24 h, and any value in between.

[0107] In some embodiments, the isolating further comprises a purifying step.

[0108] In some embodiments, the purifying comprises: purifying the fusion protein with His tag using a Ni-NTA column, and removing the His tag using Tev enzyme.

[0109] Further, the step 3 comprises: step 3.1: inoculating the recombinant humanized collagen E. coli into LB medium, and culturing at 37°C until OD600 is 0.6-0.8; step 3.2: after ice bath for 15 min, adding 5-10 mM tryptophan and 1 mM IPTG inducer, and continuing to culture at 16°C for 20-24 hours; step 3.3: centrifuging to collect the bacterial cells, ultrasonic crushing, and centrifuging to collect the supernatant; step 3.4: purifying the His8-TrxA-Tev-COL3R4L protein through a Ni-NTA column; and step 3.5: removing the His8-TrxA-Tev tag protein through Tev enzyme cutting, and further purifying to obtain the humanized collagen molecule COL3R4L. The method can inhibit the overexpression of proline hydroxylase by adding an appropriate amount of tryptophan in the induction stage, while inducing the expression of collagen, so as to ensure the hydroxylation rate of collagen and improve the synthesis yield of collagen.

[0110] Another aspect of the present application provides the recombinant humanized collagen prepared by the construction method of the recombinant humanized collagen.

[0111] Another aspect of the present application provides the application of the recombinant humanized collagen in preparing a product containing the recombinant humanized collagen. The recombinant humanized collagen has high hydrophilicity and reticular structure characteristics, is beneficial to film formation on the skin surface and then water locking and moisturizing, and can be widely applied in the field of cosmetics.

[0112] In some embodiments, the product containing the recombinant humanized collagen comprises one or more of daily washing products, household care products, and beauty and skin care products.

[0113] The present application realizes the accurate regulation of the expression intensity of proline hydroxylase by constructing an expression plasmid containing a Trp promoter, and solves the problem that the proline hydroxylase cannot be controllably expressed in different growth stages of microorganisms in the prior art.

[0114] The present application makes the proline hydroxylase only expressed in a specific stage by adjusting the concentration of tryptophan in the culture medium, so as to ensure the hydroxylation rate of collagen and avoid the influence of continuous high expression of proline hydroxylase on the synthesis yield of collagen. The recombinant humanized collagen prepared by the present application can form a stable reticular structure in an aqueous solution, has superior water locking and moisturizing and supporting capabilities, and has a broad application prospect in the field of cosmetics and the like.

[0115] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that these examples are only used to illustrate but not to limit the scope of the present application. The experimental methods in the following examples without specific conditions are preferred to refer to the instructions given in the present application, and can also be carried out according to the experimental manuals or conventional conditions in the art, or according to the conditions suggested by the manufacturers, or according to the experimental methods known in the art.

[0116] In the following specific examples, the measurement parameters of the raw material components may have slight deviations within the weighing accuracy range if not otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operation accuracy are allowed.

[0117] It should be understood that the size of the sequence number of each process described above in various embodiments of the present application does not mean the order of execution, and the execution order of each process should be determined according to its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0118] Example 1 Construction of vector plasmid pETrp1

[0119] The present example provides a method for constructing a vector plasmid pETrp1 containing a Trp promoter sequence, a ribosome binding site (RBS) sequence, a multiple cloning site (MCS) sequence, and a kanamycin resistance gene (KanR) sequence.

[0120] The raw materials for constructing the vector plasmid pETrp1 include: pET-28a(+) plasmid (trade name pET-28a(+), purchased from Merck Company, item number: 69864-MM), Trp promoter gene fragment (the sequence is shown as SEQ ID NO. 2, synthesized by Shanghai Biosciences Co., Ltd.), BglII restriction endonuclease (trade name BglII, purchased from Thermo Fisher Scientific Company, item number: ER0081), XbaI restriction endonuclease (trade name XbaI, purchased from Thermo Fisher Scientific Company, item number: ER0681), T4 DNA ligase (trade name T4 DNA Ligase, purchased from Takara Company, item number: 2011A), XL1-Blue competent cells (trade name XL1-Blue Competent Cells, purchased from Agilent Technologies Company, item number: 200249), kanamycin (trade name Kanamycin, purchased from Merck Company, item number: E004000).

[0121] 1.1, Select pET-28a(+) plasmid for modification, respectively, use BglII and XbaI restriction endonuclease to cut pET-28a(+) plasmid, obtain two linearized gene fragments; the two gene fragments obtained by enzyme cutting are separated by agarose gel electrophoresis, and the linearized gene fragments with enzyme cutting site sticky end with a length of about 5300bp are purified by cutting gel.

[0122] 1.2, Synthesize Trp promoter sequence, the sequence is shown as SEQ ID NO.2, respectively, use BglII and XbaI restriction endonuclease to cut the gene fragment shown in SEQ ID NO.2, and purify the Trp promoter gene fragment with enzyme cutting site sticky end by agarose gel electrophoresis.

[0123] 1.3, The linearized gene fragment in 1.1 and the Trp promoter gene fragment cut in 1.2 are connected by enzyme connection, the connection liquid is transformed into competent cells, the transformation liquid is coated on LB plate containing kanamycin (Kan), and the positive clones are screened and verified.

[0124] 1.4, pick the positive clones for amplification culture, extract and purify to obtain the vector plasmid pETrp1.

[0125] The final obtained vector plasmid pETrp1 is shown as Figure 1 , which contains Trp promoter sequence, ribosome binding site (RBS) sequence, multiple cloning site (MCS) sequence and kanamycin resistance gene (KanR) sequence.

[0126] Example 2 Construction of proline hydroxylase controllable expression vector plasmid pETrp-P4H(α-β)

[0127] The embodiment provides a construction method of proline hydroxylase controllable expression expression plasmid pETrp-P4H(α-β), wherein the Trp promoter which regulates the synthesis strength of proline hydroxylase can be adjusted by the concentration of tryptophan.

[0128] 2.1, In order to ensure that mammalian prolyl 4-hydroxylase (P4H) can form a high-activity α2β2 tetramer configuration, the α subunit and the β subunit are connected through a flexible linker to form P4H(α-β), wherein the P4H(α-β) comprises the sequence shown in SEQ ID NO. 3, and the flexible linker is selected from GGGGGSGGGGGS.

[0129] 2.2, The gene sequence encoding P4H(α-β) is optimized, and 5' and 3' ends are respectively provided with BamHI and EcoRI enzyme cutting sites, and the optimized gene sequence is synthesized by Shanghai Biosciences Co., Ltd., and is shown as SEQ ID NO. 4.

[0130] 2.3, double enzyme digestion of the gene sequence of P4H (a-b) in 2.2 and the vector plasmid pETrpl with BamHI and EcoRI enzymes, and separate the enzyme digestion solution by agarose gel electrophoresis, respectively, and purify the linear plasmid and the gene fragment of P4H (a-b) after enzyme digestion.

[0131] 2.4, link the two purified gene fragments in 2.3 by enzyme ligation, transform the ligation solution with E. coli XL1-Blue competent cells, spread the transformation solution on LB plates containing kanamycin (Kan), screen positive clones and verify, amplify the sequence of the correct positive clone, and extract the recombinant plasmid pETrp-P4H (a-b).

[0132] Example 3 Preparation of a proline hydroxylase controllable expression E. coli expression system

[0133] 3.1, transform the recombinant plasmid pETrp-P4H (a-b) into BL21 (DE3) E. coli competent cells, and screen the positive clones of E. coli transformed with the pETrp-P4H (a-b) plasmid by kanamycin (Kan) plates.

[0134] 3.2, select a single colony of the positive clone, incubate it in LB medium containing kanamycin (Kan) overnight, centrifuge to collect the bacterial cells, resuspend the bacterial cells with fresh sterilized LB medium, and obtain the proline hydroxylase controllable expression E. coli.

[0135] 3.3, add 50% glycerol to the resuspension liquid in a volume ratio of 1:1 to form a proline hydroxylase controllable expression E. coli glycerol bacteria, and store it at -20°C.

[0136] 3.4, pick a single colony of the positive clone on the plate in 3.1 and add it into 10 mL LB medium (regular) and 10 mL LB medium (additional 10 mM tryptophan), respectively, and incubate them at 37°C for 16 h, and centrifuge to collect the bacterial cells.

[0137] 3.5, resuspend the bacterial cells, ultrasonically break them, centrifuge to collect the broken supernatant, and detect the supernatant by SDS-PAGE.

[0138] The results are shown in Figure 2 Figure 1, there is a clear overexpression band of proline hydroxylase in the supernatant of the bacterial cells broken in the LB regular medium, indicating that the proline hydroxylase controllable expression E. coli expression system is successfully constructed, and there is almost no proline hydroxylase band in the supernatant of the bacterial cells broken in the LB medium (high tryptophan content), indicating that the additional 10 mM tryptophan can well inhibit the overexpression of proline hydroxylase.

[0139] Example 4 Construction of recombinant humanized collagen expression plasmid pCo-COL3R4L

[0140] 4.1, select water-soluble high hydrophilic human collagen fragments, and design and develop recombinant humanized collagen molecule COL3R4L by repeated connection.

[0141] 4.2, add nucleotide sequence encoding HHHHHHHHH-thioredoxin A amino acid sequence-ENLYFQ (His8-TrxA-Tev) to the 5' end of the nucleotide sequence encoding COL3R4L molecule, design the gene sequence of His8-TrxA-Tev-COL3R4L and optimize it. The codon-optimized humanized collagen molecule COL3R4L nucleotide sequence is shown in SEQ ID NO. 5, and the amino acid sequence is shown in SEQ ID NO. 6.

[0142] 4.3, introduce BamHI and HindIII restriction sites at the 5' and 3' ends of the His8-TrxA-Tev-COL3R4L gene sequence, respectively, and integrate the gene sequence into the pCold II vector plasmid by enzyme digestion and ligation. The recombinant humanized collagen expression plasmid pCo-COL3R4L is constructed.

[0143] Example 5 Preparation of recombinant humanized collagen COL3R4L using pETrp-P4H (α-β)-BL21 (DE3) E. coli expression system

[0144] 5.1, prepare the pETrp-P4H (α-β)-BL21 (DE3) E. coli constructed in Example 3 into competent cells, and transform the competent pETrp-P4H (α-β)-BL21 (DE3) with the expression plasmid pCo-COL3R4L constructed in Example 4. Successfully transformed pCo-COL3R4L positive clones are selected on plates containing both ampicillin (Amp) and kanamycin (Kan) antibiotics.

[0145] 5.2, pick a single colony of the positive clone and incubate it in LB medium at 37°C overnight; inoculate the bacterial solution in a 1:100 ratio for scale-up culture, incubate at 37°C until OD600 is 0.8, then ice bath for 15 min, add 10 mM tryptophan, add 1 mM IPTG, continue to incubate at 16°C for 24 hours, and centrifuge to collect the bacterial cells.

[0146] 5.3, resuspend the bacterial cells and sonicate them, centrifuge the broken solution at high speed, and collect the supernatant; the supernatant is purified by Ni-NTA column to obtain His8-TrxA-Tev-COL3R4L protein.

[0147] 5.4, Tev enzyme digestion removes His8-TrxA-Tev tag protein, further purification to obtain recombinant humanized collagen protein molecule COL3R4L.

[0148] Figure 3 The results show that without adding tryptophan in the induction stage, P4H(a-b) protein is overexpressed, which affects the synthesis amount of the target recombinant humanized collagen protein; in the experimental group with the addition of 10 mM tryptophan in the induction stage, the overexpression of P4H(a-b) protein is inhibited, and the synthesis amount of the target recombinant humanized collagen protein is significantly higher than that of the group without addition.

[0149] Figure 4 The results of SDS-PAGE and chromatogram show that the recombinant humanized collagen protein COL3R4L is successfully obtained, the band is single, and the purity is high.

[0150] Comparative Example 1: The recombinant humanized collagen protein COL3R4L is prepared using pETrp-BL21(DE3) E. coli expression system without P4H(a-b) protein coding gene

[0151] In this comparative example, the expression plasmid of proline hydroxylase (P4H) is not added, and other components and processes are the same as those in Example 5.

[0152] The pETrp-BL21(DE3) E. coli without P4H(a-b) coding gene is prepared into competent cells, and the expression plasmid pCo-COL3R4L constructed in Example 4 is transformed into the competent pETrp-BL21(DE3). The positive clones successfully transformed with pCo-COL3R4L are screened on the plate containing ampicillin (Amp) and kanamycin (Kan) double antibiotics.

[0153] The positive clone single colony is picked and cultured in LB medium at 37°C overnight; the bacterial liquid is inoculated for amplification at 1:100, and cultured at 37°C until OD600 is 0.8. After ice bath for 15 min, 10 mM tryptophan and 1 mM IPTG are added, and the culture is continued at 16°C for 24 hours. The bacterial body is collected by centrifugation.

[0154] The bacterial body is resuspended and ultrasonically broken, the broken liquid is centrifuged at high speed, and the supernatant is collected; the supernatant is purified by Ni-NTA column to obtain His8-TrxA-Tev-COL3R4L protein.

[0155] The His8-TrxA-Tev tag protein is removed by enzyme digestion, and the recombinant humanized collagen protein molecule COL3R4L is further purified.

[0156] Example 6: Determination of the Proline Hydroxylation Rate of Recombinant Humanized Collagen Protein

[0157] Hydroxylation rate determination: Hydroxyproline content determination kit (Solebo, item number: BC0250) was used to calculate the hydroxylation rate. The recombinant humanized collagen samples obtained in Example 5 and Comparative Example 1 were both prepared into a concentration of 2 mg / ml. The samples were subjected to acid hydrolysis to produce free HYP, which was further oxidized by chloramine T, and the oxidation product was reacted with p-dimethylaminobenzaldehyde to produce a red compound with a characteristic absorption peak at 560 nm. The hydroxyproline content was calculated by determining the absorbance of the sample hydrolysate at 560 nm. According to the calculated hydroxyproline content, the proportion of hydroxyproline in the sample relative to the total proline was further calculated, and the results are shown in Table 1.

[0158] Table 1

[0159]

[0160] The results show that the proline hydroxylation rate of the recombinant humanized collagen sample in Example 5 is significantly higher than that of Comparative Example 1, and is closer to the proline hydroxylation rate of natural human collagen (about 60-65%).

[0161] Example 7 Morphology observation of recombinant humanized collagen COL3R4L in aqueous solution

[0162] The recombinant humanized collagen COL3R4L purified in Example 5 and Comparative Example 1 was concentrated to 10%, and an appropriate amount of sample was taken on the cold stage sample stage of the cryogenic scanning electron microscope. The cold stage was quickly frozen, and the cold stage was transferred to the electron microscope sample chamber, vacuumed, and adjusted to the appropriate field of view and magnification for observation.

[0163] Figure 5 The results of the cryogenic scanning electron microscope show that the COL3R4L obtained in Example 5 can spontaneously form a regular network structure in aqueous solution, with good spatial structure and support, as shown in Figure 5 (left), while the COL3R4L obtained in Comparative Example 1 failed to form a regular network structure in aqueous solution, as shown in Figure 5 (right).

[0164] The recombinant humanized collagen COL3R4L molecule with stable network structure can provide strong support for the biological activity, mechanical support, and film-forming and moisturizing of collagen materials.

[0165] The above-described embodiments only express several implementation manners of the present application, facilitate specific and detailed understanding of the technical solutions of the present application, but cannot be understood as a limitation on the patent protection scope of the present application. It should be noted that, for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. In addition, it should be understood that, after reading the above teaching content of the present application, the skilled person in the art can make various modifications or modifications to the present application, and the equivalent forms obtained are also within the protection scope of the present application. It should also be understood that, on the basis of the technical solutions provided by the present application, the skilled person in the art obtains the technical solutions through logical analysis, reasoning or limited experiments, and all of them are within the protection scope of the appended claims of the present application. Therefore, the protection scope of the patent of the present application should be subject to the content of the appended claims, and the description can be used to explain the content of the claims.

Claims

1. A recombinant vector, characterized in that, The recombinant vector comprises a partial gene fragment of a Trp promoter, a ribosome binding site, a multiple cloning site, and a marker gene. The nucleotide sequence of the partial gene fragment of the Trp promoter is shown in SEQ ID NO.

2.

2. A vector for the controlled expression of proline hydroxylase, characterized in that, The recombinant vector comprises a partial gene fragment of a Trp promoter, a ribosome binding site, a multiple cloning site, and a marker gene. The Trp promoter of the recombinant vector can regulate the expression of the gene encoding the proline hydroxylase.

3. The method for constructing a vector for the controlled expression of proline hydroxylase according to claim 2, characterized in that, The recombinant vector comprises a partial gene fragment of a Trp promoter, a ribosome binding site, a multiple cloning site, and a marker gene. The recombinant vector comprises a partial gene fragment of a Trp promoter, a ribosome binding site, a multiple cloning site, and a marker gene. Optionally, the alpha subunit and the beta subunit of the proline hydroxylase are connected by a flexible linker. Optionally, the amino acid sequence of the flexible linker is (GGGGGS)n, wherein n≥2, and n is a positive integer. Optionally, 2≤n≤6, and n is a positive integer. Optionally, the amino acid sequence of the proline hydroxylase is shown in SEQ ID NO.

3. Optionally, the gene sequence encoding the proline hydroxylase is shown in SEQ ID NO.

4.

4. An engineered bacterium with controllable expression of proline hydroxylase, characterized in that, The recombinant vector comprises a partial gene fragment of a Trp promoter, a ribosome binding site, a multiple cloning site, and a marker gene. Optionally, the engineering bacteria with controllable expression of the proline hydroxylase comprise Escherichia coli.

5. The method for constructing the engineered proline hydroxylase expression controllable bacteria according to claim 4, characterized in that, The recombinant vector comprises a partial gene fragment of a Trp promoter, a ribosome binding site, a multiple cloning site, and a marker gene. The recombinant vector comprises a partial gene fragment of a Trp promoter, a ribosome binding site, a multiple cloning site, and a marker gene.

6. A co-expression engineering bacteria, characterized in that, The first expression vector comprises the vector with controllable expression of the proline hydroxylase as claimed in claim 2. The second expression vector comprises a vector containing a gene encoding a recombinant humanized collagen COL3R4L. Optionally, the amino acid sequence of the recombinant humanized collagen COL3R4L is shown in SEQ ID NO.

6. Optionally, the gene sequence encoding the recombinant humanized collagen COL3R4L is shown in SEQ ID NO.

5. Optionally, the co-expression engineering bacteria comprise Escherichia coli. The amino acid sequence of the recombinant humanized collagen is shown in SEQ ID NO.

6.

7. A recombinant humanized collagen, characterized in that, The recombinant vector comprises a partial gene fragment of a Trp promoter, a ribosome binding site, a multiple cloning site, and a marker gene.

8. A method for preparing a recombinant human-derived collagen, characterized by, Optionally, one or more of the following conditions are met: (1) The culture system used for the culture comprises LB medium and tryptophan. Optionally, the concentration of the tryptophan in the culture system is 5 mM - 10 mM. (2) An inducer is added during the culture. Optionally, the inducer comprises IPTG; or / and, the concentration of the inducer is 0.8 mM - 1.2 mM. (3) The temperature for the induction is 14℃ - 18℃, and the length of the induction is 20 h - 24 h. and (4) The isolation further comprises a purification step. Optionally, the purification comprises using a Ni-NTA column for purification.

9. Use of the recombinant humanized collagen as claimed in claim 7 in the preparation of a product containing the recombinant humanized collagen. ​ ​ 10. Use according to claim 9, characterized in that, The recombinant humanized collagen-containing product includes one or more of daily washing products, home care products, and beauty and skin care products.

Images